ID: 1112691698

View in Genome Browser
Species Human (GRCh38)
Location 13:101903616-101903638
Sequence CAGGGTGACTATAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112691694_1112691698 -10 Left 1112691694 13:101903603-101903625 CCTAAATATAGAGCAGGGTGACT 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1112691698 13:101903616-101903638 CAGGGTGACTATAGGGAAGGAGG 0: 1
1: 0
2: 0
3: 22
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112691698 Original CRISPR CAGGGTGACTATAGGGAAGG AGG Intronic
900132192 1:1091886-1091908 CAGGGCCACGACAGGGAAGGTGG + Intronic
900625204 1:3604810-3604832 CAGAGTGAGAATAGGGGAGGGGG + Intronic
901018693 1:6245369-6245391 CAGGGAGACTTTCGGGGAGGAGG - Exonic
901470749 1:9454790-9454812 CCGGGTGACTAAGGGGTAGGGGG - Intergenic
902991371 1:20189575-20189597 CAGGGTGCCTATCGGGTAGCTGG + Intronic
904011286 1:27392024-27392046 CAGGGTGACTATGCAGCAGGGGG - Intergenic
905089487 1:35417331-35417353 CAGGGTGAAGATACGGAAAGTGG - Intronic
905514956 1:38555839-38555861 CAGGGTTACTGGAGGGAAAGGGG + Intergenic
906744677 1:48213483-48213505 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
907629843 1:56069481-56069503 GAGGGTGAGTGTGGGGAAGGAGG + Intergenic
910048463 1:82946836-82946858 CATGGTAACTCTAGTGAAGGGGG + Intergenic
911759937 1:101602539-101602561 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
911983704 1:104597205-104597227 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
912815472 1:112825000-112825022 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
913594959 1:120366455-120366477 CAGTGTGACTACAGGGACAGAGG - Intergenic
914092309 1:144512531-144512553 CAGTGTGACTACAGGGACAGAGG + Intergenic
914306222 1:146421339-146421361 CAGTGTGACTACAGGGACAGAGG - Intergenic
914595828 1:149151469-149151491 CAGTGTGACTACAGGGACAGAGG + Intergenic
915312847 1:155013014-155013036 CAGGGTGATTTGAGGGAGGGAGG + Intronic
917197064 1:172477918-172477940 CAGAGTGTCTTTGGGGAAGGGGG + Intergenic
919017685 1:192061376-192061398 CATGTTGACTAAATGGAAGGTGG - Intergenic
920720149 1:208379739-208379761 CAGGGTGCGTATAGGGGAGGGGG - Intergenic
922684065 1:227625674-227625696 CCGGGTGAGTATAGGTATGGAGG + Intronic
923075066 1:230602496-230602518 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
923109566 1:230879925-230879947 CAGGGTGACTGGAGAGATGGAGG - Intergenic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
1063614643 10:7591315-7591337 CAGGGTGGGTTTAGGGAAGCTGG - Intronic
1065236413 10:23657318-23657340 CAGAGTCTCTATAGGGAAGAGGG - Intergenic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067097185 10:43309512-43309534 CAGGCTGGCTTTAGGAAAGGAGG - Intergenic
1067242021 10:44505536-44505558 CAGGGTCACAATAGTGTAGGTGG - Intergenic
1067360231 10:45572332-45572354 AAGGTTGCCTATAGTGAAGGAGG - Intronic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1072011427 10:91305980-91306002 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073084573 10:100879966-100879988 CAGGGTGGCTACATGGCAGGTGG - Intergenic
1074817661 10:117154949-117154971 CAGGCTGCCTGTGGGGAAGGAGG + Intergenic
1077047398 11:552569-552591 CCGGGTGCCTATAGGGGAGGGGG - Exonic
1077488897 11:2851460-2851482 CAGGGTGAGGATGGGGAAGCTGG - Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078484361 11:11707854-11707876 CAGGGTCACTGGAGTGAAGGTGG + Intergenic
1078670823 11:13363767-13363789 CAGGGTCACTCTTGGGAAGATGG - Intronic
1079230373 11:18644248-18644270 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1082896833 11:58200770-58200792 CATGGTGACTTTAGGGTAGTGGG + Intergenic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1084613418 11:70218766-70218788 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1087114740 11:94512861-94512883 CAGGCAGGCTATCGGGAAGGAGG - Intergenic
1089867207 11:121642419-121642441 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1089987287 11:122825858-122825880 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1090107745 11:123870077-123870099 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1092924992 12:13264425-13264447 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1093887693 12:24481361-24481383 CAGGGTGACTATAGTCAATAAGG + Intergenic
1093941211 12:25056889-25056911 CAGAGTGACTCTGGGGAGGGAGG - Intronic
1095832828 12:46605377-46605399 CATGCTGAGTATAGGGAAGAGGG - Intergenic
1096537184 12:52282609-52282631 GAGAGTGACCATAGGGCAGGAGG + Intronic
1096907337 12:54947420-54947442 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1098637320 12:72800541-72800563 AAGAGTGAGTATAGGGATGGAGG - Intergenic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1104572922 12:129941062-129941084 AATGGTGACTATAGGCACGGTGG - Intergenic
1107588899 13:41881967-41881989 CAGGGTGACTGCCGGGACGGAGG + Intronic
1111780580 13:92718646-92718668 CAGGGTGACTACAGTCAACGGGG + Intronic
1112691698 13:101903616-101903638 CAGGGTGACTATAGGGAAGGAGG + Intronic
1113580566 13:111425775-111425797 GAGGGTCACTTTAGAGAAGGAGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114190405 14:20436080-20436102 GAGGGTGACTAAAAGGATGGGGG - Intergenic
1119521144 14:75286421-75286443 CAGAGTGCCTGTAGGGAAGAAGG - Intergenic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1121092618 14:91193308-91193330 CAGAGTGACTTCTGGGAAGGGGG - Intronic
1121816647 14:96933869-96933891 CAGAATGACTTTTGGGAAGGGGG + Intergenic
1122381489 14:101310149-101310171 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1122550807 14:102548661-102548683 CAGGGAGAGTATGGGGAGGGGGG + Intergenic
1124631734 15:31341765-31341787 CAGGGTGACTCTGGGAAGGGGGG - Intronic
1125469237 15:39986390-39986412 CAAGGTGACTTTAGGCAAAGTGG + Intronic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1128529452 15:68433741-68433763 CAGGGTCAGGGTAGGGAAGGAGG + Intergenic
1129940925 15:79495968-79495990 CAGTGTGAGTATATGTAAGGGGG + Intergenic
1132588037 16:714781-714803 CGGGGTGGCGGTAGGGAAGGTGG - Intronic
1133396814 16:5454008-5454030 AAGGGTGACTAAAGAGAGGGAGG + Intergenic
1133938022 16:10284374-10284396 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1135659714 16:24285398-24285420 CAGGGTGAGAATAGAGTAGGGGG - Intronic
1137830495 16:51539147-51539169 CACGCTTACTATAGGGGAGGAGG - Intergenic
1138759256 16:59522101-59522123 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1138946154 16:61852775-61852797 CAGGGAGGATAAAGGGAAGGAGG - Intronic
1140133401 16:72183866-72183888 CAAGGTGAATATGGGGAAAGGGG - Intergenic
1140883387 16:79219713-79219735 CAGAGTGACAGTAGGGAACGGGG - Intergenic
1141476087 16:84274411-84274433 CTGGGTGACGAATGGGAAGGTGG - Intergenic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1141815669 16:86407976-86407998 CAGGGAAACTGCAGGGAAGGTGG + Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1145249440 17:21289318-21289340 CAGGACGAATATGGGGAAGGTGG + Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1147977343 17:44255355-44255377 GTGGGTGAATATAGGGCAGGAGG - Intronic
1149278344 17:55071303-55071325 AAGAGTGAATATAGGGATGGAGG - Intronic
1150073530 17:62172798-62172820 TAGGGTGACTATTAGGATGGGGG - Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151446759 17:74171332-74171354 CAGGTTGATTATATGGAAAGGGG + Intergenic
1152442923 17:80320175-80320197 GTGGGTGACTAGAGGGGAGGAGG - Intronic
1153348751 18:4056128-4056150 CAGGTTATCTATGGGGAAGGGGG + Intronic
1155173671 18:23285282-23285304 AAGGTTGCCTATAGTGAAGGAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155892848 18:31288729-31288751 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1156302101 18:35845107-35845129 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1157049970 18:44152038-44152060 CAGGAAGAGAATAGGGAAGGTGG + Intergenic
1158854783 18:61531936-61531958 CAGGGTATTTATAGGGAAAGAGG - Intronic
1162402511 19:10454491-10454513 CAGGGAGCCAATAGGGAAGCAGG - Intronic
1162744041 19:12789424-12789446 CAGAGCTACTCTAGGGAAGGAGG + Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163487134 19:17594641-17594663 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1163640497 19:18459266-18459288 CAGGCTGGTTGTAGGGAAGGTGG - Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165249077 19:34515195-34515217 AAGTTTGCCTATAGGGAAGGAGG - Intergenic
1168065219 19:53915383-53915405 GAGGCTGACCATGGGGAAGGGGG - Exonic
1168247979 19:55123756-55123778 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
925537079 2:4929326-4929348 AAGGGTGTCGATAGAGAAGGAGG + Intergenic
925603651 2:5635801-5635823 CAGTGTGACTATAAGGACAGAGG - Intergenic
926049858 2:9737720-9737742 CAGGGGTACTAGAGGGAATGGGG - Intergenic
926209006 2:10854996-10855018 CAGGTGGATTCTAGGGAAGGAGG + Intergenic
926218480 2:10919970-10919992 CAGGGAGACTGAAGCGAAGGAGG - Intergenic
927134015 2:20083546-20083568 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
929793220 2:45038897-45038919 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
931609079 2:64079666-64079688 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
932159613 2:69448155-69448177 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
932295712 2:70621878-70621900 AAGAGTGCCTATAGTGAAGGAGG - Intronic
932323032 2:70835758-70835780 CAGGATGACTGTGGAGAAGGAGG - Exonic
932418318 2:71586820-71586842 TAGGGTGAGCATAGGGAGGGAGG - Intronic
932558913 2:72850269-72850291 CATGGTCACTCTAGGGAAGCTGG - Intergenic
933222736 2:79709484-79709506 CAGGGTTACTGTAGGGATGAGGG + Intronic
933559589 2:83874235-83874257 CGGGGTGGCTGTCGGGAAGGCGG + Intergenic
937293092 2:120793780-120793802 CAGGGTGAATGTAGTGAGGGAGG - Intronic
939083292 2:137687434-137687456 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
939307260 2:140427375-140427397 AAGGTTGCCTATAGTGAAGGAGG - Intronic
942808696 2:179969228-179969250 CAGGGAGACTGTAGGAAAAGAGG + Intronic
943835002 2:192507282-192507304 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
943865210 2:192919307-192919329 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
945173304 2:207018466-207018488 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
946292377 2:218754961-218754983 CAGGGTGGGTATTTGGAAGGAGG - Exonic
1170480781 20:16762927-16762949 CAGGATGACAATAGCAAAGGTGG - Intronic
1173540026 20:43844187-43844209 CAGGTTGACAATTGAGAAGGGGG + Intergenic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173613027 20:44384777-44384799 CAGAGAGACTATAAGTAAGGGGG + Intronic
1174337091 20:49870426-49870448 CAGGGACGCTCTAGGGAAGGAGG + Intronic
1175723637 20:61302583-61302605 CAGGATGACTTGAGGGATGGAGG - Intronic
1176061765 20:63175673-63175695 TAGGGTGACCCAAGGGAAGGGGG + Intergenic
1176995261 21:15548135-15548157 CAAGGTGACTACAGGGAAATAGG + Intergenic
1178222919 21:30681359-30681381 CAGGAAGAGTAGAGGGAAGGGGG + Intergenic
1179320999 21:40291186-40291208 CAGGGTGACTGCAGTGGAGGAGG - Intronic
1181044595 22:20208586-20208608 CAGGGTGGCTGTGGGGACGGAGG + Intergenic
1182967116 22:34532722-34532744 CAGGGGGACTACAGTGAGGGAGG - Intergenic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
951196465 3:19828583-19828605 CAGGGAGACTATGGGGGAAGCGG + Intergenic
951644357 3:24871930-24871952 CAGGGTGATGATAGGGGAAGTGG - Intergenic
952663606 3:35878820-35878842 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954914405 3:54136569-54136591 CAGGGTGAGGATGGGAAAGGTGG - Intronic
954982197 3:54756524-54756546 CAGGGTGAAAATATGTAAGGGGG - Intronic
955833744 3:63031333-63031355 CAGGGTGGCTAGAGGGGATGGGG + Intergenic
956233656 3:67043197-67043219 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957338185 3:78859138-78859160 CAGGGTGACAGTAGTGGAGGTGG + Intronic
960165870 3:114400692-114400714 CTGGGGGACCCTAGGGAAGGAGG + Intronic
960243083 3:115368566-115368588 CATGGTGACTATAGTTAAGAAGG + Intergenic
962748219 3:138413281-138413303 CAGGCTGACTCTAAGGAAGCAGG - Intergenic
963425065 3:145114192-145114214 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
963468461 3:145711607-145711629 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
963789961 3:149573587-149573609 CAAGGTGACAATAGGGTAGCTGG + Intronic
964067669 3:152598236-152598258 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
964125613 3:153231184-153231206 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
964983490 3:162713617-162713639 AAGGGTGCCCATAGTGAAGGAGG - Intergenic
965625030 3:170676994-170677016 AAGGTTGCCTATAGTGAAGGAGG + Intronic
967189755 3:186975155-186975177 CAGGGTGAATCCAGGGAAGCGGG + Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
970029376 4:11658207-11658229 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
970041948 4:11807504-11807526 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
970163769 4:13215064-13215086 CAGGTTGAGGATAGAGAAGGGGG - Intergenic
970499306 4:16661098-16661120 CAGGGTGAGTGTAGGGAGGTGGG - Intronic
970854193 4:20634740-20634762 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
971969270 4:33600855-33600877 CGGTGTGACTGTAGAGAAGGAGG - Intergenic
972573296 4:40329833-40329855 CAGGAAGACAATAGGGAAGGTGG + Intergenic
973298437 4:48553799-48553821 CTGGTTGACTATAGGGAATGGGG - Intronic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
977782591 4:100996279-100996301 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
979146471 4:117253330-117253352 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
980379588 4:131994803-131994825 CAGGGAGAATCTAGGGGAGGGGG - Intergenic
982409621 4:155059705-155059727 CAAGGGGACTCTAGGAAAGGAGG - Intergenic
983088061 4:163472023-163472045 GAGGATCACTACAGGGAAGGTGG - Exonic
985057548 4:186048685-186048707 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
985152181 4:186959030-186959052 CAGGTTGAGTTTAAGGAAGGGGG - Intergenic
987281890 5:16421248-16421270 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
987325705 5:16810320-16810342 CATGGGGACTGTAGGGAGGGAGG - Intronic
990475503 5:56158248-56158270 CTAGGTGACCATAGGCAAGGGGG - Intronic
991624278 5:68583081-68583103 GAGGGTGTCTAAAGAGAAGGGGG + Intergenic
992407519 5:76473946-76473968 TAGAGTGACTTTAGGGAAGCTGG + Intronic
993701907 5:91128642-91128664 CAGGGTGTGTATGGGGATGGTGG - Intronic
994741394 5:103624092-103624114 CAAAGTGACTATTGGGGAGGTGG + Intergenic
996527900 5:124498269-124498291 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
996575163 5:124971098-124971120 AAGGTTGACTGTAGTGAAGGAGG + Intergenic
997050315 5:130372638-130372660 CAGGGTCATTATAAGGAACGAGG + Intergenic
997381902 5:133444374-133444396 CAGGGTGGCTGTAGGTAAGGAGG - Intronic
999894011 5:156009060-156009082 CAGAGTGACTGGAGCGAAGGAGG + Intronic
1000301449 5:159960254-159960276 CAGCGTGAATAAAGGGAAAGGGG + Intronic
1002471191 5:179437279-179437301 CAGGGTGACTTTGGCAAAGGCGG + Intergenic
1003389978 6:5705505-5705527 CAGGGTGAATCGAGGTAAGGAGG - Intronic
1004106110 6:12668625-12668647 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1004178934 6:13364649-13364671 GAGGGTGACCATGGGGAATGTGG - Exonic
1005332616 6:24764418-24764440 CAGGGAGACTGTGGAGAAGGAGG - Intergenic
1005359826 6:25021275-25021297 CAGGGTGACTATATGAAAAAAGG + Intronic
1005532620 6:26722738-26722760 CAGGGTGACTAAAGAGAGGGTGG - Intergenic
1005535784 6:26754865-26754887 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1005538175 6:26778927-26778949 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1005695801 6:28351632-28351654 GAGGGAGACAAAAGGGAAGGAGG - Intronic
1006301554 6:33196115-33196137 CAGGAAGACTATATGTAAGGAGG - Intronic
1007035822 6:38672549-38672571 CATGGTGACTAAATGGAATGTGG + Intergenic
1008051021 6:46900471-46900493 CAGGGTGAGTGTTGAGAAGGAGG - Intronic
1009378997 6:63006519-63006541 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1009464191 6:63951123-63951145 AAGGTTGCCTATAGTGAAGGAGG - Intronic
1009542695 6:64983367-64983389 CAGGGTGAATATAAGAAATGCGG + Intronic
1014395859 6:120926081-120926103 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1017068594 6:150552075-150552097 CAGGGGGACTGTGGGGAGGGTGG + Intergenic
1018497859 6:164368623-164368645 CAGGGTCACAATAAAGAAGGTGG - Intergenic
1018646727 6:165955453-165955475 CATGGTGACTAAAGCGGAGGTGG - Intronic
1019085603 6:169473307-169473329 AAGAGTGACAAAAGGGAAGGAGG + Intronic
1019655279 7:2190769-2190791 CAGGATGGCTAAAGTGAAGGTGG + Intronic
1022683552 7:32573112-32573134 CAGAGTAACTACGGGGAAGGTGG - Intronic
1025214259 7:57042657-57042679 GGGGCTGACTATAGGGAAGGGGG - Intergenic
1025657694 7:63534156-63534178 GGGGCTGACTATAGGGAAGGGGG + Intergenic
1026151580 7:67792247-67792269 CAGGGTGGCTATGGGGAGTGCGG - Intergenic
1029683933 7:102132469-102132491 GGGGCTGACTATAGGGAAGGGGG - Intronic
1029696576 7:102217580-102217602 CATGGTGTCTAGAGGGAGGGAGG + Intronic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1031296460 7:120010111-120010133 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1031364897 7:120890114-120890136 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1031422613 7:121568485-121568507 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1031554233 7:123151877-123151899 CAGGGTGACAACAGTGGAGGTGG - Intronic
1032688513 7:134259340-134259362 CTGGGTGTCAATAGGAAAGGTGG + Intronic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1036206212 8:6807296-6807318 CTGGGTGAGTCTAGGGAAGCCGG - Intergenic
1036549513 8:9804173-9804195 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1038341174 8:26686460-26686482 CAGGGTGACTATAGTTAATAAGG - Intergenic
1038385245 8:27138154-27138176 CAGGGTTAGTTAAGGGAAGGAGG - Intergenic
1038559522 8:28559852-28559874 CAGAGTGAGTATTGGGAAGTGGG - Intronic
1038725157 8:30075725-30075747 CAGGTTGAATATAGGGAATTGGG - Intronic
1040647863 8:49420689-49420711 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1041692078 8:60698330-60698352 CAGGAAGAATATAGGGTAGGTGG + Intronic
1041917688 8:63152805-63152827 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1042605596 8:70542457-70542479 AAGGGGGACTAGAGTGAAGGGGG - Intergenic
1043185067 8:77138103-77138125 CAGGGTGACAAAAAAGAAGGAGG - Intergenic
1043197065 8:77308545-77308567 CATGGTGACTATAGTTAACGAGG + Intergenic
1043355003 8:79401737-79401759 CAGGGAGACTGCAGGGAAAGAGG - Intergenic
1044518444 8:93168000-93168022 GAGGGTGAGAATAGGGAAAGTGG + Intergenic
1045151092 8:99409090-99409112 CAGAGTGGCTAAATGGAAGGTGG - Intronic
1046915563 8:119674720-119674742 GAGGGTGAATCTAGAGAAGGGGG + Intergenic
1047817626 8:128482139-128482161 CAGGGATAATCTAGGGAAGGAGG + Intergenic
1048794035 8:138131972-138131994 CAGGGTGACTTAAGGTAAAGAGG - Exonic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049868972 8:144958764-144958786 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1050474008 9:6021190-6021212 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1050895923 9:10885972-10885994 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1053014494 9:34654253-34654275 CAGTGTGTCTATATGGCAGGTGG - Intronic
1054827737 9:69590016-69590038 AAGGGTGAGTTTTGGGAAGGAGG - Intronic
1055357751 9:75454791-75454813 CAGGGGGACTATGGGGAAGTTGG - Intergenic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1057812734 9:98270316-98270338 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1060156356 9:121322679-121322701 GAGTGTGACTATAGGGAACCAGG - Intronic
1061487651 9:130928516-130928538 CTGGGTGACTGATGGGAAGGTGG - Intronic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062327334 9:136018490-136018512 CAGGGTGACTCCAGGGTGGGTGG - Intronic
1185506193 X:633548-633570 CAGGGTGTCTACAGGGAACGGGG - Intronic
1185889045 X:3808206-3808228 CACGGTGACAAAAGGGAAGATGG + Intergenic
1186519625 X:10193927-10193949 GATGGTGACTAGAGGGAAAGTGG + Intronic
1186783912 X:12941036-12941058 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1189229797 X:39443357-39443379 CAGGGGGACAATGGGGAGGGTGG + Intergenic
1189250768 X:39599369-39599391 CAGGGTGAGTGTAGGGTTGGTGG - Intergenic
1189909843 X:45799429-45799451 CAGGGAGAGTCTGGGGAAGGAGG + Intergenic
1192314616 X:70042199-70042221 CAGGCCGACTATAGGGCAGAAGG + Exonic
1192601311 X:72467440-72467462 TAGGGTGACGATAGGGAAGTTGG + Intronic
1194499702 X:94666791-94666813 CATGGTGACTAAAGGCAATGTGG - Intergenic
1194503135 X:94703288-94703310 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1195291317 X:103434034-103434056 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1195499130 X:105573664-105573686 GAGGGGGAATATAGGAAAGGGGG + Intronic
1196221127 X:113113179-113113201 AAGGTTGCCTATAGTGAAGGAGG + Intergenic
1197932926 X:131713294-131713316 AAGGTTGCCTATAGTGAAGGAGG - Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic