ID: 1112692682

View in Genome Browser
Species Human (GRCh38)
Location 13:101915830-101915852
Sequence GCAGCCCTTCAGTCAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112692682_1112692687 24 Left 1112692682 13:101915830-101915852 CCAGGATTTGACTGAAGGGCTGC 0: 1
1: 0
2: 0
3: 12
4: 201
Right 1112692687 13:101915877-101915899 AGCCTTCTGCTGAACCTCAGCGG 0: 1
1: 0
2: 1
3: 12
4: 148
1112692682_1112692690 30 Left 1112692682 13:101915830-101915852 CCAGGATTTGACTGAAGGGCTGC 0: 1
1: 0
2: 0
3: 12
4: 201
Right 1112692690 13:101915883-101915905 CTGCTGAACCTCAGCGGACTGGG 0: 1
1: 0
2: 1
3: 3
4: 77
1112692682_1112692689 29 Left 1112692682 13:101915830-101915852 CCAGGATTTGACTGAAGGGCTGC 0: 1
1: 0
2: 0
3: 12
4: 201
Right 1112692689 13:101915882-101915904 TCTGCTGAACCTCAGCGGACTGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112692682 Original CRISPR GCAGCCCTTCAGTCAAATCC TGG (reversed) Intronic
904420137 1:30385856-30385878 GGAGCCCTGCAGTGAGATCCTGG - Intergenic
904467661 1:30718060-30718082 GCACCACCTCAGTCTAATCCAGG + Intronic
906087595 1:43149037-43149059 GGAGCCCATCAGACCAATCCAGG - Intronic
906836464 1:49087703-49087725 GCAGGCCAACATTCAAATCCAGG + Intronic
907811441 1:57874629-57874651 GCAGCCATTGAGTCAAGTTCAGG + Intronic
909170712 1:72290594-72290616 GCAGCCTTTCAGTCACCTCTAGG + Intergenic
912540954 1:110414962-110414984 GCAGCCCTTCATTCAAGCACTGG + Intergenic
913285156 1:117219214-117219236 GCAGGCCAACATTCAAATCCAGG + Intergenic
913524163 1:119675409-119675431 TCAGCCCTTCATTCAAATGGAGG + Intronic
915026176 1:152831842-152831864 GCAGGCCAACAGTCAAATTCAGG + Intergenic
922425531 1:225489096-225489118 GAAGCCCTTCTTTCAATTCCTGG - Exonic
1064371425 10:14755005-14755027 GCAGCTCTTGACTCAATTCCTGG - Intronic
1067333536 10:45343078-45343100 GCAGCCCAACATTCAAATTCAGG + Intergenic
1069555603 10:69395741-69395763 GCTGCCTTTCAGATAAATCCAGG - Intronic
1070060781 10:72981136-72981158 GCAGCTATGCAGTCAAGTCCTGG - Intergenic
1072245135 10:93536594-93536616 GCAGGCCAACAGTCAAATTCAGG + Intergenic
1073440808 10:103551653-103551675 GCAGCTCTTCTGCCATATCCCGG + Intronic
1073925106 10:108505994-108506016 GCAGGCCATCATTCAAATTCAGG + Intergenic
1075278126 10:121113483-121113505 TCAGGCATTCAGTCAAACCCTGG + Intergenic
1075881208 10:125852582-125852604 GCAGCCCATCAGCCAGAGCCAGG - Exonic
1077284432 11:1759451-1759473 GCAGCCCTGCAGCGACATCCCGG + Intronic
1077683019 11:4263967-4263989 GCAGCCCAACATTCAAATTCAGG + Intergenic
1077687022 11:4302791-4302813 GCAGCCCAACATTCAAATTCAGG - Intergenic
1077692179 11:4353980-4354002 GCAGCCCAACATTCAAATTCAGG - Intergenic
1077697213 11:4405325-4405347 GCAGCCCAACATTCAAATTCAGG - Intergenic
1078321760 11:10341227-10341249 GCAGGCCATCATTCAAATTCAGG + Intronic
1078896370 11:15600553-15600575 CCAGCCCTTCAGACAGCTCCAGG + Intergenic
1080378511 11:31742361-31742383 GCAGGCCATCATTCAAATTCAGG + Intronic
1082199748 11:49351492-49351514 GCAGCTCCTCAGTCAAAGCTGGG - Intergenic
1083503309 11:63131805-63131827 GCAGGCCAACATTCAAATCCAGG - Intronic
1086289010 11:85283963-85283985 GCAGATCTTCATTCAAATCTAGG - Intronic
1086655918 11:89354731-89354753 GCAGCTCCTCAGTCAAAGCTGGG + Intronic
1090946122 11:131431134-131431156 GCCACCCTTCAGCCAAATTCAGG + Intronic
1092913372 12:13167583-13167605 TCATCTCTTCAGTCAAAGCCTGG + Intergenic
1094710582 12:32957784-32957806 GCAGGCCTACATTCAAATTCGGG + Intergenic
1095793658 12:46194458-46194480 GCAGCCCAACATTCAAATTCAGG - Intronic
1098074544 12:66714969-66714991 CCAACCCATCAGTCAAATCAAGG + Intronic
1098842675 12:75495222-75495244 ACAGCCCTGGAGTTAAATCCAGG + Exonic
1101161544 12:101981816-101981838 GAAGCCCTGCAGTTGAATCCAGG - Intronic
1102026104 12:109714959-109714981 GGACCCCTTCTGTCCAATCCTGG - Intronic
1105337374 13:19486587-19486609 ACAGCCCTTCAGGCCACTCCTGG - Intronic
1107300192 13:38958056-38958078 GCAGCCCAGCAGTCACATCCTGG + Intergenic
1108632646 13:52301990-52302012 ACAGCCCTTCAGGCCACTCCTGG - Intergenic
1108654053 13:52510603-52510625 ACAGCCCTTCAGGCCACTCCTGG + Intergenic
1111695039 13:91612974-91612996 ACAATCCTTCACTCAAATCCTGG + Intronic
1112692682 13:101915830-101915852 GCAGCCCTTCAGTCAAATCCTGG - Intronic
1113041590 13:106109037-106109059 GCATCCCTTCTCTCAAACCCTGG + Intergenic
1114063577 14:19040527-19040549 GCAGCCCTGGGTTCAAATCCTGG - Intergenic
1114098679 14:19359469-19359491 GCAGCCCTGGGTTCAAATCCTGG + Intergenic
1114866816 14:26605668-26605690 TCAGCTCCTCAGTCAAATTCTGG - Intergenic
1115946929 14:38672514-38672536 GCAGGCCAACATTCAAATCCAGG + Intergenic
1116871881 14:50075451-50075473 GCAGGCCAACATTCAAATCCAGG + Intergenic
1117123534 14:52595344-52595366 GCAGGCCAACATTCAAATCCAGG - Intronic
1119427617 14:74546068-74546090 GCTTCCCTTCAGTCACATTCTGG - Intronic
1119643512 14:76331303-76331325 GAAGACCTAGAGTCAAATCCTGG + Intronic
1120684901 14:87527142-87527164 GCAGCCTTTCTGTCAGAACCAGG + Intergenic
1120878517 14:89396493-89396515 GGACCACATCAGTCAAATCCAGG + Intronic
1202848360 14_GL000225v1_random:665-687 GAAGCCCTTTCGTCAAATCCTGG - Intergenic
1123472228 15:20563767-20563789 GCAGCCTTTCTGTTAAATCTGGG - Intergenic
1123492966 15:20797646-20797668 GCAGCCCTGGGTTCAAATCCTGG + Intergenic
1123549467 15:21366748-21366770 GCAGCCCTGGGTTCAAATCCTGG + Intergenic
1123645774 15:22436586-22436608 GCAGCCTTTCTGTTAAATCTGGG + Intergenic
1123732533 15:23158758-23158780 GCAGCCTTTCTGTTAAATCTGGG - Intergenic
1123750667 15:23356140-23356162 GCAGCCTTTCTGTTAAATCTGGG - Intronic
1124283037 15:28380056-28380078 GCAGCCTTTCTGTTAAATCTGGG - Intronic
1124299662 15:28531557-28531579 GCAGCCTTTCTGTTAAATCTGGG + Intronic
1124960225 15:34388360-34388382 GCAGCCTTTCTGTGAAATCTGGG + Intronic
1124976854 15:34534581-34534603 GCAGCCTTTCTGTGAAATCTGGG + Intronic
1127639647 15:60904189-60904211 GAAGTCCTTCAGTAAAACCCAGG - Intronic
1127776588 15:62268862-62268884 GCAGCCTTTCTGTTAAATCTGGG + Intergenic
1128447434 15:67776410-67776432 GCAGGCCTTCAGAAAAATGCAGG + Intronic
1129564481 15:76607543-76607565 GCAGGCCACCATTCAAATCCAGG - Intronic
1132433768 15:101780677-101780699 GCAGCCTTTCTGTTAAATCTGGG + Intergenic
1202957798 15_KI270727v1_random:93966-93988 GCAGCCCTGGGTTCAAATCCTGG + Intergenic
1132548329 16:543812-543834 GCAGCTCTTCAGTAAACGCCAGG - Intronic
1137572762 16:49577650-49577672 GCAGGCCTTAAGTCACCTCCTGG - Intronic
1138009483 16:53364087-53364109 GCAGCCTTTCTGTTAAATCTGGG + Intergenic
1138094422 16:54200893-54200915 ACAGCTCTGCAGTCACATCCTGG + Intergenic
1140407997 16:74723744-74723766 GCAGACCTGGATTCAAATCCTGG + Intronic
1140583015 16:76253833-76253855 GCAGGCCGACAGTCAAATTCAGG - Intergenic
1140850678 16:78932324-78932346 GCAGTCCTTGAGACAATTCCAGG + Intronic
1144570981 17:16398820-16398842 GCATACCTGCAGTCAAATCAGGG + Intergenic
1144680618 17:17191401-17191423 CCAGCCCTTTGGTCATATCCTGG + Exonic
1146470534 17:33120914-33120936 GCAGCCCTGGTTTCAAATCCTGG + Intronic
1147162742 17:38577559-38577581 GCAGCCTTTCAGTCAAGCCTGGG - Intronic
1148102336 17:45099969-45099991 CCAGTCCTTCAGCCAAATCTGGG - Intronic
1150414735 17:64977470-64977492 ACAGCCGTTCAGTCAAAAACAGG - Intergenic
1151080825 17:71326540-71326562 GCAGACCTTAACTCAAGTCCAGG - Intergenic
1152040565 17:77900000-77900022 GCAGCCCTGCAGAGAAATCTTGG - Intergenic
1153064778 18:1033843-1033865 GCAGGCCAACATTCAAATCCAGG - Intergenic
1157109001 18:44801962-44801984 TCAGCCCTTCAGTCCAGCCCAGG + Intronic
1157205662 18:45696063-45696085 GCAGCCCAACATTCAAATTCAGG + Intergenic
1157878097 18:51292334-51292356 TCAGCCCTTCAGAAAGATCCAGG - Intergenic
1160213797 18:76908398-76908420 GCAGGCCTCCACTCAAATGCAGG + Exonic
1163592791 19:18203824-18203846 TCAGCCCATCAGTCAAATGAAGG + Intronic
1163623207 19:18372954-18372976 GCAGCCTCTCAGCCATATCCTGG - Intergenic
1163881003 19:19922464-19922486 GCAGCCCAACATTCAAATTCAGG - Intronic
1164280573 19:23764915-23764937 GCAGCCCTTTAGTCTATTCTTGG + Intronic
1167702489 19:51058327-51058349 GCAGCCACTCAGTCAAAGCTGGG + Intronic
1167710151 19:51105432-51105454 CCAACCCTCCAGTCAAATCCTGG + Intronic
925294022 2:2766042-2766064 GGAGTCCCTCAGTCAATTCCTGG + Intergenic
928224552 2:29436996-29437018 GCACCACTTGAATCAAATCCTGG - Intronic
930437441 2:51363218-51363240 GCAGGCCAACATTCAAATCCAGG - Intergenic
930838071 2:55815617-55815639 GCAGGCCTACATTCAAATTCAGG + Intergenic
933627808 2:84621470-84621492 CCAGACATTCAGTCAAATCACGG - Exonic
939030953 2:137075112-137075134 GCAGGCCAACATTCAAATCCAGG - Intronic
939862588 2:147437530-147437552 CAAGCCCTGCATTCAAATCCTGG + Intergenic
942065656 2:172269225-172269247 GCAGGCCAACATTCAAATCCAGG - Intergenic
942411895 2:175718183-175718205 GCAGCCCAACATTCAAATTCAGG + Intergenic
942859269 2:180590133-180590155 GCAGCCCAACATTCAAATTCAGG - Intergenic
944217473 2:197270527-197270549 GAAGCCCTTCAGGGACATCCAGG + Intronic
945197537 2:207251335-207251357 CCAGCCATTGATTCAAATCCCGG - Intergenic
945700558 2:213164519-213164541 GAAGGCCTGCTGTCAAATCCAGG + Intergenic
946673509 2:222131862-222131884 GCAGGCCTTAATTCAAATCTAGG - Intergenic
947459050 2:230286659-230286681 TCAGCCCTTCACTCACATCCAGG - Intronic
947469338 2:230386131-230386153 TCAGCCCTTCACTCACACCCAGG - Intronic
948004635 2:234597139-234597161 GCCCCCTTTCAGTCAGATCCGGG - Intergenic
948369551 2:237479897-237479919 GCACCCTTACAATCAAATCCTGG + Intergenic
1170186317 20:13594841-13594863 GCAGGCCAACATTCAAATCCAGG + Intronic
1172214143 20:33223045-33223067 GCAGATCTTGATTCAAATCCTGG - Intronic
1173718827 20:45235724-45235746 GCAGCCATTAATTCACATCCTGG - Intergenic
1174925365 20:54753390-54753412 GCAGGCCAACATTCAAATCCAGG - Intergenic
1175300744 20:57941111-57941133 GCAGCCCCTTTCTCAAATCCTGG + Intergenic
1175949597 20:62576332-62576354 GAAGCCCTTCAGCAAAGTCCTGG + Intergenic
1176445684 21:6818200-6818222 GCAGCCCTGGGTTCAAATCCTGG - Intergenic
1176736194 21:10548788-10548810 ACAGCCCTTCAGGCCACTCCTGG + Intronic
1176823851 21:13683233-13683255 GCAGCCCTGGGTTCAAATCCTGG - Intergenic
1178036417 21:28588475-28588497 GCAGGACTTCTGTTAAATCCTGG - Intergenic
1180482071 22:15763161-15763183 GCAGCCCTGGGTTCAAATCCTGG - Intergenic
1180749036 22:18111579-18111601 GCCGCCCCTCAGTAAGATCCAGG - Intronic
1182775848 22:32830501-32830523 ACAGAGCTTCAGCCAAATCCTGG + Intronic
1183532951 22:38374066-38374088 ACAGCCCTTCAGGCCACTCCTGG - Intronic
1184644212 22:45887693-45887715 CCAGGCCTTCAGTCACATCCTGG + Intergenic
949734019 3:7149652-7149674 GGAGTCCATCATTCAAATCCAGG - Intronic
950114579 3:10442348-10442370 GAAGCCCTTCAGTCAGCTGCCGG + Intronic
950803746 3:15578494-15578516 GCTGCCTTTGAGTCAAAGCCAGG - Intronic
952988531 3:38810323-38810345 GCAGCCCTTCAGTTTATTCCAGG + Intergenic
955097662 3:55815759-55815781 GAAGTCTTACAGTCAAATCCTGG - Intronic
956241963 3:67140931-67140953 GCAGGCCTACATTCAAATGCAGG - Intergenic
956905201 3:73758542-73758564 GCAGCCCCTCATTCAAACCCAGG - Intergenic
958974720 3:100654465-100654487 GCATCCCATCAGTTAAATCAAGG + Intronic
960792647 3:121450815-121450837 GCAGCCCAACATTCAAATTCAGG - Intronic
961034688 3:123634361-123634383 GGAGCCCTGCAGTCAGACCCTGG + Intronic
962266873 3:133950169-133950191 GCAGAGCTTCATTCAAACCCAGG + Intronic
962709898 3:138077543-138077565 GAAGCACTTCAGACCAATCCTGG - Exonic
963526029 3:146414328-146414350 GAAGCTCTTCAGTGCAATCCTGG + Intronic
968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG + Exonic
970120217 4:12745473-12745495 ACAGCCCTTGGTTCAAATCCTGG + Intergenic
971608096 4:28684705-28684727 TTACCCCTTCAGTAAAATCCAGG - Intergenic
975433406 4:74321717-74321739 ACAGCCTTGCAGCCAAATCCAGG - Intergenic
981508647 4:145530837-145530859 GCAGACCTTGATTCACATCCTGG + Intronic
981776489 4:148373964-148373986 GCAGACCTGCATTTAAATCCTGG - Intronic
987917535 5:24234359-24234381 GCAGCTCTCCAGGCAAACCCAGG - Intergenic
988859254 5:35260488-35260510 GCAGGCCAACATTCAAATCCAGG - Intergenic
991161552 5:63508913-63508935 GCAGGCCATCATTCAAATTCAGG + Intergenic
992983600 5:82203341-82203363 GCAGCCATTGGGTCAAAGCCAGG + Intronic
993742403 5:91556986-91557008 GCAGCCCAACATTCAAATTCAGG + Intergenic
994161041 5:96556824-96556846 GCAGGCCAACATTCAAATCCAGG + Intronic
995352651 5:111198471-111198493 GCAGCCCTGCAGTGATAGCCAGG - Intergenic
995951167 5:117715830-117715852 GCATCACTTCAGGAAAATCCAGG - Intergenic
997351436 5:133234113-133234135 GCAGCCCATGGGCCAAATCCAGG - Intronic
998454373 5:142259961-142259983 CCAGCCCTTCAGTCACTGCCTGG + Intergenic
998869844 5:146541247-146541269 GCAGCCTTCCAGTCACATGCAGG + Intergenic
999229200 5:150051836-150051858 GCAGGCCTACAGCCCAATCCTGG + Exonic
999702785 5:154243521-154243543 GCAGAACAGCAGTCAAATCCAGG - Intronic
1000698866 5:164422706-164422728 GCAGTGCTTCAGTCAAGTACAGG - Intergenic
1001047230 5:168383578-168383600 GCACCCCATCTGTCAAAACCTGG - Intronic
1001840675 5:174873714-174873736 GTAGACCTGGAGTCAAATCCAGG + Intergenic
1008363429 6:50648575-50648597 GCAGGCCAACAGTCAAATTCAGG - Intergenic
1009457802 6:63877497-63877519 GCAGCCCAACAGTCAAATTCAGG - Intronic
1009598358 6:65765128-65765150 ACTGCCCTACTGTCAAATCCAGG - Intergenic
1013446371 6:110232579-110232601 GCAGCCTTTTTGTCATATCCAGG + Intronic
1013578163 6:111506241-111506263 GCAGGCCAACAGTCAAATTCAGG - Intergenic
1015086474 6:129299209-129299231 GGAGCCATTTAGACAAATCCAGG - Intronic
1015405567 6:132833658-132833680 ACAGCCCTACTGTCAAAGCCAGG - Intergenic
1016913844 6:149226205-149226227 GCAGGCCTTCCTCCAAATCCAGG - Intronic
1018380657 6:163255380-163255402 GCTGCCCGTCAGTCACCTCCTGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1022452079 7:30524898-30524920 GCAGCCTTTCTGTTAAATCTGGG + Intronic
1022838584 7:34140815-34140837 GTAGACATTCACTCAAATCCGGG + Intronic
1023121760 7:36916339-36916361 GCAGCCTTTCAGTCACCTGCTGG + Intronic
1023129599 7:36989290-36989312 GAATCCCTTGATTCAAATCCTGG - Intronic
1024577346 7:50775383-50775405 GCAGCCCTGCAGCCAACTGCTGG + Intronic
1024884566 7:54126200-54126222 ACAGCCCCTCAGTCAATTTCCGG - Intergenic
1025577665 7:62668459-62668481 GCAGGCCTACATTCAAATTCAGG + Intergenic
1026974654 7:74490008-74490030 GCAGCACTGCAGTCCAACCCAGG - Intronic
1027730642 7:81867813-81867835 GCAGCCCTTCAATCCAATGCTGG - Intergenic
1035752909 8:2008438-2008460 GCAGCCCTTCCCTCACATCTGGG - Intergenic
1040383506 8:46895564-46895586 GCAGGCCAACAGTCAAATTCAGG + Intergenic
1042575100 8:70209225-70209247 GCAGCAATTCAGTCACATCTTGG - Intronic
1042842877 8:73141704-73141726 GCAGCGCTTGAGACACATCCAGG - Intergenic
1043940977 8:86195439-86195461 GCATCCTTTCAGTGGAATCCTGG + Intergenic
1044011738 8:87002488-87002510 CCAGCCCTTCATTCTATTCCAGG + Intronic
1045157317 8:99491387-99491409 GCAGGCCAACATTCAAATCCAGG - Intronic
1046689268 8:117264462-117264484 GCAGCATTGCAGTCAATTCCAGG + Intergenic
1048221681 8:132547892-132547914 GCATCCCTTCAGCTAAACCCAGG - Intergenic
1048254907 8:132898343-132898365 CCAGCCCTTCAGCCAGGTCCCGG + Intronic
1052136056 9:24911645-24911667 GCAGCTATTCATCCAAATCCAGG + Intergenic
1053055999 9:34993453-34993475 GCAGCACTCCAGCCCAATCCCGG + Intronic
1053098801 9:35352018-35352040 GCAGCACTTGAGCCAAGTCCAGG + Intronic
1053345071 9:37371981-37372003 GCAAACCTCCTGTCAAATCCCGG + Intergenic
1057157003 9:92851271-92851293 GAAGCCCTTGGGCCAAATCCAGG + Intronic
1057798028 9:98172141-98172163 GCAGGCCTTCAGTCATATCTGGG - Intronic
1060268013 9:122123400-122123422 GCAGCCCCACAGCCATATCCGGG + Intergenic
1062721777 9:138048265-138048287 GCAGACCTTCACTCACATCCTGG - Intronic
1203523511 Un_GL000213v1:66325-66347 GCAGCCCTGGGTTCAAATCCTGG + Intergenic
1189438797 X:41016250-41016272 GCAGCCCTTCAGTCTCATTCAGG - Intergenic
1189618928 X:42815200-42815222 GCAGGCCAACATTCAAATCCAGG - Intergenic
1191160714 X:57327366-57327388 GCAGGCCATCATTCAGATCCAGG - Intronic
1195544386 X:106099072-106099094 GCAGGCCATCATTCAAATTCAGG - Intergenic
1201180075 Y:11334296-11334318 GAAGCTCTTTTGTCAAATCCTGG + Intergenic
1201240518 Y:11953669-11953691 GCAGCCCTGCAGGCAGCTCCCGG + Intergenic
1201364414 Y:13187649-13187671 GCAGGCCTACATTCAAATTCAGG + Intergenic
1202594489 Y:26521952-26521974 ACAGCCCTTCAGGCCACTCCTGG + Intergenic