ID: 1112698795

View in Genome Browser
Species Human (GRCh38)
Location 13:101980686-101980708
Sequence CAAGTGCCAACAAGCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112698792_1112698795 -8 Left 1112698792 13:101980671-101980693 CCATCTTTCTCTTACCAAGTGCC 0: 1
1: 0
2: 2
3: 22
4: 285
Right 1112698795 13:101980686-101980708 CAAGTGCCAACAAGCCATCAGGG 0: 1
1: 0
2: 1
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112698795 Original CRISPR CAAGTGCCAACAAGCCATCA GGG Intronic
907792025 1:57676209-57676231 CAAGTGCCTACAAGGCATTGTGG + Intronic
910051243 1:82976566-82976588 CAAATGCCCACAAGAGATCAAGG + Intergenic
913009848 1:114671794-114671816 CTAGTACAAACATGCCATCAGGG + Intergenic
916351835 1:163859182-163859204 CAAATGCCACGTAGCCATCAAGG + Intergenic
916888714 1:169096002-169096024 GAAGTGCCAACCACCCTTCAAGG - Intergenic
918667079 1:187164566-187164588 CAACTGCTAACAAGTCATTAGGG - Intergenic
919343591 1:196345872-196345894 CCAGTGCTTACAAGACATCATGG + Intronic
921080148 1:211732572-211732594 CAAGTGCCCACCAACCTTCAGGG + Intergenic
1067762992 10:49063804-49063826 CAGGTGACACCAAGCCTTCAGGG - Intronic
1069451448 10:68521180-68521202 CAAGTGCCAACAAGGCAGTGGGG + Intronic
1079803538 11:24900335-24900357 CAATTTCCAACAAGCCAGAATGG - Intronic
1081081027 11:38739516-38739538 GAAGTCCCAACAAGAAATCAGGG + Intergenic
1081686349 11:45045926-45045948 CTGCTGCCAACAAGCCACCAGGG - Intergenic
1081803589 11:45876744-45876766 CTAGTGTCAAAAAGACATCAAGG - Intronic
1083315030 11:61809552-61809574 CAAGTACCAAGAAGCAATAAAGG + Intronic
1083975693 11:66118039-66118061 CATGTGCCAAAAAGGCTTCAGGG - Intronic
1084063389 11:66689894-66689916 CAAGAACCAGCAAGGCATCAAGG - Exonic
1090639052 11:128715006-128715028 CAAGTGCTAAAATGCCTTCAAGG - Intronic
1090660300 11:128877355-128877377 TAACTGCCAACAAGCCATGAAGG - Intergenic
1090794561 11:130123651-130123673 GAAGTACCAACGAGGCATCACGG - Exonic
1095842645 12:46710757-46710779 CATGTGCCAACATGGCATCAAGG - Intergenic
1097373151 12:58808758-58808780 TAACTGCCAATAAGCCATGATGG - Intronic
1097992696 12:65852935-65852957 CAAGTTCCAACAGAACATCATGG + Intronic
1103282431 12:119771141-119771163 AAAGTGCCACCTAGGCATCACGG + Intronic
1109462628 13:62681807-62681829 CAAGTTCCAAAAACCCATCTCGG - Intergenic
1111962371 13:94825640-94825662 CTGGTGCCAACAAGCCTTCTGGG - Intergenic
1112698795 13:101980686-101980708 CAAGTGCCAACAAGCCATCAGGG + Intronic
1112770413 13:102788976-102788998 CAAGTGGAAATAAGCCTTCAAGG + Intronic
1116777140 14:49194080-49194102 CAAGGCTCAACAAGCCACCAAGG + Intergenic
1118617028 14:67580955-67580977 CAAGTGGGAACAAGCCATGAAGG + Exonic
1119946801 14:78703921-78703943 ATAGTGCCAAGAAGCCATCTGGG + Intronic
1126767760 15:52026184-52026206 CAAGTGCCAACAAGCCTAGAGGG - Intronic
1129097923 15:73228165-73228187 TAAATGCCAACCAGTCATCAAGG + Intronic
1129258027 15:74345253-74345275 CATGGGCCCACAAGCCCTCATGG + Intronic
1129798929 15:78398765-78398787 CAAGCACCAGGAAGCCATCAGGG - Intergenic
1131241813 15:90751004-90751026 TAGGTGGCAACAAGCCATAAAGG - Intronic
1132092283 15:98956339-98956361 CAGATTCCAACAAGCCAGCAAGG - Intronic
1135132239 16:19862474-19862496 AAAGTGCCGACATGCCATCTTGG - Intronic
1137344622 16:47644780-47644802 CCAGTGCCAAAAAGCCATTGAGG + Intronic
1138864792 16:60803486-60803508 CAAGTCTCAACAACCCATCATGG - Intergenic
1139397232 16:66649909-66649931 CAAGTGCCACAAAACGATCAGGG - Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1142903679 17:3028503-3028525 GAAGGGCCAACAGGCCTTCAGGG + Intronic
1143697832 17:8633137-8633159 CAAGTGCCAAAGAGCCACCAGGG - Intergenic
1147450813 17:40502697-40502719 CATGTGCCAACAAGGCTGCATGG - Intergenic
1149262584 17:54896223-54896245 CAAGTTTCAACAAGGCATCCAGG + Intergenic
1157467106 18:47956801-47956823 CAGGTGCCAAAAAGCTATCGAGG - Intergenic
1163404736 19:17115133-17115155 CACGTGCCACCACGCCAGCAAGG + Intronic
1164673874 19:30089146-30089168 GAAGTGCCAACCAGCCCCCAGGG + Intergenic
1165148186 19:33745463-33745485 CACCTGCCAACCAGCCAGCAAGG - Intronic
1167823010 19:51947052-51947074 CAATTGCCTACAAACTATCAAGG - Intronic
929980014 2:46669381-46669403 ACAGTGCCAGCCAGCCATCAGGG - Intergenic
932277454 2:70462303-70462325 CCAGAGCTCACAAGCCATCAGGG + Intronic
933315907 2:80714789-80714811 CAAGGGCAAATAAACCATCAAGG - Intergenic
936394066 2:112106221-112106243 CAAGTGCCAAGTAGCAATCCTGG + Intronic
945112209 2:206370722-206370744 CAATTGCCCACCATCCATCAGGG - Intergenic
947742594 2:232491418-232491440 CAATTGCCAACCATCCTTCAGGG + Intergenic
948060875 2:235042610-235042632 AAAGTGCCATCAAGCCTTCCGGG + Exonic
948917216 2:241040423-241040445 CAAGTGCCTGCAGGCCACCATGG + Intronic
1181904856 22:26186243-26186265 CAACTGACAAGAAGCCAGCATGG + Intronic
1181992905 22:26851148-26851170 TAAGTCACAACAAACCATCATGG + Intergenic
1182739586 22:32557879-32557901 AAAGTGACAACAAGCCAGCCAGG - Intronic
951714486 3:25625156-25625178 AAATTGCCAGCATGCCATCAAGG + Intronic
967942872 3:194779786-194779808 CAAGTGCCACCAAGCAGACAAGG - Intergenic
968874972 4:3261906-3261928 CCAGTGCCTACAAGACAGCAGGG - Intronic
969202382 4:5616257-5616279 CAAGTTCCAACATGACCTCAAGG - Intronic
970847738 4:20562456-20562478 CAAGTTTCTGCAAGCCATCAAGG - Intronic
972108599 4:35525762-35525784 CAGATGCCAGCAGGCCATCAAGG - Intergenic
985932818 5:3072463-3072485 CAAGTGTTTACAAGCCATGAAGG + Intergenic
988678379 5:33458033-33458055 CAAGTGCCCAAAAGCCCTCAGGG - Intronic
990509461 5:56477253-56477275 CAAGTGCCAACCAGCCTAGAGGG + Intronic
995922099 5:117326922-117326944 CAAGAGCCAGAAAGCCTTCATGG + Intergenic
1006985287 6:38172070-38172092 CCAGGGGCAACAAGCCAACATGG - Exonic
1010685072 6:78844977-78844999 CAATTGCCAAAAACCCATGAAGG + Intergenic
1010915410 6:81611151-81611173 CAAGTTCAAAGAAGACATCATGG + Intronic
1012166746 6:95963764-95963786 CAAATGCCAACAAGGACTCAAGG + Intergenic
1012330763 6:97983207-97983229 CAAGTGCCAAAAACACATAATGG - Intergenic
1014707417 6:124764726-124764748 CAAGTGATAAGAAGCCATCTAGG - Intronic
1018370644 6:163165089-163165111 CAAGTGCCAACACTCTACCAAGG + Intronic
1023302710 7:38791124-38791146 CAAATGGCAAAAAGCAATCAAGG - Intronic
1029968115 7:104761850-104761872 GAAGTGCCAGCAAGCCATATTGG + Intronic
1030454351 7:109754447-109754469 TAGGTGCCAACAAACCACCATGG + Intergenic
1043246279 8:78006119-78006141 TACATGCCACCAAGCCATCATGG - Intergenic
1050853687 9:10322825-10322847 CAAGTGCCAACATGTCATCAGGG + Intronic
1053493706 9:38532946-38532968 CAGATGCCAAGGAGCCATCAGGG + Intergenic
1053629685 9:39922340-39922362 CAAGTGCAAGAAAGCCATTAAGG + Intergenic
1053776080 9:41541207-41541229 CAAGTGCAAGAAAGCCATTAAGG - Intergenic
1054214202 9:62328362-62328384 CAAGTGCAAGAAAGCCATTAAGG - Intergenic
1054673282 9:67826997-67827019 CAAGTGCAAGAAAGCCATTAAGG + Intergenic
1057674435 9:97127776-97127798 CAGATGCCAAGAAGCCATCAAGG + Intergenic
1185914085 X:4015900-4015922 AAAGTGCCAGAAAGCCATCATGG - Intergenic
1186577596 X:10783039-10783061 CAAGTGCTTAATAGCCATCAGGG - Intronic
1188099341 X:26063572-26063594 AAAGAACCAACAATCCATCATGG + Intergenic
1189889224 X:45581525-45581547 CAAGTGGCACTGAGCCATCAGGG + Intergenic
1195234290 X:102881562-102881584 TAAGTTCCACCAAGCCTTCAAGG - Intergenic
1196815927 X:119665600-119665622 CAGGAGCCAACAAGACTTCAGGG + Intronic
1199179697 X:144839023-144839045 CAAGTGCCAACTAGGAGTCAGGG + Intergenic
1199297003 X:146170731-146170753 CAACTGCAAACTGGCCATCACGG - Intergenic
1201894274 Y:18976938-18976960 AAAATTCCAACAAGCCAACACGG - Intergenic