ID: 1112699959

View in Genome Browser
Species Human (GRCh38)
Location 13:101996326-101996348
Sequence ATGGAGAAACTTTCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112699955_1112699959 20 Left 1112699955 13:101996283-101996305 CCTTGATGTTGGAGCTCAGTAGA 0: 1
1: 0
2: 2
3: 8
4: 110
Right 1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG 0: 1
1: 0
2: 1
3: 36
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112699959 Original CRISPR ATGGAGAAACTTTCTGAGGA GGG Intronic
900140784 1:1138816-1138838 AGGGAGAAGCTCTCTGAAGACGG + Intergenic
901962115 1:12835589-12835611 AAGGAAAATATTTCTGAGGAGGG - Intergenic
901963952 1:12850708-12850730 AAGGAAAATATTTCTGAGGAGGG - Intronic
901968729 1:12890366-12890388 AAGGAAAATATTTCTGAGGAGGG - Intronic
902016444 1:13311417-13311439 AAGGAAAATATTTCTGAGGAGGG + Intronic
903890232 1:26564973-26564995 AAGGAGGAACTTTCTGAAGAGGG + Intronic
904783885 1:32971130-32971152 CTGGAGAAAGTTTTTGAGTAGGG - Intergenic
905703385 1:40036241-40036263 GTGGGAAAACTTTCTGGGGATGG + Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905971971 1:42148701-42148723 ATGGGGAAACTCTCTGAGGGAGG + Intergenic
907539774 1:55203228-55203250 ATAGAGAAAGTTTATGAGGAAGG + Intronic
908221489 1:62011267-62011289 ATGATGAAACTTAGTGAGGAAGG - Intronic
909276221 1:73690278-73690300 TGGGAGAAACTTCCAGAGGAAGG - Intergenic
910049874 1:82961105-82961127 ATGGTGAAAATTTCGGGGGATGG - Intergenic
910577545 1:88783162-88783184 ATGAAGAAAATATCTGAGGCAGG - Intronic
910743783 1:90551030-90551052 CTTGAGAAAAGTTCTGAGGAGGG - Intergenic
910924108 1:92380743-92380765 ATTCAGAAACATTCTCAGGAAGG + Exonic
911107754 1:94150195-94150217 ATGGTGAAACTATCCAAGGAAGG - Intronic
911148994 1:94579498-94579520 ATGGAGGACCTTCCAGAGGAAGG - Intergenic
912963040 1:114213053-114213075 CTGGGGAAAGTTTCTGAGGAAGG + Intergenic
914800090 1:150954836-150954858 TTCCAGAAACTTTCTGAGAAGGG - Intronic
914860799 1:151384302-151384324 ATGGCAAAACCTTCTGAGGTTGG + Intergenic
915732260 1:158062045-158062067 ATGGAGAAACTTTCTCTTTAGGG - Intronic
916559019 1:165916685-165916707 ATGTAAAAACATTCTGAGAAGGG - Intergenic
918405967 1:184212469-184212491 ATGGAGAAACTTCCTAGGGGTGG + Intergenic
918849574 1:189668960-189668982 ATGGTTAAACTTAGTGAGGAAGG + Intergenic
919059910 1:192619323-192619345 ATGGAAAAACTCTTTGATGATGG - Intergenic
921322372 1:213954385-213954407 AAGGAGCTACTTTCTGAGGAAGG - Intergenic
924786986 1:247208094-247208116 CTGGAGGCTCTTTCTGAGGATGG - Intergenic
924789161 1:247228131-247228153 ATGGAAAAACATTCTGAGGCAGG + Intergenic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1065464250 10:26001971-26001993 AGTGAGACCCTTTCTGAGGAGGG + Intronic
1065515499 10:26520228-26520250 ATGGTGGAAGCTTCTGAGGAGGG - Intronic
1068615765 10:59114267-59114289 GTGCAGAAACTATCTGAGGCTGG - Intergenic
1069207250 10:65706301-65706323 TTTCAGAAACTTTCTAAGGAAGG - Intergenic
1069266500 10:66464848-66464870 ATGGAGAATTTTTCTGAAGTTGG + Intronic
1069579440 10:69555444-69555466 ATGGAGGAACTTTTTAAGGAGGG - Intergenic
1070126831 10:73629251-73629273 ATGGTGAGACTTTGTGAGCATGG + Intergenic
1071307053 10:84308859-84308881 ATGGTGCAAGTCTCTGAGGAGGG - Intergenic
1071402038 10:85282879-85282901 ATGAAAATATTTTCTGAGGAAGG - Intergenic
1074204226 10:111268199-111268221 TTGGAGATACTTTGTGAGGAGGG + Intergenic
1077953907 11:6992121-6992143 ATGTAGAAACTATGTGAAGAGGG + Intergenic
1079304582 11:19311105-19311127 ATTGAGAAAGATTCTGAGGCTGG + Intergenic
1080630995 11:34075566-34075588 ATGGAATAACTTTCTGAGACTGG + Intronic
1082081934 11:48019042-48019064 ATGGAGAACCCCTCTCAGGAGGG + Intronic
1082113698 11:48305278-48305300 AGGGACTAACTTTCTGTGGAGGG + Intergenic
1082747855 11:56985541-56985563 ATGCAGTAAATTTCTGAGAAAGG + Intergenic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1086035643 11:82410659-82410681 ATGGAGTAACTTTCATAGAAAGG - Intergenic
1087128232 11:94646823-94646845 ATGGCGAAAATTTTTGGGGATGG - Intergenic
1087292747 11:96338374-96338396 ATGAAGAAACTGGCTGAGTAAGG + Intronic
1088353379 11:108914799-108914821 ATGGAAAAATGTTCTGAGCAGGG + Intronic
1089264244 11:117246920-117246942 ATTGAGAAGCTTTGTGAGAAGGG + Exonic
1089765940 11:120765811-120765833 ATGATGAAACTTCCAGAGGAAGG - Intronic
1089831744 11:121335118-121335140 ATGGAGAGACTGTCAGAGGTGGG - Intergenic
1090274353 11:125409185-125409207 TTGGAGAGAATTTGTGAGGAAGG - Intronic
1092182105 12:6453016-6453038 GTGGAGTAGCTTTCTGGGGAAGG + Intronic
1092900921 12:13058689-13058711 ATGTGGAAGCTTTCTGATGAGGG - Intronic
1093595067 12:20949804-20949826 ACTGAGAAACCTTCTCAGGAAGG - Intergenic
1094023855 12:25942057-25942079 GTGGAAAAACTGTCTGAAGAGGG + Intergenic
1095203684 12:39415088-39415110 ATTGAAAATCTTTCTTAGGAAGG + Intronic
1097845458 12:64361581-64361603 ATAGGGTAACTTTCTGAGGTTGG - Intronic
1098007340 12:66011722-66011744 ATAGAAAAACCTTCTGGGGAAGG + Intergenic
1098024102 12:66184726-66184748 ATGAAGAAAGTTTCCAAGGAGGG + Intergenic
1098228157 12:68345892-68345914 ATGGATGAGCTTTCTGAGGGAGG - Intergenic
1098577875 12:72064504-72064526 ATGATTAAACTTACTGAGGAAGG + Intronic
1101720705 12:107348117-107348139 ATGGGGAGACTTTCTGAGTAAGG - Intronic
1104322789 12:127767615-127767637 ATGCAGAAACTTTCAGTGAAAGG + Intergenic
1106892825 13:34264634-34264656 ATAGAGAAGCTTTCTCAGGCAGG - Intergenic
1108006914 13:45957743-45957765 AAGGAAAAACTATGTGAGGAAGG - Intronic
1108056082 13:46486771-46486793 ATGGAGATGCTTTCTGAAGATGG + Intergenic
1108377174 13:49824453-49824475 GTCGAGACACTTTCTGGGGATGG - Intergenic
1109234010 13:59793256-59793278 ATGGAGTAAACTTCTGAGGGCGG - Intronic
1109634154 13:65091422-65091444 ATTAAGATACTTTCTGAGGCGGG - Intergenic
1110383828 13:74884958-74884980 GGGTAGAAACTTTCTTAGGATGG - Intergenic
1110621098 13:77596648-77596670 ACAGAAAAACTTGCTGAGGAAGG + Intronic
1111065234 13:83082472-83082494 ATGGCTAAACTTAGTGAGGAAGG - Intergenic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1113233422 13:108240901-108240923 ATGGAGAATTTTTCAGAAGAAGG + Intergenic
1114241450 14:20872019-20872041 ATGTAGAAACTTTTTTAGAATGG - Intergenic
1114650057 14:24279032-24279054 ATGTAGATCCTTTATGAGGAAGG + Intergenic
1114654542 14:24308196-24308218 ATGGAGGGAATTTCTGGGGACGG + Exonic
1115734363 14:36308669-36308691 ACTAACAAACTTTCTGAGGAGGG + Intronic
1116120290 14:40714411-40714433 ATGGAGATATGTTCTGAGTAAGG - Intergenic
1117041796 14:51774744-51774766 ATGGAAGAACTTTCTGGGGAGGG - Intergenic
1117567354 14:57008246-57008268 ATGTAGAACTTTTCTGAGCAGGG - Intergenic
1117759213 14:59009114-59009136 ATGGAAAAACCTTCTGTTGATGG - Intergenic
1117805909 14:59490486-59490508 AGGAAGAAAATTTCTGTGGAGGG + Intronic
1118507518 14:66429698-66429720 AAGCATAAACTTTCTGAGAAAGG - Intergenic
1118634279 14:67733657-67733679 ATTTAGAAACATTCTGAGAAAGG + Intronic
1118671083 14:68128124-68128146 ATGTAGAAACCTTCTGAACATGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119660338 14:76446852-76446874 ATGGAGCCACTTTCTGTGGCTGG + Intronic
1120560041 14:85980195-85980217 ATGGAGAACCCTTTTGAGCAGGG - Intergenic
1121686798 14:95841677-95841699 ATGGAGAGAGTTAGTGAGGAAGG + Intergenic
1123585132 15:21753205-21753227 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1123621779 15:22195812-22195834 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1125676617 15:41505518-41505540 ATGGCGAAACTTGCTGAGTGGGG + Exonic
1125681902 15:41536252-41536274 ATGGAGAAACTTCCCCAGGCTGG + Intronic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1127836274 15:62793621-62793643 ATGAAGAAACATTCAGAGTATGG - Intronic
1128131451 15:65229778-65229800 CTGGAGCATCATTCTGAGGATGG + Intergenic
1128138233 15:65280131-65280153 ATGGCTAACCTTTCTAAGGAAGG - Intronic
1129156805 15:73723134-73723156 ATGGAGAAATTTTGGGAGGAAGG + Intergenic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129637380 15:77335202-77335224 AAGGAGAATCTTTCTGAGAGAGG - Intronic
1130347417 15:83061037-83061059 ATGGAGATACATTCTAAGAAAGG + Intronic
1131069244 15:89454862-89454884 CTGGAAAAACTTTCTGAGCTGGG + Intergenic
1131353529 15:91723412-91723434 AGGGGGAGACTTGCTGAGGAAGG - Intergenic
1132681156 16:1142359-1142381 ATGGAGAAAATTACTGAGTGTGG + Intergenic
1133527037 16:6615722-6615744 ATAGAGAGACTTTCAAAGGAGGG - Intronic
1133547546 16:6822446-6822468 TTGGAGGAACTTTCAGAGAAAGG + Intronic
1135120709 16:19764060-19764082 ATGGAGAAAAATTCTGTGAATGG - Exonic
1135552620 16:23409704-23409726 AGGGAAAAACTGTCTGAGGAAGG + Intronic
1137261810 16:46836749-46836771 ATGGGGAAATGTTCTGAGAAAGG - Intergenic
1137391567 16:48085641-48085663 ATGGAGAAAACTTCTCAGTAGGG - Exonic
1145051540 17:19665876-19665898 ATGGAGCAACTGACTTAGGACGG - Intronic
1147259949 17:39203819-39203841 ATAGAAAAACTTTCTTAGAAAGG - Intronic
1148833796 17:50454593-50454615 GAGAAGAAACTTTCAGAGGAAGG - Intronic
1149305141 17:55340166-55340188 ATTAAGAGACATTCTGAGGATGG - Intergenic
1149468471 17:56897764-56897786 AGGGAGGAGCTTTCAGAGGAAGG + Intronic
1151061339 17:71097983-71098005 AAAGAGAAACTTTCTCAAGAAGG - Intergenic
1152990314 18:357785-357807 ATGGGGATACATTCTGAGAATGG + Intronic
1154948404 18:21184676-21184698 CTGGTGAAACTTTCTTAGAACGG - Intergenic
1154953151 18:21229517-21229539 ATGATTAAACTTACTGAGGAAGG - Intergenic
1155328743 18:24692693-24692715 ATCAGGAAACTTTCTGAGCATGG - Intergenic
1156711567 18:39953160-39953182 ATGGTTAAACTTAGTGAGGAAGG - Intergenic
1156859386 18:41818434-41818456 ATAGAAAAAGTTTCTGAGAACGG + Intergenic
1157285532 18:46374807-46374829 CTGGAGACACTTCCTGGGGATGG + Intronic
1157418989 18:47529788-47529810 ATGGGGTAATTTTCTGAGGTGGG + Intergenic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1158058222 18:53307200-53307222 ATGGACAAAATCTCTGAGGCAGG + Intronic
1158405763 18:57157824-57157846 ATCAAAAAACTTTCTGAGGTAGG - Intergenic
1159374136 18:67569708-67569730 ATAAAGATACTTTCTGAGTATGG + Intergenic
1162858963 19:13491186-13491208 ATGGAGAAACTTTATGAGACAGG - Intronic
1164550130 19:29203786-29203808 TTGGAAAAACTTACTGAGAAAGG + Intergenic
1165631518 19:37305580-37305602 AGGGAGAAACTTCGTGAGGATGG - Intergenic
1166415910 19:42594874-42594896 ATCCAGAAACTTTCTGAGCACGG + Exonic
1166420569 19:42633080-42633102 ATCCGGAAACTTTCTGAGCATGG + Intronic
1166432659 19:42740430-42740452 ATCCAGAAACTTCCTGAGCATGG + Exonic
1166448634 19:42879627-42879649 ATCCAGAAACTCTCTGAGCACGG + Exonic
1166471441 19:43082615-43082637 ATCCAGAAACTTCCTGAGCACGG + Exonic
1166482585 19:43186450-43186472 ATCCAGAAACTTCCTGAGCACGG + Exonic
1166776391 19:45315464-45315486 GTGGAGAAGCTCTCTGTGGAAGG - Exonic
1167385500 19:49160737-49160759 GTGGAAAAACTTTCTGGGGCTGG + Intronic
1168612535 19:57812870-57812892 ATGAAGAGAATTTCTAAGGACGG + Intronic
926159651 2:10478516-10478538 ATGTACAAACGTTCGGAGGAGGG - Intergenic
926775307 2:16416345-16416367 ATGGAGATTCTTTTTTAGGAAGG + Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927574663 2:24191092-24191114 ATGTAGGAATTTTCTGAGTATGG + Exonic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
927835519 2:26395236-26395258 ATGAAGAAACTATCTGATAAAGG - Exonic
928333109 2:30372823-30372845 AAGGAGAAAATATCTAAGGATGG - Intergenic
929273916 2:40005061-40005083 GTGGAGAAGTTGTCTGAGGATGG + Intergenic
930017528 2:46981342-46981364 ATCGAGCAACTTTGTGGGGAAGG - Intronic
931683880 2:64776324-64776346 ATGAATAAACTTAGTGAGGAAGG - Intergenic
932487501 2:72093507-72093529 AAGGAGAAGCTTGCTGGGGAAGG - Intergenic
932505443 2:72225943-72225965 ATGGATACAACTTCTGAGGAGGG - Intronic
933204396 2:79488796-79488818 CAGGAGAGGCTTTCTGAGGAGGG - Intronic
933211927 2:79580161-79580183 TTGGAGAAACTTTCTCCAGATGG + Intronic
933698439 2:85237540-85237562 ATAGTGACATTTTCTGAGGATGG - Intronic
934583185 2:95464124-95464146 ATTGTGAAATTTTCTGAGGATGG - Intergenic
934596265 2:95612590-95612612 ATTGTGAAATTTTCTGAGGATGG + Intergenic
934786503 2:97012958-97012980 ATTTTGAAATTTTCTGAGGATGG - Intronic
935475270 2:103513239-103513261 ATAAAGTAACTTTCAGAGGAAGG - Intergenic
936092100 2:109508070-109508092 ATGGGGAAATCTGCTGAGGAAGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
937867303 2:126762286-126762308 TTGGAGAAACTTTTTTTGGAGGG - Intergenic
939627917 2:144501215-144501237 ATGGAGAAAGTTCCTGAGATTGG - Intronic
940195189 2:151086429-151086451 ATGGAAAAACTTTCTGATGTTGG - Intergenic
942672470 2:178390662-178390684 ATGGCCAAATTTTATGAGGAGGG - Intronic
942819207 2:180091268-180091290 ATGGGGATACATTCTGAGAAAGG - Intergenic
946609221 2:221439965-221439987 ATGCAGAAAATTTGTGAAGATGG - Intronic
946657349 2:221962532-221962554 ATGGGGACACTTTCTTAGGTGGG + Intergenic
946832623 2:223741592-223741614 ATGGAGAAGCTTCCTCAAGAGGG + Intergenic
948511198 2:238466426-238466448 CTTGAGAAGCTTCCTGAGGAGGG + Intergenic
1169783444 20:9333315-9333337 AGGGAGAGCCTCTCTGAGGAGGG + Intronic
1169975584 20:11323643-11323665 ATGGATCACCATTCTGAGGAAGG - Intergenic
1170427185 20:16246769-16246791 ATGGAAAATGTTTCTGAGAAAGG - Intergenic
1170517399 20:17145641-17145663 ATGCAGAAGCCTTCTGAGAATGG + Intergenic
1170947481 20:20904302-20904324 CTGGACAAACTCCCTGAGGAAGG - Intergenic
1171956056 20:31464680-31464702 ATGGGGAAATTTTGGGAGGAAGG - Intergenic
1171994632 20:31722551-31722573 AGGGAGTGACTTTCCGAGGAAGG - Intronic
1173026982 20:39316861-39316883 ATGAATCAGCTTTCTGAGGATGG - Intergenic
1173927027 20:46788312-46788334 CTGGAGAAACTTTCTGAAGAAGG - Intergenic
1174105430 20:48158911-48158933 ATGGCGAATCTTTCTGAAGCTGG + Intergenic
1174707390 20:52670374-52670396 ATGCAGAAATTTCCAGAGGAAGG - Intergenic
1175456064 20:59115401-59115423 AAGGAGATTCTTTCTGAGGAGGG - Intergenic
1175968726 20:62673215-62673237 AGGGAGAAACTTCCCGAGGGAGG + Intronic
1176086696 20:63298610-63298632 ATTGAGACTCGTTCTGAGGAGGG - Intronic
1176367592 21:6043245-6043267 ATGGTGGAACTTTCTGGGCACGG + Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1178027549 21:28485392-28485414 TTGAAGAAACTTTCTCAGAAAGG + Intergenic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1179755927 21:43495297-43495319 ATGGTGGAACTTTCTGGGCACGG - Intergenic
1181778065 22:25174184-25174206 ATGGAGAACGTTTCAGAGAACGG - Intronic
1181838836 22:25636671-25636693 ATGAAGGAACTTTCTAAGAATGG - Intronic
1183031971 22:35113326-35113348 AGGGAGGAGCTTTGTGAGGAAGG - Intergenic
949326314 3:2868880-2868902 ATGGAAAGCCTTTCTAAGGAGGG + Intronic
950323683 3:12083519-12083541 AAGGAGAAACTTTGGGAGGAAGG - Intronic
951633841 3:24751557-24751579 ATGGAGATGCTTTTTCAGGAAGG + Intergenic
951937578 3:28038636-28038658 AATGAGCTACTTTCTGAGGAAGG - Intergenic
951975387 3:28501668-28501690 ATGAGGAAACTTTCTGGGTAAGG - Intronic
952123276 3:30270072-30270094 ATGGAGAAACTTTTGGAGAGCGG + Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953751605 3:45612642-45612664 ATGAGGGAACTTTCTGGGGATGG - Intronic
953808103 3:46089152-46089174 ATGGTGAAGCTTTCTGATGAAGG - Intergenic
955202650 3:56864806-56864828 ATCAAGACACTCTCTGAGGAAGG - Intronic
955362589 3:58288393-58288415 ATGCAGAAACCCTCTCAGGAAGG - Intronic
955791026 3:62588933-62588955 ATGCAGAGACTATCTGGGGAAGG + Intronic
956377838 3:68634735-68634757 AGAGAGAGCCTTTCTGAGGAAGG - Intergenic
959380337 3:105633816-105633838 ATTGAGAAACTTTCAGATTATGG + Intergenic
959384485 3:105685025-105685047 ATGAAGAAAAATTCTAAGGAAGG + Intronic
960053512 3:113259918-113259940 AGGTGGGAACTTTCTGAGGACGG - Intronic
960094889 3:113679708-113679730 ATGAAAGAACTTTCTGAGGCTGG - Intronic
960138311 3:114127973-114127995 ATGGGGATATTTTCTGAAGACGG - Intergenic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
962189047 3:133291038-133291060 ATGGAGATATTTTGTGAAGATGG + Intronic
964086920 3:152830311-152830333 AGCAAGAAACTTTCTAAGGATGG + Intergenic
964124964 3:153226619-153226641 ATGGCGAAAATTTTTGGGGATGG + Intergenic
964879695 3:161409983-161410005 AGGGAAAGACTTTCTCAGGAGGG - Intergenic
964936768 3:162098831-162098853 ATGGTGAAACTCTCTGAAGATGG + Intergenic
965633728 3:170759583-170759605 TTGGGGAGACCTTCTGAGGAAGG - Intronic
970949273 4:21733841-21733863 ATGGCTAAACTTTCTGAATAAGG - Intronic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971870699 4:32234674-32234696 ATGGAGAATGTATTTGAGGAAGG + Intergenic
972670806 4:41213199-41213221 ATGAGGAAACTTTGTGAGGTTGG - Intronic
973052405 4:45611617-45611639 TTGGAGGAGCTTTCTGATGAGGG - Intergenic
973922652 4:55704539-55704561 AGGGAGGAACATTCTGAGCAGGG + Intergenic
974270326 4:59642542-59642564 ATGGTGAAACATTCTGAAAAAGG + Intergenic
974283865 4:59838338-59838360 ACTGAGAAACTCTCTGAGGAGGG - Intergenic
976712625 4:88088442-88088464 GTTGACAAACTTTCTGAGAAGGG - Intergenic
977108932 4:92925634-92925656 ATGTAGAAATTTTCTGTGGCTGG + Intronic
977413527 4:96698926-96698948 ATGCAGAAACCTTTTGATGAAGG + Intergenic
980038805 4:127915428-127915450 AATGAGGAACTTTCTAAGGATGG - Intergenic
982793501 4:159619036-159619058 ATGGAGAAGATTTATTAGGAAGG + Intergenic
983453015 4:167930351-167930373 AGGCAGAAAAGTTCTGAGGAAGG + Intergenic
983686975 4:170421998-170422020 ATGGTGAAACTTGCTGAAGCTGG - Intergenic
984145254 4:176052661-176052683 CTTGAGAAACATTCTGAGGAAGG - Intergenic
984233216 4:177125010-177125032 ATGGAGATGCTTCCTGGGGAAGG - Intergenic
984276914 4:177622166-177622188 ATGGGGATACATTCTGAGTACGG - Intergenic
984565987 4:181330633-181330655 ATGCATAAACTTTATGAGGAGGG + Intergenic
984720476 4:182968602-182968624 ATGGAGTCATTTACTGAGGAGGG - Intergenic
985815122 5:2122427-2122449 ATGAAGAAATTATCAGAGGAAGG - Intergenic
985942469 5:3149563-3149585 ATGGAGCAATTTTATGATGACGG + Intergenic
986124370 5:4871755-4871777 GTGGAGAAGCTTTCACAGGAAGG + Intergenic
986819697 5:11452058-11452080 AGGAAGAAACTTTCTGAAAATGG + Intronic
987576451 5:19734496-19734518 TTGGTGAATTTTTCTGAGGATGG - Intronic
989541472 5:42623616-42623638 TTGGAGAAACTTCCTTGGGAAGG - Intronic
990734271 5:58842614-58842636 ATGATGAATCTTTCTTAGGATGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992837601 5:80655503-80655525 GTGGATAAAGTTTCTTAGGATGG + Intronic
993677014 5:90828349-90828371 TTGGAGAATATTACTGAGGAGGG - Intronic
994111573 5:96010729-96010751 ATGGAAAAACATTCTGTTGATGG - Intergenic
994687136 5:102969467-102969489 ATGGGGGTCCTTTCTGAGGAAGG + Intronic
994760970 5:103853606-103853628 ATGATTAATCTTTCTGAGGAAGG - Intergenic
994837469 5:104874028-104874050 ATGGGGATACTTTCTGAAAAAGG - Intergenic
995431750 5:112087174-112087196 AGGGAGAAAATTTCTATGGATGG - Intergenic
995662275 5:114498689-114498711 ATGAAGAAAATTATTGAGGAAGG - Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998968833 5:147569297-147569319 AAGGAGAAAATTACTGTGGAAGG + Intergenic
999055648 5:148573239-148573261 ATTGAGAAGGTTTCTGAGAATGG + Intronic
999648014 5:153738268-153738290 GTGGTGACATTTTCTGAGGAGGG - Intronic
1000382072 5:160638233-160638255 ATGAAGAAAGTTCATGAGGAGGG - Intronic
1001928861 5:175658592-175658614 ATGGAGCAACTTTCTGCTAAAGG + Intronic
1002765535 6:235568-235590 ATGAAGAGGATTTCTGAGGAGGG - Intergenic
1003452416 6:6247586-6247608 GTGGAACAACTTTCTGAGAAAGG - Intronic
1003598746 6:7499218-7499240 ATGGTGAAGCTTGGTGAGGAAGG - Intergenic
1003941161 6:11028436-11028458 ATGGAGACAGTTTCTCTGGACGG - Intronic
1004768155 6:18754592-18754614 ATGGCGAAAATTTTTGGGGATGG + Intergenic
1007009801 6:38405175-38405197 ATAGACAATCTATCTGAGGAAGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008726019 6:54420553-54420575 ATGAAGAAAGTTATTGAGGAAGG - Intergenic
1008927365 6:56901037-56901059 AGAGAGACTCTTTCTGAGGAAGG + Intronic
1009632931 6:66222655-66222677 ATGGAGATAATTTCTGTGCAAGG + Intergenic
1013043293 6:106458103-106458125 ATGCAGAAATTTTCTGAAGACGG + Intergenic
1015036043 6:128655873-128655895 GTGAGGAAACTCTCTGAGGATGG - Intergenic
1015382371 6:132584113-132584135 ATGGACAAAGGTTCTGAGGAAGG - Intergenic
1015762517 6:136680233-136680255 ATGAAAAAATTTTCTGTGGATGG + Intronic
1016201178 6:141410419-141410441 ATGGTGGAAATTTCTGGGGAAGG - Intergenic
1016602052 6:145873546-145873568 ATGGACATAAATTCTGAGGAGGG + Intronic
1016698502 6:147026718-147026740 ATGGACAAACTTTCAAAGAACGG + Intergenic
1016710989 6:147171621-147171643 ATGGAGACACTTTCCTAGCATGG + Intergenic
1017239416 6:152150415-152150437 TGGCAGAAACTTTCTGTGGAAGG + Intronic
1017955758 6:159176507-159176529 TTGGAGAAAGATGCTGAGGAAGG + Intronic
1019582779 7:1775465-1775487 ATGAAGATATTTTCAGAGGAAGG - Intergenic
1020915081 7:14183506-14183528 AAGGAGAAACTGTATGGGGAAGG + Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021880513 7:25090990-25091012 ATGTTGAAAATTTCTGAGGCAGG + Intergenic
1022543291 7:31159984-31160006 ATAGAGAAACTCTATGTGGAAGG - Intergenic
1022800729 7:33774856-33774878 ATGGAGATCCTTTTGGAGGAAGG + Intergenic
1023183519 7:37510503-37510525 ATGAAAAAACATTCTGAAGATGG - Intergenic
1023751598 7:43378450-43378472 ATGCAGAATCTTTCTAAGGCAGG - Intronic
1024310538 7:47965312-47965334 ATGCAGAGACTTTGTCAGGATGG - Exonic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1026375487 7:69746411-69746433 ATGGTGATACATTCTGTGGAGGG + Intronic
1026988067 7:74567384-74567406 AGGGAGAAACTTACTGAAGGGGG + Intronic
1027343183 7:77231786-77231808 AGGCAGAAACTTTCTTAGGGAGG - Intronic
1028783340 7:94763347-94763369 TTGCAGATACTTTCTGAGGGAGG - Intergenic
1030672437 7:112352255-112352277 ATCAAGATAATTTCTGAGGAAGG + Intergenic
1030864610 7:114684326-114684348 ATTCAGAAACTGTCAGAGGAGGG + Intronic
1031229778 7:119091366-119091388 ATGGAATAACTTTTTGAGGTAGG + Intergenic
1031452416 7:121938146-121938168 ATGGAGAGGATTTCTGAGGTGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1034693006 7:153029024-153029046 ATGGAGACCCTTTCTCAGCAGGG - Intergenic
1035953775 8:4053112-4053134 ATGGAGAAGCTTCCTGGGCAAGG - Intronic
1036652768 8:10655587-10655609 GTGGAGAAAATGGCTGAGGACGG - Intronic
1037405131 8:18534208-18534230 CTAGAGAAACTTTCTAAGGGAGG + Exonic
1038092567 8:24270336-24270358 ATGGAGCACCTTTGTGAGGGTGG + Intergenic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039511908 8:38098693-38098715 ATGGAGCAGCTTTCTAAAGAAGG - Intergenic
1039900047 8:41745203-41745225 AGGGAGAAATTGTCAGAGGAGGG + Intronic
1040462678 8:47663965-47663987 ATGGAGAAACATTCTATGAATGG + Intronic
1041635843 8:60142937-60142959 AAGGAGATTCTTTCTGATGAAGG + Intergenic
1042930696 8:74011140-74011162 CCAGAGTAACTTTCTGAGGAAGG - Intronic
1043588096 8:81793395-81793417 ATGGAGACACTTACAGAGGGAGG - Intergenic
1043723200 8:83574367-83574389 ATTGAAAAACTGTCTTAGGATGG + Intergenic
1044036323 8:87308012-87308034 ATGGGGAAACTTCCTGGAGAAGG - Intronic
1044795555 8:95893501-95893523 TTAGAGCAACTCTCTGAGGAAGG - Intergenic
1046275028 8:111947725-111947747 ATGGAGAAACTAGCTGAAGGAGG + Intergenic
1047428134 8:124765534-124765556 TTGAAGAATGTTTCTGAGGAAGG - Intergenic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1047825125 8:128565058-128565080 ATGGATTAACTAACTGAGGATGG + Intergenic
1047993182 8:130307965-130307987 ATGGAGACAACTTTTGAGGAAGG - Intronic
1048373742 8:133803501-133803523 ATGGAAAGACTTTCTGGAGAGGG - Intergenic
1048710259 8:137201982-137202004 ATGGAGACAGTTATTGAGGAAGG + Intergenic
1049048222 8:140169891-140169913 ATGCAGAAACTAGCTGAGCATGG - Intronic
1050149249 9:2602623-2602645 ATGTAGAAAGTTTGAGAGGAAGG - Intergenic
1050859443 9:10407923-10407945 ATGGGGAAACTTTTGGAAGAAGG + Intronic
1051790117 9:20792454-20792476 ATGGGGATACGTTTTGAGGAAGG - Intronic
1052169124 9:25372221-25372243 ATGAGGAAACTCTCTGAGGCAGG + Intergenic
1052725313 9:32221815-32221837 ATGGGGAAACTTTCTGATTTTGG + Intergenic
1052907719 9:33851246-33851268 ATGGTGAAACTATCAGAGGTTGG - Intronic
1055368522 9:75572109-75572131 CTGGATATACTTTCAGAGGAAGG - Intergenic
1056083170 9:83118419-83118441 ATGGATCAACTTTCGGATGAAGG + Intergenic
1058148940 9:101443046-101443068 ATGGAGAAATCTTTTGAGGGTGG - Intergenic
1058180169 9:101788608-101788630 TTGGAGATACTGTCTAAGGAAGG + Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059334087 9:113557765-113557787 CTGGGGAAAGTTTCTGAGGCAGG + Intronic
1060478961 9:124006557-124006579 ATGTAGAAACTCCCGGAGGAGGG - Intronic
1060540631 9:124427968-124427990 ATGAGGAAACTTTCTGATGGTGG - Intergenic
1062745259 9:138207921-138207943 CTGGAGGAACTTTCTGATGGTGG + Intergenic
1203484542 Un_GL000224v1:40346-40368 AGGGAGAAACTTTCAGACCACGG + Intergenic
1203484556 Un_GL000224v1:40450-40472 AGGGAGAAACTTTCAGACCACGG + Intergenic
1186108520 X:6230806-6230828 AAGGAAGAACTTTCTGAGTAGGG + Intergenic
1186109942 X:6245060-6245082 ATGATGAATTTTTCTGAGGAAGG - Intergenic
1186257990 X:7743512-7743534 ATGTTGCACCTTTCTGAGGATGG - Intergenic
1186640105 X:11446482-11446504 ATGGAGAATTTATCTGAGGAGGG - Intronic
1186730266 X:12402437-12402459 ATGGTGCAACTTACTGAGGTAGG - Intronic
1190118239 X:47639482-47639504 AGAGAGAAACTTACAGAGGAGGG - Intronic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1190989484 X:55531318-55531340 ATGAAGAAACTTGATGATGAAGG - Intergenic
1191629034 X:63300969-63300991 ATGCAAAAACTGTCGGAGGATGG - Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192817826 X:74613464-74613486 ATGGTGAAACTGTCTAGGGAAGG + Intronic
1193525780 X:82586613-82586635 ATGAAGATCCTTTCTGAGAAAGG - Intergenic
1193577781 X:83224632-83224654 CTGGAGAGACTTTCTGTGGAGGG - Intergenic
1194994013 X:100573684-100573706 ATAGAGTATCTTTCTAAGGAGGG + Intergenic
1195126345 X:101813091-101813113 ATGGTGATACCTTCTGAGAAAGG + Intergenic
1195179256 X:102340269-102340291 ATGGCGATACCTTCTGAGAAAGG - Intergenic
1195374184 X:104210226-104210248 ATGGAGAAAGTATCATAGGAAGG + Intergenic
1195704419 X:107728765-107728787 ATGGAAAATCTTTCTCAGAAGGG + Intronic
1195724718 X:107902714-107902736 ATGGAGCAACCCTCTGAAGAGGG + Intronic
1197242366 X:124133600-124133622 TTGGAGAAAGTTGCTGAGGCAGG + Intronic
1197604815 X:128573304-128573326 AAAGAGACACTTTTTGAGGAAGG - Intergenic
1197789044 X:130232432-130232454 TAGGAGAAACTATCTGAGAAAGG + Intronic
1198514384 X:137389955-137389977 ATGGAAAAAATTCCAGAGGAAGG - Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198729000 X:139707301-139707323 AGGTAGAAAGTTTCTGGGGAAGG - Intronic