ID: 1112701007

View in Genome Browser
Species Human (GRCh38)
Location 13:102008011-102008033
Sequence ATTCATTCTCACCTGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112701007_1112701009 13 Left 1112701007 13:102008011-102008033 CCAGGCTACAGGTGAGAATGAAT 0: 1
1: 0
2: 2
3: 9
4: 161
Right 1112701009 13:102008047-102008069 TGCATCCCTATTTGTAATTCAGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112701007 Original CRISPR ATTCATTCTCACCTGTAGCC TGG (reversed) Intronic
900505021 1:3025562-3025584 GGACATTCTCACCTGTAGACTGG - Intergenic
901712786 1:11128843-11128865 AAGTATCCTCACCTGTAGCCAGG + Exonic
903068524 1:20715001-20715023 GGTAATTCTCACCTGCAGCCTGG + Intronic
903403915 1:23080438-23080460 AGCCATTCTTACCTGTTGCCTGG + Intronic
903549521 1:24148207-24148229 ATTCATAGTCACCTGAAGTCAGG - Intergenic
904927544 1:34060568-34060590 ATTCCTTCTCATCTAGAGCCAGG + Intronic
906448867 1:45926848-45926870 ATTCAGGGTCACCTGGAGCCAGG - Intronic
906684154 1:47752240-47752262 CTTCATGCTCACCAGTAGGCAGG + Intergenic
907875044 1:58477698-58477720 AGTCTTTCTCACCTGTTCCCTGG - Intronic
910425149 1:87114144-87114166 ATTCATTCTCATCTGTAAAATGG - Intronic
910516349 1:88065268-88065290 CTTCTTTCTCAACTGTAGCATGG + Intergenic
911107673 1:94149196-94149218 ATTTAAATTCACCTGTAGCCTGG - Intronic
911817581 1:102373067-102373089 AGTCATTCTCACACTTAGCCAGG + Intergenic
912036656 1:105324851-105324873 ATACAGTCTCACCTGAAGCCAGG + Intergenic
912089270 1:106050384-106050406 ATTAATTCTCACCTAGATCCAGG - Intergenic
913263138 1:117018875-117018897 ATTTCTTCTCCCCTCTAGCCAGG - Intronic
915718102 1:157963368-157963390 TTTCACTCTCTCCTGTAGGCAGG - Intergenic
919023600 1:192139851-192139873 CTTCATTCTCCCATGTAGCTGGG - Intergenic
920262259 1:204696939-204696961 TTTCTTTCTCAGCTGCAGCCTGG - Intergenic
922124444 1:222709135-222709157 ATGTATTTTCAACTGTAGCCGGG + Intronic
924349826 1:243104091-243104113 ATGGAGTCTCACCTGTCGCCAGG - Intergenic
1064767184 10:18686773-18686795 ATTAACTCTCACCACTAGCCTGG - Intergenic
1065151544 10:22827443-22827465 GTTCTTTCTGACCTGCAGCCAGG + Intergenic
1069084137 10:64119993-64120015 ATTCTTTCTCAACTAGAGCCTGG + Intergenic
1070978447 10:80624590-80624612 GTTGATTCTAACATGTAGCCAGG - Intronic
1071094443 10:81957044-81957066 ATTAATTCTCACCAGTAACATGG + Intronic
1076206127 10:128604779-128604801 ATTTATCCTCACATGTATCCCGG - Intergenic
1076472577 10:130729120-130729142 ATGCATCCCCACCTGAAGCCAGG - Intergenic
1077115860 11:884395-884417 TGTCATTCTCAGCTGTACCCTGG - Intronic
1078660396 11:13281122-13281144 ATTCCTTCTCACCTCTACCCGGG + Intronic
1079359739 11:19760426-19760448 CTGCATTCTCCCCTGAAGCCAGG - Intronic
1082766714 11:57174593-57174615 CTGCATTCTCACCTGGAGCTTGG + Intergenic
1083815952 11:65132534-65132556 TTGCCTTCTCACCTGCAGCCTGG - Intronic
1084410477 11:69003601-69003623 ACTCATTCCCACCTGGAGCTCGG + Intergenic
1090911349 11:131122249-131122271 ATGCATTTTCACCTGCAGGCTGG - Intergenic
1092903429 12:13081158-13081180 ATTCTTTCCCACCTGTACCTTGG + Exonic
1095965671 12:47865312-47865334 AGTCACTCTCACCTCTAGGCTGG + Intronic
1095969062 12:47889225-47889247 ATACTTTCTCACCTCCAGCCTGG + Intronic
1097011645 12:55957452-55957474 ACTCATACTTACCTGGAGCCTGG - Exonic
1098566959 12:71947638-71947660 ATCCATTCTGAACTGAAGCCAGG - Intronic
1100078548 12:90820066-90820088 TTTCATCCTCACTTGTAGCATGG - Intergenic
1107622719 13:42249890-42249912 ATTGATTCTTACCTGTGGCCAGG + Intronic
1112701007 13:102008011-102008033 ATTCATTCTCACCTGTAGCCTGG - Intronic
1113218443 13:108070402-108070424 ATTCAGTCTCCCCTGTAAACTGG + Intergenic
1113280284 13:108781104-108781126 ATTCACTATCACCTGTGCCCAGG + Intronic
1116390079 14:44380985-44381007 ATTCTTTCTGAGCTGCAGCCAGG + Intergenic
1117584281 14:57184240-57184262 AGTGATTCTAACATGTAGCCAGG + Intergenic
1118847961 14:69562278-69562300 TTTCATTATCACATGAAGCCAGG - Intergenic
1124449872 15:29778223-29778245 AGTGATTCTTACCTGCAGCCTGG - Intronic
1125306577 15:38323734-38323756 GTTGATTCTAACCTTTAGCCAGG + Intronic
1125316097 15:38433133-38433155 TTTCATTCTCACCAGGAACCAGG - Intergenic
1126325791 15:47475890-47475912 ATTCTTTCTGATCTTTAGCCAGG - Intronic
1126596232 15:50386669-50386691 ATCCTGTCTCACCTGTAGCTGGG - Intergenic
1127403279 15:58613285-58613307 ATATACTCTCACCTGTAGCTAGG - Intronic
1127747279 15:61991847-61991869 CTTCATTTTCAGGTGTAGCCTGG + Intronic
1128455841 15:67830879-67830901 ATTTATCCTCACCTCTGGCCAGG - Exonic
1128609753 15:69064123-69064145 ATGCATTCTCACCTGTAAAATGG + Intergenic
1129970599 15:79774751-79774773 CTTCAGCCTCACCTGTAGCTGGG - Intergenic
1130789956 15:87143455-87143477 ACACAGTCTCACCTGTCGCCAGG - Intergenic
1133655727 16:7862004-7862026 ATTCATTGTCAATGGTAGCCAGG - Intergenic
1133882592 16:9797158-9797180 TTTCTCTCCCACCTGTAGCCTGG + Intronic
1135229442 16:20691903-20691925 TTTCATTCTCGCCTGTAGGGGGG - Intronic
1136140056 16:28282613-28282635 ATTCATTCACACTTGTTCCCAGG - Intergenic
1137239868 16:46647066-46647088 TTTCATTCTCAGCTGTACCTTGG - Intergenic
1140132064 16:72171640-72171662 CTTCATTCTCACATGAACCCTGG + Intronic
1140209953 16:72961968-72961990 CTGCAGTCTCACCTGTATCCCGG - Intronic
1141095064 16:81157279-81157301 ATGGAGTCTCACCTGTTGCCAGG + Intergenic
1143365994 17:6409007-6409029 ATTCACTCTCATCTACAGCCAGG + Intronic
1144266928 17:13578615-13578637 ATTCAATCTAATCTGAAGCCTGG + Intronic
1146525193 17:33561430-33561452 ATTCATTCCCACCTGTAGCAAGG + Intronic
1157415661 18:47500689-47500711 ATTCATTCTCACTTCTATGCTGG - Intergenic
1158934816 18:62354699-62354721 ATTCATTCTCAGGTCTTGCCTGG - Intronic
1162131238 19:8527288-8527310 AGTCACTCTCACCTGTCCCCTGG - Intronic
1163473880 19:17513701-17513723 CTTCAGCCTCCCCTGTAGCCGGG - Intronic
1163974249 19:20834445-20834467 ATTCAATCTCCCATGTAGCTGGG + Intronic
1165108556 19:33488284-33488306 GATCATGCTCACCTGGAGCCTGG - Intronic
1166394113 19:42426255-42426277 ATTCACACTCACCTGTATCCTGG + Exonic
925987955 2:9231210-9231232 CTTCACTCCCTCCTGTAGCCAGG + Intronic
927108365 2:19846612-19846634 ATTCAAACTCCACTGTAGCCAGG + Intergenic
927647927 2:24890636-24890658 ATTCATGCTCACCTGCATCCCGG + Intronic
928427729 2:31192704-31192726 GGTCTTTCTCACCTGGAGCCTGG - Intronic
928798907 2:35062568-35062590 ATTCATTATCACCTAGAGACAGG - Intergenic
928992878 2:37254192-37254214 ATTTTTTTTTACCTGTAGCCAGG + Exonic
929102783 2:38332720-38332742 ATTCATTCTCCCCTGGACTCTGG - Intronic
929235985 2:39606257-39606279 GTTGATTCTTACCTGCAGCCAGG + Intergenic
929487202 2:42365509-42365531 ACTCAGCCTCACCTGTAGCTGGG - Intronic
929663161 2:43810148-43810170 AGGCATTCTCAGCTGTAGCTGGG + Intergenic
930649728 2:53952586-53952608 ATTCATTCTCCCCTGTGGTTAGG + Intronic
931475966 2:62587853-62587875 ATCCATTCTCACTTGTACACAGG - Intergenic
931967979 2:67554374-67554396 TTGCATTCTCATCTGAAGCCAGG - Intergenic
933214564 2:79614763-79614785 ATTCAGTCTTTCCTGTAGCATGG + Intronic
938580457 2:132641282-132641304 ATGCATTCTCAGCTATAGCGAGG - Intronic
938608647 2:132923155-132923177 GTTCATTCTCAAGTGTATCCAGG - Intronic
939227427 2:139381814-139381836 ACTCAATAGCACCTGTAGCCAGG + Intergenic
939307871 2:140431722-140431744 ATTCATTCAAAACTGTATCCAGG + Intronic
941558992 2:167021051-167021073 ATTTATTCTAACATGCAGCCAGG - Intronic
941760802 2:169240932-169240954 ACTCATTCTGAACAGTAGCCTGG - Intronic
945868676 2:215203670-215203692 CTTCATTCACAACTGTAGCTGGG - Intergenic
1168942821 20:1727900-1727922 ATTCATTCAAAACTGTATCCAGG - Intergenic
1170149426 20:13214030-13214052 AGTGATTCTCACCTGAATCCTGG + Intergenic
1170533124 20:17314348-17314370 ATTCATTCCCACTTGTGTCCCGG - Intronic
1172672777 20:36645784-36645806 ATTCTTCCTCACCTGTCTCCAGG + Intronic
1173131626 20:40399473-40399495 ATTCACTCTAACCTGGAACCAGG + Intergenic
1173294086 20:41740236-41740258 TTTCAGTCTCACCTCTTGCCAGG - Intergenic
1174384414 20:50178581-50178603 ATTTATTCTCCCCTGAAACCAGG - Intergenic
1175218942 20:57406000-57406022 CTTCCTTCTGACCTGTAGGCAGG - Intronic
1178623049 21:34193086-34193108 ATTCTTTCTCACCTGTATCCTGG + Intergenic
1178664472 21:34534381-34534403 GTTCTTTCCCACCTGTAACCTGG + Intronic
1178679004 21:34656125-34656147 ATTCATTCTAACCTGTTATCTGG - Intergenic
1178829982 21:36047978-36048000 ATGGAGTCTCACCTGTTGCCAGG - Intronic
1180180137 21:46115082-46115104 ATTCATTCCCAGCTGTAGTAGGG - Intronic
1184711893 22:46255407-46255429 GTTCTGTCTCACCTGTTGCCAGG - Intergenic
950995155 3:17488129-17488151 ATTCATTCTTTCCTGTTTCCTGG + Intronic
951114415 3:18843360-18843382 TTGCATTCTCCCATGTAGCCTGG - Intergenic
952129147 3:30339033-30339055 ATTCTTTCTCTCCTTCAGCCTGG - Intergenic
952254422 3:31683258-31683280 ATTCATTCTCACCGGTGTTCTGG - Intronic
953206514 3:40834774-40834796 ATTCCTGCCCACCTGTATCCTGG + Intergenic
953536455 3:43780525-43780547 ATACATCCTCACCTATATCCTGG + Intergenic
953584644 3:44188625-44188647 ATTCATTTTAACCTGTGGCAAGG + Intergenic
955119607 3:56044023-56044045 ATTAAATCTCACCTGCAGACAGG + Intronic
955655503 3:61240800-61240822 AGTGATTCTAACTTGTAGCCAGG - Intronic
957276293 3:78094634-78094656 AACCATTCTCACTTGTGGCCAGG + Intergenic
961808765 3:129508467-129508489 CTTCATTCTCATCTGTAACATGG - Intronic
962084062 3:132172297-132172319 ATTCTTTTTCACCTCTAGTCAGG - Intronic
965427289 3:168542913-168542935 CTTCATCCTCACCTTTAGCTAGG + Intergenic
967072401 3:185973212-185973234 ATTAATACTCACCAGAAGCCGGG + Intergenic
970057219 4:11988649-11988671 AGTCATTCTCTGCTGCAGCCAGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972281100 4:37602883-37602905 AATCATTCTCACCAGTATCCAGG + Intronic
974162973 4:58163985-58164007 ATCCATTCTCCCTTGTAGCATGG + Intergenic
975837266 4:78437236-78437258 ATTCATTCTAACTAGGAGCCAGG + Intronic
977960689 4:103081589-103081611 ATTAATTCTTACTTGTGGCCGGG - Intronic
979252114 4:118576469-118576491 ATGGAGTCTCACCTGTTGCCAGG + Intergenic
979603821 4:122615593-122615615 ATACACACACACCTGTAGCCAGG - Intronic
982325003 4:154121086-154121108 ATGCATTCTCATCTGGACCCTGG - Intergenic
986146102 5:5079256-5079278 ATTCATCCTCATCTGTAGGTAGG + Intergenic
988393193 5:30662404-30662426 ATTTATTCTCCCCTGTTGCCAGG + Intergenic
989255933 5:39365702-39365724 GATCATTCTAACGTGTAGCCAGG + Intronic
992749980 5:79853005-79853027 ATTCAGTCTCGACTGAAGCCAGG - Intergenic
993608323 5:90022524-90022546 ATTCAGCCTCACCAGTAACCAGG + Intergenic
994201826 5:96985293-96985315 AATCATTCTCAACTGTAGTCTGG - Intronic
1001436534 5:171703660-171703682 ATTCATTCTAACATCTACCCTGG + Intergenic
1001794515 5:174490949-174490971 CCTCATTCCCACCTGTTGCCTGG - Intergenic
1002151142 5:177232013-177232035 CTTCAGTCTCACATGTAGCTGGG + Intronic
1006932465 6:37696483-37696505 AATCATTCCCACCTCTAGCAGGG + Intronic
1008080166 6:47186239-47186261 ATTGATTCTAATGTGTAGCCAGG + Intergenic
1008605150 6:53132767-53132789 ATTCACTCTCCCATGTAGCTTGG - Intronic
1012502032 6:99898774-99898796 CTGCATTCTCATCTGAAGCCTGG + Intergenic
1016148880 6:140711189-140711211 ATTCATTCTCTCCTGTGACACGG + Intergenic
1016961810 6:149680178-149680200 ATTCATTGTCAGCTTCAGCCAGG + Exonic
1024395386 7:48860559-48860581 ATTCAAACTCCCCTGAAGCCAGG + Intergenic
1024399851 7:48911713-48911735 ATTCAAACTCCCCTGAAGCCAGG - Intergenic
1025023926 7:55500466-55500488 CTGCATTCTCACCTGGAGCTTGG - Intronic
1027495768 7:78886304-78886326 ATTCATTGTCTCCTTTAACCTGG + Intronic
1028857824 7:95611983-95612005 CTTCATTCCCTCCTATAGCCAGG + Intergenic
1031802446 7:126265113-126265135 AGTCCTTCTCAGCTGCAGCCTGG + Intergenic
1032420335 7:131774249-131774271 GTTTAAACTCACCTGTAGCCTGG + Intergenic
1032678471 7:134156173-134156195 GTTCTGTCTCACCTGTAGTCAGG - Intronic
1033528717 7:142242836-142242858 ATTCATTCCCACCTGCAGAAGGG + Intergenic
1033644763 7:143292688-143292710 ATCAATTCTCACCTGTCGACAGG - Exonic
1036481281 8:9141788-9141810 GTTAATCCTGACCTGTAGCCAGG - Intronic
1040502207 8:48014932-48014954 CTTCAGTCTCCCCAGTAGCCAGG - Intronic
1045751908 8:105495414-105495436 ATTCATTCTTTCCTGTATCAAGG - Intronic
1047230761 8:122996110-122996132 ATTCATTTGCTCCTTTAGCCTGG - Intergenic
1050576950 9:7006816-7006838 ATTCATTCTCACTTAGACCCAGG - Intronic
1052078232 9:24171764-24171786 CTTCATTGTCACCTGTTGCTTGG + Intergenic
1058442779 9:105025091-105025113 ATTGATTCTCCCCTGTAGCATGG - Intergenic
1059026610 9:110640810-110640832 ATTGATTGTCACCTGTGGCTGGG + Intergenic
1059977419 9:119732178-119732200 ATGGATTCTCACCTAGAGCCTGG + Intergenic
1188254264 X:27940910-27940932 TTACATTCTCACCTGGAGCTTGG + Intergenic
1189596310 X:42569886-42569908 ATTCAATCTCACCAGTAATCAGG - Intergenic
1195925658 X:110022112-110022134 AGTGATTCTAATCTGTAGCCAGG + Intronic
1199087524 X:143645346-143645368 ATCCATTTTCCCCTGTAGGCTGG - Intergenic