ID: 1112702041

View in Genome Browser
Species Human (GRCh38)
Location 13:102021072-102021094
Sequence GTGTATGTGCCTTAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112702041 Original CRISPR GTGTATGTGCCTTAAGTGGA GGG Intronic
904526889 1:31140527-31140549 GTGTGTGTGCCAAAAGGGGAAGG - Intergenic
918102908 1:181391969-181391991 GTGTGTGTGTGTTTAGTGGAAGG + Intergenic
919659774 1:200233032-200233054 GTGTCTGACCCTTAAGTGCAGGG - Intergenic
920260695 1:204685833-204685855 GTGTGTGTGCGTTAGGTAGAGGG - Intergenic
923315550 1:232776657-232776679 GTGTATTTCCTTTAAGTGAATGG + Intergenic
924073871 1:240312375-240312397 CTGTATGAGCCTGAAATGGAAGG - Intronic
1065333863 10:24634517-24634539 GTATATGTGGCTTAATTGGCTGG - Intronic
1070552435 10:77501405-77501427 GTGCATGTGCCTGAGGAGGATGG + Intronic
1073235128 10:102007906-102007928 GTGTGTGTGCCTTCATTGGGAGG + Intronic
1074539883 10:114355647-114355669 GAGTATGTGCCTTTATTAGATGG - Intronic
1077324892 11:1959427-1959449 GTGTGTGTGCCTGAGGTGGTGGG - Intronic
1080297034 11:30742043-30742065 TAGAATGTGGCTTAAGTGGAAGG + Intergenic
1083415470 11:62522718-62522740 GTGTCTCTGCCAAAAGTGGAAGG - Exonic
1083415574 11:62523324-62523346 GTGTCTTTGCCCAAAGTGGAAGG - Exonic
1083415811 11:62525064-62525086 GTGTCTCTGCCAAAAGTGGAAGG - Exonic
1083416134 11:62526978-62527000 GTGTCTGTGCCTGAGGTAGAAGG - Exonic
1090821739 11:130348837-130348859 GAGGATTTGCCTTAAGTGAAAGG - Intergenic
1202807874 11_KI270721v1_random:14606-14628 GTGTGTGTGCCTGAGGTGGTGGG - Intergenic
1093198118 12:16153123-16153145 GTTTATATGCCTTAGGTTGAGGG - Intergenic
1095578506 12:43767164-43767186 GTCTATTTGTCTTAATTGGAAGG + Intronic
1096649121 12:53053299-53053321 GTGGAGGGGCCTTCAGTGGATGG - Intronic
1096719661 12:53511747-53511769 TAGTATGTGCTTTATGTGGATGG - Intronic
1096753027 12:53774919-53774941 ATGTAAGTGACTTGAGTGGAGGG + Intergenic
1097191887 12:57223361-57223383 GTGTATGTGCCTGGATTGGCTGG - Intronic
1101384953 12:104248707-104248729 CAGTATCTGCCGTAAGTGGAAGG - Intronic
1112702041 13:102021072-102021094 GTGTATGTGCCTTAAGTGGAGGG + Intronic
1115038476 14:28889995-28890017 ATGTATGAGCTTTAAGTAGATGG - Intergenic
1118448044 14:65869571-65869593 GTGGATGTGGCTTAAGTGTGGGG + Intergenic
1119587962 14:75855795-75855817 GTGTATGTGTTTTAAGTAGATGG - Intronic
1127358378 15:58223674-58223696 GTGTATGTGTATTGAGGGGAGGG - Intronic
1127827489 15:62717842-62717864 GTTTTTGTCCATTAAGTGGATGG + Intronic
1129410458 15:75347946-75347968 GAAGGTGTGCCTTAAGTGGAAGG - Intronic
1139232153 16:65294205-65294227 TTGTCTGTGCCTTCAGTAGAGGG + Intergenic
1139308831 16:66011223-66011245 GTGCAAGTGGTTTAAGTGGAAGG - Intergenic
1139556891 16:67718189-67718211 GTGTGTGGCCCTTAAGTTGAAGG - Intronic
1141340858 16:83202510-83202532 TTGCATGTGCCTTCATTGGAAGG - Intronic
1142056749 16:88002425-88002447 GGGTCTGTGCCCTAGGTGGATGG + Intronic
1142714050 17:1738344-1738366 GTGTTTGTGCCTTCAGCTGAGGG + Exonic
1143986923 17:10922761-10922783 GTGCAGATGCCGTAAGTGGATGG - Intergenic
1144925392 17:18802671-18802693 CTGTTTGTACCTTAAGGGGAGGG + Intronic
1152514269 17:80813432-80813454 GTGTGTGTGCTTTATGTGTAAGG + Intronic
1164862795 19:31575953-31575975 GTGAATATGCCTTAATTAGAGGG - Intergenic
1167401947 19:49278759-49278781 GTGTATCTGCCATAAGGGTAGGG - Intergenic
925617387 2:5756582-5756604 GTTTATGTGCTTTCAGTGAAAGG + Intergenic
925996880 2:9300680-9300702 GACTGTGTGCCTTAAGAGGATGG - Intronic
926772155 2:16387918-16387940 ATCTAAGTGCCTTTAGTGGAAGG - Intergenic
928383359 2:30840473-30840495 GTCTGTGTGCCTGAAGTGTAAGG + Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
932305875 2:70704065-70704087 GTGGAGGTGACTTCAGTGGACGG - Intronic
937306927 2:120877398-120877420 GTGCATGCATCTTAAGTGGAGGG + Intronic
937465891 2:122132729-122132751 TTGAGTGTGCTTTAAGTGGAAGG + Intergenic
939586990 2:144017912-144017934 AAGTACCTGCCTTAAGTGGATGG - Intronic
939879748 2:147616781-147616803 GTGGAAGTGACTTCAGTGGATGG - Intergenic
942382543 2:175406930-175406952 GTGTGTGTGTGTTAAGGGGAAGG - Intergenic
942536479 2:176969862-176969884 TTGGATGTGCCTTAAGGGCAAGG - Intergenic
944382774 2:199130819-199130841 GTGTCTGTCTCTTGAGTGGATGG + Intergenic
945983024 2:216329760-216329782 CTGTATGTCCCTTAAGTATAAGG + Intronic
1169047556 20:2546610-2546632 GTGTATGTCTCTTGAGTTGAAGG + Intronic
1169921670 20:10740827-10740849 GTTTATGTGCTTTAAGGAGAGGG - Intergenic
1170614623 20:17938770-17938792 GTGTATGTGCGAGGAGTGGATGG + Intergenic
1172103084 20:32497417-32497439 GTTTCAGTGCCTTAAGTAGAAGG + Intronic
1173284855 20:41661071-41661093 ATGTAGGTGCCTTAATTGTAAGG + Intergenic
1173545396 20:43893919-43893941 GTGAATTTGCTTTACGTGGAAGG - Intergenic
1175928764 20:62483736-62483758 ATGTATGTGCATTAAGTGTGGGG - Intergenic
1177862553 21:26471286-26471308 GTGTATGCTCCTCAAGTGGGAGG - Intronic
1181041092 22:20192975-20192997 GTGTATATGCCTTGAGGGGGAGG - Intergenic
1181600906 22:23951445-23951467 GTGTATGTCCATTCAGTAGAAGG + Intergenic
1181994821 22:26869033-26869055 TTGTATCTGACTTAAGTGTAAGG - Intergenic
949931806 3:9084343-9084365 GAGTATGTGACTTAACTGGATGG + Intronic
952060796 3:29507243-29507265 GTGTATGTACCTAAAGAGTATGG - Intronic
952179815 3:30906013-30906035 GTGTTTGTCCCTTAAATTGAAGG - Intergenic
953926991 3:46987669-46987691 CTGTGGGTGCCTTAAGTGAAGGG + Intronic
954533141 3:51338042-51338064 GGGTATATGAATTAAGTGGAAGG - Intronic
956323427 3:68024792-68024814 GTGTGTGTGCATTAAGGAGATGG - Intronic
956878668 3:73488935-73488957 GTGTGTGTGCCTGTAGTGGGTGG + Intronic
957134413 3:76267035-76267057 GTGCATGTTCCTTAGGTTGATGG + Intronic
958893034 3:99801442-99801464 GTGTATGTGTCTTGAGTGGCAGG + Intergenic
960507459 3:118511110-118511132 GATTATATGCCTTAGGTGGATGG + Intergenic
961846584 3:129769693-129769715 GTGTAAGAACATTAAGTGGATGG - Intronic
963108787 3:141668069-141668091 GTGTGTGTGTCTTCAGTGAAAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
971730128 4:30368520-30368542 GTGAGTGTGCCATTAGTGGATGG + Intergenic
974884699 4:67804244-67804266 GTGTGTGTGTGTTTAGTGGATGG + Intergenic
980511747 4:133799838-133799860 GTGTATCTGCCTTGAAAGGATGG + Intergenic
982323686 4:154107603-154107625 GTGTATATGAGTTAAGTGGATGG + Intergenic
982503805 4:156193617-156193639 GTGTCTGTGCCTTAACCGGGAGG - Intergenic
982549544 4:156780604-156780626 TTGTATGTGCCTTGAGTGGAAGG + Intronic
989359019 5:40578281-40578303 GTGTATGTGCATGCATTGGACGG + Intergenic
990908179 5:60825647-60825669 GTGTATGGGCCTGAGGTTGAGGG + Intronic
992603658 5:78433356-78433378 GGTTTTGTGCCTTAAGTGGGAGG + Intronic
993426577 5:87772340-87772362 TTAGATGTGGCTTAAGTGGAAGG + Intergenic
993483559 5:88453813-88453835 GTCTAAGTGTCTTAAGTAGAAGG - Intergenic
996007799 5:118443913-118443935 CTTTATGGGCCTTAAGTGGATGG + Intergenic
996222228 5:120948411-120948433 GAGAATGTGCCTTAAATGCATGG - Intergenic
997641455 5:135451402-135451424 GTGTCTGTGCCTTAGGGGAAAGG - Intronic
998388622 5:141772838-141772860 GTGAATGTGGATGAAGTGGATGG + Intergenic
998896507 5:146805765-146805787 GGGGATGTGGCTTAAGGGGAAGG + Intronic
1000799235 5:165703870-165703892 GTGTATGTGTGTTGGGTGGAAGG + Intergenic
1003211113 6:4067605-4067627 GTGTTTGGGTTTTAAGTGGATGG - Intronic
1006415473 6:33901190-33901212 GTGGATGTGCCATGAGTGTAAGG - Intergenic
1011757687 6:90520680-90520702 GTATATGAGCCTTAAGGGTAAGG - Intronic
1011800944 6:91015618-91015640 GTGTATGTGTCTTTAGGGAAGGG + Intergenic
1012118087 6:95330297-95330319 GTGTATGTGCCCAAGGTGGTTGG + Intergenic
1014551862 6:122798353-122798375 GTTTATATGCCTTAGGTGGCAGG + Intronic
1015668292 6:135657193-135657215 TTGAATGTGCCTTAAGTTTAAGG + Intergenic
1016718109 6:147257896-147257918 GTGTAAGTGACTTCAGGGGAAGG - Intronic
1016891181 6:149008380-149008402 GTGTATGTGCTTGAGGTGGGTGG + Intronic
1018872045 6:167790720-167790742 GTGTGTGTGTCTTAAGGGAAGGG - Intronic
1020674047 7:11158354-11158376 GAGTTTGTGCCTTAATGGGAAGG + Intronic
1021910181 7:25378010-25378032 GTGTTTTTCCCTTAAATGGATGG + Intergenic
1022624695 7:32023038-32023060 GTGTATGTGCATTAAATCGTTGG - Intronic
1030204190 7:106936845-106936867 TTTTATGTGCCTTAAATTGAAGG + Intergenic
1032268765 7:130385605-130385627 GTGCATGTGCCTGAAGGGCAGGG + Intronic
1034601159 7:152257734-152257756 GTGTATATACGTTAAGTGTAGGG + Intronic
1038610115 8:29053059-29053081 CAGCGTGTGCCTTAAGTGGAAGG - Exonic
1040306076 8:46212514-46212536 GTGCCTGTGCCTCTAGTGGAAGG + Intergenic
1040326154 8:46342624-46342646 GTGCCTGTGTCTTATGTGGAAGG + Intergenic
1040602585 8:48898897-48898919 CTGTGTGTGCCTTATGTGCATGG - Intergenic
1040875354 8:52146072-52146094 GTGTATGTGTCTTATGTGGTCGG + Intronic
1056295463 9:85188847-85188869 GTGGGTGTGGCTTCAGTGGAAGG + Intergenic
1056601991 9:88053717-88053739 GTCTATGTGCCCTGGGTGGAGGG + Intergenic
1061475906 9:130866117-130866139 GTGAATGTCCCTTAACTGAAAGG - Intronic
1186871657 X:13780035-13780057 ATGTGTGTCCCCTAAGTGGAAGG + Intronic
1188377799 X:29454329-29454351 GTGTATGTACCTCAGTTGGAAGG + Intronic
1191258590 X:58290628-58290650 GTGTGTGTGTCTTAAATGGGGGG + Intergenic
1191939366 X:66461725-66461747 CTGGATGTGGCTGAAGTGGAGGG + Intergenic
1192366703 X:70479811-70479833 GTGTATGTGCCCTAGGAAGAGGG + Intronic
1193374017 X:80736060-80736082 CTGTTTGTGCCTTTAGTTGATGG + Exonic
1193435382 X:81469011-81469033 GTGAATGAGCATTAAGTGGAAGG - Intergenic
1198239596 X:134770812-134770834 GTGTATGTGCTATAAGTGTGAGG - Intronic
1199843513 X:151674243-151674265 GGGTGTGTGCCTTATGTGGAAGG - Intronic
1201310492 Y:12594735-12594757 GTGTAAGTTCCTTATTTGGAGGG + Intergenic