ID: 1112703333

View in Genome Browser
Species Human (GRCh38)
Location 13:102037280-102037302
Sequence GGTCTCAGTGGACTAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 3, 2: 9, 3: 55, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112703333 Original CRISPR GGTCTCAGTGGACTAAAATC AGG Intronic
900934409 1:5756124-5756146 AGTCTCACTGGGCTAAAATCAGG + Intergenic
902226637 1:15000320-15000342 GGTTTCACTGGGCCAAAATCAGG - Intronic
902583501 1:17424080-17424102 AGTCTCAGTGGACTGAGATGCGG + Intronic
903469395 1:23575268-23575290 GATCTCACTGGGCTAAAATCAGG - Intergenic
904078591 1:27858040-27858062 GGGCAGAGTGGACTAAAGTCTGG + Intergenic
905411074 1:37768460-37768482 GGTTGCAGTGGACTGAAATCAGG - Intergenic
905471792 1:38197810-38197832 GCTTTCAGTGGACTAAATGCCGG - Intergenic
905556013 1:38884709-38884731 GGTTTCAGTGAACCAAGATCCGG + Intergenic
906456354 1:46000541-46000563 GGTCTCAGTGGTAAAAAACCAGG - Intronic
908289902 1:62654984-62655006 AGTATCACTGGACTAAAATAAGG - Intronic
908996567 1:70163013-70163035 GGTCTCATTGGGCTAAAATCAGG + Intronic
910573924 1:88737268-88737290 GGCCTCAGTGGAATAGACTCAGG - Intronic
910594269 1:88962060-88962082 GATCTCAGGGGAATAAAAACAGG + Exonic
911892500 1:103389980-103390002 CATCTCAGTGGAGTAAAACCAGG - Intergenic
913182712 1:116337642-116337664 AGTCTCACTGGACTAAGTTCAGG + Intergenic
915505225 1:156351220-156351242 GGTATCACTGGGCTAAAATCAGG + Intronic
917770821 1:178276105-178276127 GGCCTCAGTGGATTTAAATATGG - Intronic
918687075 1:187430216-187430238 GGTCTCCTAGGGCTAAAATCAGG - Intergenic
919119460 1:193321087-193321109 GGTCTTACTGGGCTAGAATCAGG - Intergenic
920505717 1:206513857-206513879 GGTTTAAGTGGAATAAAGTCGGG + Intronic
920794398 1:209124577-209124599 GTTCTCACAGGGCTAAAATCAGG - Intergenic
920969278 1:210729026-210729048 GCTCACAGTGGACTATAATGTGG + Intronic
922195913 1:223360421-223360443 GGTCTCAGTGGCCCCAAATGAGG + Intronic
924738605 1:246781185-246781207 GGTCTCATTGGGCTAAAAGCAGG - Intergenic
1063131351 10:3180447-3180469 GATCTCACTGTGCTAAAATCAGG + Intergenic
1063723805 10:8614860-8614882 GCTCTCAGTGCACAGAAATCTGG - Intergenic
1064317173 10:14269386-14269408 GGTCTCAAGGGGCTAAAATCAGG + Intronic
1065404513 10:25349089-25349111 AGTCTCACTGAACTAAAGTCAGG + Intronic
1065859632 10:29861157-29861179 GGTTGCACTGGACTAAAATCAGG - Intergenic
1066433511 10:35375200-35375222 GGACTCAGTGGGCAGAAATCAGG + Intronic
1066560914 10:36668887-36668909 GGTTTCAGTGGGCCAAGATCAGG - Intergenic
1068680214 10:59811100-59811122 GGACTCACTAGGCTAAAATCAGG - Intronic
1070272020 10:74965655-74965677 GGTCTCACCAGATTAAAATCGGG + Intronic
1070635325 10:78121485-78121507 GGTATCAAGTGACTAAAATCAGG + Intergenic
1071096041 10:81976033-81976055 TGTCTAATTGGGCTAAAATCAGG - Intronic
1071526039 10:86359034-86359056 GGTCTCACTGGGCTAAAATCTGG - Intronic
1071665851 10:87557593-87557615 GGTCTAAATGGTTTAAAATCTGG - Intergenic
1071737803 10:88321106-88321128 GACCACAGTGGAATAAAATCAGG + Intronic
1072489151 10:95886752-95886774 GGTCTCAGTGGGCTAAAATCAGG - Intronic
1072979397 10:100087149-100087171 GGTCTCATTGTACTAATATCAGG - Intergenic
1073055358 10:100696879-100696901 AGTCTCATTGGGCTAAAGTCAGG - Intergenic
1073814706 10:107193791-107193813 GGTCTCACTGGACGAAAATCAGG - Intergenic
1074667816 10:115751303-115751325 GTTCTCAGGGAGCTAAAATCAGG - Intronic
1076426431 10:130370553-130370575 GGTCCCAGTGGCCAGAAATCTGG - Intergenic
1076616693 10:131759760-131759782 GACCTCACTGGACTAAAATCAGG + Intergenic
1083182005 11:60992905-60992927 CCTCTCAGTGGTCTAAAGTCTGG + Intronic
1083284067 11:61646578-61646600 GGTTGCAGTGGACTGAGATCAGG - Intergenic
1085789373 11:79483984-79484006 GGTCTCATTGGGCTAAAACAAGG + Intergenic
1087984208 11:104657478-104657500 GGTCTCATTAGACTCATATCAGG + Intergenic
1090671799 11:128952749-128952771 AGTCTCACTGGGCTAAAATCAGG + Intergenic
1091091169 11:132772619-132772641 GGGCTCAGTGGGCTAACTTCAGG + Intronic
1091149435 11:133313760-133313782 GGTCTCCATGGGCTAAAATCAGG - Intronic
1092353820 12:7778063-7778085 GTTCACAGGTGACTAAAATCGGG - Intergenic
1092928915 12:13296923-13296945 GGTCTCACCAGGCTAAAATCAGG + Intergenic
1093585688 12:20832988-20833010 AGTGTCAGTGAACTAAACTCAGG + Intronic
1094574623 12:31673950-31673972 GGTCTCACTGGGCTAAAATCAGG + Intronic
1097913609 12:64996539-64996561 GGTCTCAAAGGACTAATATGAGG + Intergenic
1099135848 12:78900315-78900337 GCTCTCAGGGAACTTAAATCTGG + Intronic
1099995137 12:89770155-89770177 GGTCCCTGTGGACTAAACTATGG + Intergenic
1101744266 12:107526510-107526532 GGTCTCAGAGGACACAAATATGG - Intronic
1101918275 12:108912646-108912668 GGTCTCAATGGGCAAAAAGCAGG + Exonic
1103015710 12:117492966-117492988 GGTCTCATGGAGCTAAAATCAGG - Intronic
1103788540 12:123452101-123452123 GGTCACAGTGAGCTAAGATCCGG + Intergenic
1104043242 12:125144154-125144176 GGTCTCACTGGGCTGAAATCAGG + Intergenic
1104166820 12:126239766-126239788 GGTTCCACTGGACTAAACTCAGG + Intergenic
1104874341 12:132023193-132023215 GGTTGCAGTGAACTAAGATCAGG - Intronic
1109023864 13:57135267-57135289 GATTTCAGAGGACTAAAAACTGG - Intergenic
1110200447 13:72843812-72843834 GGGCTAAGTGGAGTGAAATCTGG - Intronic
1110523121 13:76504419-76504441 GGTCTCACAAGGCTAAAATCAGG + Intergenic
1110861363 13:80347902-80347924 GGTCTCTGTGGTGTAAAATGAGG - Intergenic
1112703333 13:102037280-102037302 GGTCTCAGTGGACTAAAATCAGG + Intronic
1114662480 14:24356281-24356303 GGCCTCACTGGGCTAAAATCAGG + Intergenic
1117414382 14:55480331-55480353 GGTTGCAGTGAACTGAAATCTGG - Intergenic
1118255802 14:64204848-64204870 GATCTCACTGGGCTAAGATCAGG + Intronic
1121112904 14:91324489-91324511 GGTGTCAGTGCACTATAATCTGG + Intronic
1124860246 15:33432539-33432561 GGTCTCTGTGGTCAAAAATTCGG - Intronic
1125385035 15:39128284-39128306 GCTCTTAGTGGACTAAAATAGGG - Intergenic
1125612623 15:40982207-40982229 GGTTTCAGTGCACTGAGATCAGG - Intronic
1125954185 15:43777738-43777760 GGTCTCAGTGCACCAGGATCTGG - Intronic
1126449465 15:48789843-48789865 GATCTCACTAGGCTAAAATCAGG - Intronic
1126836118 15:52667150-52667172 GTTATCAATGGAATAAAATCTGG + Intronic
1127190929 15:56529830-56529852 AATCTCACTGGACTGAAATCTGG + Intergenic
1128138633 15:65283099-65283121 TCTCTAAGTGGACTAGAATCTGG - Intronic
1128826268 15:70720178-70720200 GGCCTCAGTAAACTACAATCAGG - Intronic
1132848439 16:2012067-2012089 GGTCACACTGAGCTAAAATCAGG + Intronic
1133790670 16:9007209-9007231 GGTCTCACTGGGCTGAAATCAGG - Intergenic
1137416814 16:48290089-48290111 GGTCTCAGTAAATTAAAATAGGG - Intronic
1137715567 16:50596195-50596217 GGTCTGGGTGGACCAAAGTCTGG + Intronic
1138615293 16:58160614-58160636 GGTCCCAGTGGACTGAAAGGTGG - Intronic
1138985438 16:62322502-62322524 GGTCTCACTGGGCTAAAATCGGG + Intergenic
1139017184 16:62704292-62704314 AATCTCTCTGGACTAAAATCAGG - Intergenic
1141604407 16:85144745-85144767 GCTCTCACTGGGCCAAAATCCGG + Intergenic
1141804187 16:86331907-86331929 GGCCTCACTGGGCTAAAATTAGG + Intergenic
1145087744 17:19956980-19957002 ATTCTCAGTGAACTAAAATGAGG - Intronic
1147035712 17:37678833-37678855 AGTATCACTGGACCAAAATCAGG - Intergenic
1148546461 17:48522814-48522836 GGTCTTAGTAGACTAAACTTAGG + Intergenic
1149792364 17:59490587-59490609 GCTCTCACTTGACAAAAATCCGG - Intergenic
1152395376 17:80029829-80029851 GGTCTCACAGGGCTAAAACCAGG + Intronic
1153994701 18:10430372-10430394 GGTTACAGTGAACTGAAATCAGG + Intergenic
1154248871 18:12726070-12726092 GGTCTGACGAGACTAAAATCAGG + Intergenic
1155549508 18:26949990-26950012 GGCCTCACCAGACTAAAATCAGG - Intronic
1156111812 18:33736513-33736535 GGTGTCAGTCAACTAAAAACTGG - Intronic
1156314172 18:35951850-35951872 GGGCTCATTGGGCCAAAATCAGG + Intergenic
1156509719 18:37626256-37626278 GGTCTCGCTGGGCTACAATCGGG + Intergenic
1156758595 18:40558919-40558941 GGTCTCACTGGTTTGAAATCGGG - Intergenic
1159046843 18:63376753-63376775 GGTCTCACTGGGCTAAAATCAGG - Intergenic
1159433760 18:68388559-68388581 GCTCTAACTGGACTTAAATCAGG + Intergenic
1159659025 18:71070543-71070565 GCTCTCAGCGGTCTAAAATCAGG - Intergenic
1163563628 19:18036300-18036322 GGACCCAGTGGGCTCAAATCTGG - Intergenic
1166599635 19:44082596-44082618 CATCTCACTGGACAAAAATCAGG + Intronic
1166794516 19:45418455-45418477 GGTTGCAGTGGGCTAAGATCTGG + Intronic
1168014401 19:53560616-53560638 GGTCTCACCGGGCTAAAACCAGG + Intronic
1168056034 19:53865960-53865982 GGTCTCAGTGCACCCAGATCAGG - Intergenic
925692840 2:6542394-6542416 GCCCTAAGCGGACTAAAATCTGG + Intergenic
926178712 2:10620607-10620629 GAACTCAGTGGAATAAAATGTGG + Intronic
926427416 2:12751756-12751778 GGTCTCACTGGGTTAAAATCAGG + Intergenic
926962737 2:18376734-18376756 GGCCTCACTGCACTAAAATGAGG + Intergenic
928773172 2:34726403-34726425 AGGCTCAGGGGACTAAAATAGGG - Intergenic
929493082 2:42414897-42414919 GGTATCAGTGAAGTAAGATCAGG - Intronic
931049959 2:58401650-58401672 GGTCTCACATGGCTAAAATCAGG + Intergenic
932376036 2:71236845-71236867 GGTTTCTGTGAGCTAAAATCAGG + Intergenic
936506041 2:113108081-113108103 AGTCTTACTGGGCTAAAATCAGG + Intronic
936669184 2:114636582-114636604 GGGCTCTGTGGACTATACTCTGG + Intronic
938301876 2:130220889-130220911 GGTGTCATTGGACTAAACTGTGG - Intergenic
938454823 2:131453562-131453584 GGTGTCATTGGACTAAACTGTGG + Intergenic
940556006 2:155229484-155229506 GGGCTCAGAGGACTAAAGTTTGG + Intergenic
942492995 2:176508684-176508706 GGTCTCACTGGTCTAAAATCAGG + Intergenic
945538285 2:211048583-211048605 GAGCTCAGTGGACGTAAATCAGG + Intergenic
947538089 2:230953548-230953570 AGTCTCACTGGGCTAAAATCAGG - Intronic
948419967 2:237852009-237852031 GATCTCACTAGACTAAAATCAGG - Intergenic
1170413886 20:16120107-16120129 GGTCTCACTGGGCTAAAGTCAGG + Intergenic
1173453610 20:43187133-43187155 GGTCTCAGTGTCCAAAAGTCGGG - Intronic
1175003862 20:55661459-55661481 GGTCTCACAGAAATAAAATCTGG - Intergenic
1176046488 20:63095443-63095465 GGTCTCCCTGGGCTAACATCAGG - Intergenic
1177770766 21:25513016-25513038 GGTCTCATTGAGCTAAAATCAGG - Intergenic
1178665576 21:34543479-34543501 AGTCTCAATGGGCTAAAATCAGG - Intronic
1182877363 22:33703766-33703788 AGTCTCACTGGACTAAAGTCAGG - Intronic
1182877726 22:33706874-33706896 AGTCTCACTGGACTAAAGTCAGG - Intronic
953064551 3:39456880-39456902 GGCTTCACTGGGCTAAAATCAGG - Intergenic
954485512 3:50847306-50847328 GGTCACAATGGAATAAAAACAGG - Intronic
955463224 3:59208490-59208512 GGTCTCACTGGACTAAAATCGGG - Intergenic
956182247 3:66528307-66528329 GGTCTCACTGGGCTACAATAAGG - Intergenic
956411645 3:68985871-68985893 GGTCTCACTGGACTAACACCAGG + Intronic
956482258 3:69685052-69685074 GGTCTCCGTGGATGAAAGTCAGG + Intergenic
957578624 3:82041454-82041476 GGTTTAAGTGAAGTAAAATCAGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959872594 3:111345548-111345570 GGTTTCACTGGGCTAAAATCAGG - Intronic
962030260 3:131592109-131592131 GTACAGAGTGGACTAAAATCTGG + Intronic
962696246 3:137950305-137950327 GGTCTCACCAGTCTAAAATCAGG + Intergenic
963282549 3:143399463-143399485 GGAATCAGTGGTTTAAAATCAGG + Intronic
964723752 3:159793514-159793536 GGTCTTACAGGGCTAAAATCAGG + Intronic
965276519 3:166690248-166690270 GGTCTCACTGGGCTACAACCAGG + Intergenic
965659064 3:171021655-171021677 AGTATCACTGGACTAAAATCAGG + Intronic
967628642 3:191716134-191716156 GGTCTCACTGAGCTAAAATCAGG + Intergenic
968142390 3:196269092-196269114 GGTCTCAGAGGGCTAAAATCAGG - Intronic
968751809 4:2393941-2393963 GGTCTCTCTGGACTAGAAGCAGG + Intronic
970024648 4:11610573-11610595 GGTGTCAGTGCACTGAAAGCAGG + Intergenic
973880073 4:55262316-55262338 GGGACCAGTTGACTAAAATCAGG - Intergenic
974584833 4:63859258-63859280 AGGCTCACTGGACTAAAATGTGG + Intergenic
975427876 4:74251884-74251906 GGTCTCTGTAGACTAGAATAAGG + Intronic
976001126 4:80374227-80374249 GGACTCATTGGACTAGATTCTGG - Intronic
976179463 4:82385298-82385320 GGTCTCACTGGACTAAATTAAGG - Intergenic
977494734 4:97760820-97760842 GGTCTTAATGGGCTAAAATATGG + Intronic
979344580 4:119571583-119571605 ATTCCCAGTGGGCTAAAATCAGG - Intronic
980005824 4:127541390-127541412 GGACTCTGTGTAGTAAAATCTGG - Intergenic
982637583 4:157916326-157916348 GGTCCTAATGGGCTAAAATCAGG + Intergenic
983862318 4:172722951-172722973 GGTCTCACTGGGCTAAAATGAGG + Intronic
983934653 4:173492980-173493002 GGCCTTAGTGGACTAAGAACAGG + Intergenic
984874071 4:184352025-184352047 GGTCTCACTGGACTAAAATCAGG + Intergenic
985973981 5:3400749-3400771 GGTCTCAGTGAGCTACCATCAGG - Intergenic
986180967 5:5392635-5392657 AGTCTCAGTAGGCTACAATCAGG - Intergenic
986516584 5:8571004-8571026 GGTCTAAGTGGCTCAAAATCTGG + Intergenic
987360316 5:17100417-17100439 GATCTTACTGGGCTAAAATCAGG + Intronic
987442191 5:17969348-17969370 GGTCCCAGTGGATTCAAATAAGG - Intergenic
987833988 5:23137119-23137141 GATCTCACTGGGCTAAAATCAGG - Intergenic
988515958 5:31905029-31905051 GGTTGCAGTGGGCTAAGATCGGG - Intronic
990023488 5:51157956-51157978 GGTCACAGTGAATTAAAATTCGG - Intergenic
990747317 5:58972456-58972478 GATCTCAGGGGACTGAAATGGGG + Exonic
992647898 5:78829143-78829165 GGTCTCACTGGACTAAATCCAGG - Intronic
993170446 5:84412504-84412526 AGTATCACTGGGCTAAAATCAGG - Intergenic
993979102 5:94521856-94521878 GGTCCAAGTGGCATAAAATCAGG + Intronic
994048288 5:95333354-95333376 GGTTTCATTGAACTAAAATCAGG - Intergenic
994824816 5:104699217-104699239 GGTCTCTGTAGAGGAAAATCTGG - Intergenic
995412381 5:111873377-111873399 GGTCTCTTTGAGCTAAAATCAGG + Intronic
997927932 5:138047863-138047885 GGTCTCACTGGGCTAAAGTCAGG - Intronic
999113238 5:149140300-149140322 TGGCTCAGTGCACTAAAGTCTGG - Intergenic
1002444907 5:179284447-179284469 GGTCTCAGTGAACTGAGCTCAGG - Intronic
1003133154 6:3412951-3412973 GGTCTCACTGGTCTAAAGTCGGG - Intronic
1005917944 6:30370578-30370600 GGTCTCTCTGGCCTAAAATAAGG + Intergenic
1008067366 6:47063485-47063507 GGTCTCATTAGGCTAAATTCAGG - Intergenic
1010012816 6:71068964-71068986 GGTCCCAGTGCACCAAAGTCAGG - Intergenic
1012244784 6:96914204-96914226 GGTCTCACTGGGCTAATATCAGG - Intergenic
1012435554 6:99211625-99211647 GGTCTCACTGGGCTAAAACCAGG + Intergenic
1014940672 6:127434513-127434535 GGTTGCAGTGAACTGAAATCTGG + Intergenic
1016355069 6:143209662-143209684 GGTCTCACTGGGCTAAAACAAGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018772407 6:166982906-166982928 GGTCTCACTGAGCTAAAACCAGG + Intergenic
1019009635 6:168833659-168833681 GATGTCAGTGGACTGAACTCTGG - Intergenic
1020888631 7:13851078-13851100 GATCTCTGTGGAATAAAATCAGG - Intergenic
1023118768 7:36888202-36888224 AGTCTCTGTGGGCTAGAATCTGG - Intronic
1023310434 7:38881154-38881176 GATCTCACTGGGCTAAAATCAGG + Intronic
1026500167 7:70937156-70937178 GGTTGCAGTGGACCAAGATCAGG - Intergenic
1027149586 7:75723439-75723461 GGTCTCACTGGGCTAAAATTGGG + Intronic
1028123659 7:87086196-87086218 GGTCTCGTTAGGCTAAAATCGGG - Intergenic
1028398686 7:90401426-90401448 GGTCTCACTGTGCTAAAATCAGG - Intronic
1032755391 7:134885470-134885492 GGTATCACTGGAAAAAAATCTGG + Intronic
1033414219 7:141148042-141148064 GGTCCTAGGGGGCTAAAATCAGG + Intronic
1033537647 7:142327104-142327126 GGGCTCTGTGCACTAAAATACGG + Intergenic
1035138406 7:156730871-156730893 GGTTGCAGTGGACTGAGATCAGG + Intronic
1036014896 8:4772037-4772059 GGTCTCACTGGGCTAAAACCAGG + Intronic
1037218832 8:16491026-16491048 GGTCACACTGGGCTAAAATCAGG - Intronic
1040597874 8:48858009-48858031 GGTCTCACTGGGCTAAAATTGGG - Intergenic
1040805685 8:51393858-51393880 GGTCTTGCTGGGCTAAAATCAGG - Intronic
1041028630 8:53712642-53712664 GGTCTCTCTGGACTGAAAACAGG + Intergenic
1042508425 8:69586055-69586077 GGTCCTACTGGAGTAAAATCAGG - Intronic
1042875085 8:73434328-73434350 TGTCTCACTGGGCTAAAATCAGG - Intronic
1043514920 8:80986900-80986922 GGTCTCACTGGGCTAAAATCAGG - Intronic
1045166065 8:99606369-99606391 TGTCTCACTGGACTGGAATCTGG + Intronic
1045245106 8:100435820-100435842 GGTCTCACTGGGCTAAAATTAGG + Intergenic
1045860929 8:106814454-106814476 GATTTCACTGGGCTAAAATCAGG + Intergenic
1047751995 8:127888806-127888828 GGTCTCACTGAGCTAAAATCAGG - Intergenic
1058666189 9:107318215-107318237 GGGCTCACTGTACTAAAATCAGG + Intronic
1059619484 9:115987656-115987678 GGTCTCACTGGACTAAATTAAGG - Intergenic
1062196464 9:135276818-135276840 GGTCTCACTGGCCTAAATCCAGG + Intergenic
1186156452 X:6731417-6731439 AATCTCAGTGGACTAAAAACTGG + Intergenic
1192495437 X:71613899-71613921 GGTGTCACTGGGCTAAAATCAGG + Intergenic
1194420857 X:93671194-93671216 GGTCTCAGTTGAATCAAATGTGG + Exonic
1195031028 X:100928031-100928053 GATCTCTGTGGACAAAAATGAGG + Exonic
1196841489 X:119863522-119863544 GGCTTCAGTGAACTATAATCTGG + Intergenic
1197339693 X:125251468-125251490 GTTCTCACTGGGCTAAATTCAGG + Intergenic
1198070005 X:133138933-133138955 GGTATCAGTGGAGTAGAATGTGG - Intergenic
1199694762 X:150336044-150336066 GGTCACACTGGGCTAAAATCAGG + Intergenic
1199903694 X:152203590-152203612 GGTCTCACTGTGCTAAAATCAGG + Intronic
1201236691 Y:11918859-11918881 AGTCTGAGTGGACTAGAATACGG - Intergenic