ID: 1112708131

View in Genome Browser
Species Human (GRCh38)
Location 13:102095625-102095647
Sequence AAGGGGGAGGAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3687
Summary {0: 1, 1: 6, 2: 35, 3: 465, 4: 3180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112708131_1112708140 3 Left 1112708131 13:102095625-102095647 CCCTCCTCATTCTCCTCCCCCTT 0: 1
1: 6
2: 35
3: 465
4: 3180
Right 1112708140 13:102095651-102095673 CTACTCAATGTGAAGACACCAGG 0: 1
1: 0
2: 6
3: 26
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112708131 Original CRISPR AAGGGGGAGGAGAATGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr