ID: 1112711408

View in Genome Browser
Species Human (GRCh38)
Location 13:102133185-102133207
Sequence GTGCAGACCTAGAATTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112711408 Original CRISPR GTGCAGACCTAGAATTATAA TGG (reversed) Intronic
905943793 1:41885048-41885070 GTGCAGAGCTTGTATAATAAGGG - Intronic
913239300 1:116815407-116815429 GTGCAGAAATAGAACTAGAAGGG - Intergenic
917380423 1:174400277-174400299 CTGCTGACATAGTATTATAATGG - Intronic
922150523 1:222999243-222999265 GTGAATAACTAGAATTAGAAGGG + Intronic
1064959772 10:20950925-20950947 TTGCATCCTTAGAATTATAAAGG - Intronic
1070482434 10:76895976-76895998 GGGCAAAACTAGAATTATTAAGG + Intronic
1072563454 10:96598001-96598023 TTGCAGACCTATAATTATAGTGG + Intronic
1073938911 10:108670743-108670765 GTAGAGCCCTAGAATTAAAATGG - Intergenic
1074688094 10:115978227-115978249 GAACAGCCTTAGAATTATAAAGG + Intergenic
1080279540 11:30540743-30540765 GTGCAGAACTAGGATTAAGAAGG - Intronic
1080857529 11:36125145-36125167 GTGCAGACCCACAATCATAAAGG - Intronic
1084841517 11:71854971-71854993 ATGCAAACCTAAAATTATTAAGG + Intergenic
1086236713 11:84640250-84640272 GTGCAGACCTCGTCTTGTAATGG - Intronic
1087686418 11:101270836-101270858 GTGCACACATAGAAGTCTAAAGG - Intergenic
1098840877 12:75476391-75476413 ATGCATACCTAGAGTAATAAAGG + Intergenic
1099309261 12:80997169-80997191 GTGCTTACCTAAGATTATAATGG + Intronic
1099566977 12:84263768-84263790 GAGCAATCTTAGAATTATAAGGG + Intergenic
1103866990 12:124060616-124060638 GGGAAGACCTAGAAGAATAATGG + Intronic
1107831683 13:44379987-44380009 GTGCAGACATAGCCTTAAAAGGG + Intronic
1109876565 13:68411918-68411940 GTAAAGACCTAGTATTATAGTGG + Intergenic
1111417313 13:87966290-87966312 AAGAAAACCTAGAATTATAATGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1117561671 14:56946657-56946679 GAGCAGACCAGTAATTATAAGGG + Intergenic
1117767520 14:59098344-59098366 TTGAAGACCTTGAATTATAGAGG - Intergenic
1118116225 14:62780327-62780349 GATCAGCCCTAGATTTATAAAGG - Intronic
1133488904 16:6248222-6248244 TTGGAGGCCTAGAATTAGAATGG + Intronic
1143449643 17:7028226-7028248 TTCCAGACCTAGAATTACAGGGG - Exonic
1146479852 17:33196508-33196530 GAGCATACATAGAATTACAATGG + Intronic
1153500867 18:5748526-5748548 GTGTAGACCTAAACTTTTAAAGG + Intergenic
1156070201 18:33197481-33197503 TTTCACACCTGGAATTATAATGG - Intronic
1156848209 18:41694397-41694419 GTATAGACATACAATTATAAAGG + Intergenic
1157835218 18:50895359-50895381 ATCTAGACCTAGAATTTTAATGG - Intronic
925526192 2:4805024-4805046 ATGTAGGCCTAGGATTATAAAGG - Intergenic
929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG + Intronic
930609791 2:53528981-53529003 GTGCAGACCCAAAATTCTAGGGG + Intergenic
935821097 2:106893634-106893656 TTGGAGACCTAGAAATATACTGG - Intergenic
935901407 2:107797587-107797609 GTGAAGAGCTAGAATTAATATGG - Intergenic
937397938 2:121555086-121555108 GTGCAGACCCAGAGTCCTAATGG + Intronic
940517933 2:154704655-154704677 ATGTAGACCTAGAATTTTATTGG - Intronic
942139534 2:172964227-172964249 GGGCAGTCCTGGAAATATAATGG + Intronic
947115121 2:226761688-226761710 GAGCAGAACTAGAATTTTATAGG + Intronic
948843389 2:240671124-240671146 GTGCAGACTTAAAGCTATAACGG + Intergenic
1173332725 20:42088456-42088478 CTCCAGAACTAGAATTAGAAGGG + Intronic
1177369815 21:20187714-20187736 ATGAAAACCTAGAATTATTATGG - Intergenic
1179149560 21:38798337-38798359 GTGGAGACAGAGAATTATTAAGG + Intergenic
949106763 3:208797-208819 CTGGAGACCTTGAATTATACAGG + Intronic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
951035614 3:17928702-17928724 GTGGAAACCCAGATTTATAAGGG - Intronic
953650900 3:44802719-44802741 GTGCATACCTAGTTTTCTAATGG + Intronic
954737234 3:52716331-52716353 GTCCAGACTAAAAATTATAAAGG + Intronic
955632880 3:60993622-60993644 GTGCAGTTCTAGAGTTTTAATGG - Intronic
956485646 3:69719359-69719381 GAACAGACTTAGAAGTATAAAGG + Intergenic
958112421 3:89165769-89165791 GTTCAGGCCTTGAATGATAAAGG + Intronic
958626787 3:96636127-96636149 GAGCAGACCCAGATTTAAAAAGG + Intergenic
959650597 3:108746784-108746806 GGGGAGACATAGAATTAGAATGG + Intronic
962679412 3:137783207-137783229 GTTGGAACCTAGAATTATAAGGG - Intergenic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
964879130 3:161404233-161404255 GTGCAGAGCTTCACTTATAAGGG - Intergenic
965117593 3:164512225-164512247 GGGAAGACATGGAATTATAATGG - Intergenic
969782613 4:9421010-9421032 ATGCAAACCTAAAATTATTAAGG + Intergenic
975211004 4:71699899-71699921 CTTCAGACCTAGACTTATCATGG + Intergenic
978178879 4:105769305-105769327 CTGCAGACCTAGCCTTATGATGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
990330282 5:54719146-54719168 ATACATACATAGAATTATAAAGG - Intergenic
990340796 5:54821134-54821156 GTGCTGAGCTAGAAATAAAAGGG + Intergenic
993254206 5:85566644-85566666 ATTCAGACCTAAAAATATAAGGG + Intergenic
1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG + Intergenic
1008697899 6:54062889-54062911 GTGCAGGGCTAGAATTAATATGG + Intronic
1010118966 6:72351245-72351267 GTGCTGACCTAAAAATTTAATGG - Intronic
1011997474 6:93610739-93610761 GTAAAGACATAAAATTATAAGGG - Intergenic
1015258406 6:131206608-131206630 ATACAGAACTAGAATTGTAATGG + Intronic
1023374559 7:39543051-39543073 ATACAGACCTAGAATTACATAGG + Intergenic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1037180027 8:15994351-15994373 GTGGAGCCATAAAATTATAATGG - Intergenic
1037597043 8:20362971-20362993 GTGCTGAACTAGGCTTATAATGG - Intergenic
1044119062 8:88371646-88371668 ATCCAGACCTAGATGTATAATGG - Intergenic
1044778485 8:95719373-95719395 GTTCAGCCCTTGAAATATAAGGG - Intergenic
1046494960 8:115001181-115001203 GTGAAGGCCCAGAATTATTACGG + Intergenic
1046807706 8:118498625-118498647 GTTCACACCTAGAATTTTCATGG + Intronic
1048278677 8:133088423-133088445 TAGCAGGGCTAGAATTATAAAGG - Intronic
1056084951 9:83138477-83138499 TTGCAAACAAAGAATTATAATGG + Intergenic
1061591012 9:131597564-131597586 GTGCAGTGCTAGAAGTACAAAGG - Intronic
1186432965 X:9520524-9520546 GAGGAGACCTAGAGTTATCAGGG + Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1195508936 X:105691938-105691960 GAGCAGATCTAGAATTAAACAGG + Intronic
1199039021 X:143088513-143088535 GTGGATATCTAGAATTACAATGG + Intergenic
1200750806 Y:6942552-6942574 GAGGAGACCTAGAGTTATCAGGG + Intronic