ID: 1112714035

View in Genome Browser
Species Human (GRCh38)
Location 13:102163457-102163479
Sequence TCGAGGAAGTTTAGAGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112714031_1112714035 20 Left 1112714031 13:102163414-102163436 CCAGGGTTATAAAGGTGAGGAAA 0: 1
1: 0
2: 1
3: 29
4: 406
Right 1112714035 13:102163457-102163479 TCGAGGAAGTTTAGAGCAAGTGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112714035 Original CRISPR TCGAGGAAGTTTAGAGCAAG TGG Intronic
901022848 1:6263782-6263804 TCTAGGCAGTTTCTAGCAAGAGG + Intergenic
902924128 1:19684511-19684533 CGGAGGAAGTTGAGAGCCAGAGG - Intronic
905698068 1:39990581-39990603 GTGAGGAAGTTGAGACCAAGAGG - Intergenic
907466799 1:54643311-54643333 TTGGGGAAGTTTATAGGAAGAGG + Intronic
915765075 1:158354429-158354451 AGGAGGAAGTTTGGAGCATGCGG - Exonic
918837934 1:189492186-189492208 TCTATGGAGTTTAGAGCAACAGG + Intergenic
1065563885 10:26989858-26989880 TCCAGGAAGTTCAGAGGAGGCGG + Intergenic
1066391400 10:34979881-34979903 TCAGGGAAGTTTAGAGGAGGAGG - Intergenic
1074264459 10:111887759-111887781 TCTAGGTAGTCTAGAGCAATGGG + Intergenic
1075985777 10:126783973-126783995 TCATGGGTGTTTAGAGCAAGGGG - Intergenic
1093641402 12:21530614-21530636 TCGCGAAACTTTAGAGCATGAGG - Intronic
1094324289 12:29220006-29220028 TCAAGGAATTTTAGAGCTAGTGG + Intronic
1094657132 12:32431252-32431274 TCCCGGAAGTTTACAGAAAGGGG - Intronic
1106601525 13:31191642-31191664 GCTTGGAAGTGTAGAGCAAGGGG + Intergenic
1107097669 13:36553695-36553717 TCCAGGAAGCTTTGAGCAAGAGG + Intergenic
1112714035 13:102163457-102163479 TCGAGGAAGTTTAGAGCAAGTGG + Intronic
1113328358 13:109305447-109305469 GCCAGGAAGTTTAGGACAAGAGG + Intergenic
1114556239 14:23563960-23563982 TCGAGCCAGTTTAGAGCAGCTGG - Intronic
1115650710 14:35401210-35401232 TCCAGGAAGTTTAAATCAACGGG + Intergenic
1122084275 14:99289047-99289069 TTGAGGCAGTTAAGAGCCAGTGG - Intergenic
1124830921 15:33148523-33148545 TAGAGGAGGTTTACAGGAAGTGG + Intronic
1129426344 15:75466085-75466107 TAGAGGAAGTCTAGTGTAAGAGG + Exonic
1131053978 15:89364913-89364935 TGGAAGAAGTTCAGGGCAAGCGG + Intergenic
1133367621 16:5223396-5223418 TCAAGGAAGCTTATAGCAAGAGG + Intergenic
1138512585 16:57517127-57517149 TCGAGAGAGTTTAAAGCAGGAGG - Intronic
1138867080 16:60834864-60834886 TCTAGGAAGGTCAGGGCAAGGGG + Intergenic
1142715986 17:1747205-1747227 TGGAGGAGGGTGAGAGCAAGGGG + Intronic
1152300257 17:79491258-79491280 TAGAGGAAGTTTAGGACTAGGGG + Intronic
1157729706 18:49992855-49992877 TCCAGAAAGTTCAGAGCTAGTGG - Intronic
1158776467 18:60587983-60588005 GAAAGGAAGTTTAGAGGAAGTGG - Intergenic
1166805818 19:45486236-45486258 TCTATGAAGTTTAGAGCCGGGGG - Intronic
926372725 2:12196825-12196847 TCGGGGAATTTTAGGGGAAGGGG - Intergenic
927317813 2:21706043-21706065 TCAAGGAAATTTATAGCAAGAGG - Intergenic
927722060 2:25389486-25389508 TGGAGAAAGTTTGGAGCAATGGG + Intronic
928161269 2:28927660-28927682 CCGAGCAAGTAGAGAGCAAGAGG + Exonic
929125239 2:38517644-38517666 TCTAGGATGCTTGGAGCAAGTGG - Intergenic
930507213 2:52298510-52298532 TCTAGGAATTTTATAGCTAGAGG + Intergenic
930784120 2:55253895-55253917 TTGATGAAATGTAGAGCAAGTGG - Intronic
934118062 2:88814251-88814273 TGGAGGATGTTTAGTGCAGGAGG - Intergenic
935861777 2:107339017-107339039 TTGAGTAACTTTAAAGCAAGAGG + Intergenic
939425689 2:142033368-142033390 TCGAGAAAATTAAGAGCAACAGG - Intronic
940025064 2:149197705-149197727 TCTAGGAAGTACAGAGCAAAGGG + Intronic
940442765 2:153737826-153737848 TCTAGGAACTTTACAGCAATTGG - Intergenic
940622060 2:156124805-156124827 TCTAGGAGGTTTAGATAAAGTGG - Intergenic
942101664 2:172589917-172589939 TTAAGGAACTTAAGAGCAAGAGG + Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942546901 2:177074799-177074821 TGGAGGAAATTTCAAGCAAGTGG - Intergenic
944545666 2:200796760-200796782 TTGAGGAAGTCTAGGGCAACAGG + Intergenic
947884064 2:233549805-233549827 TAGAGGCAGTTTAGTGGAAGAGG + Intronic
948496266 2:238351732-238351754 TCGAGGATGTTTGGGGCAATGGG + Intronic
1169003500 20:2186496-2186518 TTGGGGAAGTTGAGAGGAAGTGG - Intergenic
1179209984 21:39316117-39316139 TTGAGAAAGTTAAGACCAAGAGG + Intronic
1183820647 22:40343477-40343499 CCGAGGAAGTGTGGAGGAAGAGG + Intergenic
1184826476 22:46955956-46955978 TAGAGGAAGTTTAAAGCCATTGG + Intronic
950106450 3:10391979-10392001 TGGAGGAGGTTGTGAGCAAGAGG - Intronic
957682678 3:83457918-83457940 TAGAGGAAGTTGAGAAAAAGTGG - Intergenic
964708045 3:159642002-159642024 TGGAGGAGATTTAGAGCCAGAGG + Intronic
970268750 4:14319629-14319651 TGGATGAAGTTTAGAGAAAAAGG + Intergenic
971225871 4:24751108-24751130 TACAAGAAGTTTAGAGGAAGGGG - Intergenic
976510828 4:85907994-85908016 TGGAGGAAGTTCAGAGCAGGTGG + Intronic
979109930 4:116740142-116740164 TCTAGGGAGTTTGGAGCAGGAGG + Intergenic
983417392 4:167476067-167476089 TCAGGGAAGTTTATAGTAAGAGG - Intergenic
988008732 5:25454693-25454715 TGGAGGCAGTATAGAGCTAGTGG + Intergenic
988462573 5:31453691-31453713 TGGAGCAGGTTTAGAGGAAGTGG - Intronic
988609361 5:32710775-32710797 ACGAGAAAGGTGAGAGCAAGCGG + Intronic
989404173 5:41042063-41042085 AAGAGGAAATTGAGAGCAAGGGG + Intronic
989429736 5:41338854-41338876 TAGAGGAAGTATAGACAAAGTGG - Intronic
997533155 5:134595118-134595140 TGGAGGAGGTTTATAGAAAGGGG - Intergenic
1000050868 5:157561954-157561976 TCGAGGAGGTTAAGAACCAGAGG + Intronic
1010375698 6:75167343-75167365 TCTAGGAAATTTAGAGGAAAAGG - Intronic
1015286371 6:131490298-131490320 TCGGGGATGTTTATAGCAAATGG + Intergenic
1024779158 7:52826682-52826704 TGGAAGAAGTTTTGAGGAAGTGG + Intergenic
1027462002 7:78466048-78466070 AGGAGGATGTTAAGAGCAAGTGG - Intronic
1032575811 7:133053050-133053072 TGGAGGAAGTTTAGAGTGATAGG - Intronic
1032800616 7:135314719-135314741 TTGAGGAAGTTTACAACAAAAGG - Intergenic
1033245547 7:139714074-139714096 ACGAGGGAGTGGAGAGCAAGTGG + Intronic
1039518667 8:38153253-38153275 TGGAGGAGGTTTTGAGGAAGGGG - Intergenic
1042790819 8:72603772-72603794 ACGAGCAAGTTTGGAGTAAGAGG - Intronic
1044605488 8:94043788-94043810 TCGAGGAAGGGAGGAGCAAGAGG + Intergenic
1049024914 8:139981725-139981747 TCGAGGATGCTTTGAGAAAGTGG - Intronic
1052960390 9:34291156-34291178 TTAAGGAAGTTTAGATAAAGGGG + Intronic
1053728865 9:41031985-41032007 AAGAGGAAGTCTAGAGGAAGTGG + Intergenic
1054699647 9:68400098-68400120 AAGAGGAAGTCTAGAGGAAGTGG - Intronic
1058871871 9:109209173-109209195 TAGAGGAAGTATAGAGCAACTGG + Intronic
1058986480 9:110212695-110212717 TCTAGAAAGTAGAGAGCAAGGGG - Intergenic
1188120699 X:26303830-26303852 TTGAGGAATTTAGGAGCAAGAGG + Intergenic
1199698550 X:150360883-150360905 CTGAGGAAGATGAGAGCAAGTGG + Intergenic
1200813514 Y:7508276-7508298 ACGAGGAAATTGAGACCAAGAGG + Intergenic