ID: 1112714059

View in Genome Browser
Species Human (GRCh38)
Location 13:102163634-102163656
Sequence CAGTATTCGAGGAGGTGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112714059 Original CRISPR CAGTATTCGAGGAGGTGATC TGG Intronic
901914899 1:12491064-12491086 CAGTATTGGAAGAGGTAGTCTGG + Intronic
903312847 1:22473452-22473474 TAGTATTAAAGGAGGTGATATGG + Intronic
906330142 1:44877531-44877553 CAGTGGTCCAGGAGGTGACCAGG - Intronic
913119823 1:115729473-115729495 CATTATTCCAGGAGGAGATCTGG + Intronic
915910895 1:159914647-159914669 CAGTTTTAAATGAGGTGATCAGG + Intergenic
917117442 1:171616599-171616621 CAGGTTTGAAGGAGGTGATCAGG + Intergenic
924572411 1:245249043-245249065 CAGTGTTAGAGGAGGTAATGTGG + Intronic
1063171247 10:3511829-3511851 CAGTATGCAAGGAGATGACCCGG - Intergenic
1065566783 10:27019408-27019430 AACTATTCGAGTAGGTGCTCAGG + Intronic
1085056738 11:73408996-73409018 CAGGATTAGAAGGGGTGATCTGG - Intronic
1085304695 11:75478473-75478495 CAGTTTTACAGAAGGTGATCTGG - Intronic
1085404189 11:76252143-76252165 CAGTATTTCAGGAGGACATCGGG + Intergenic
1087704540 11:101475120-101475142 CAGTGTTAGAGGTGATGATCTGG + Intronic
1091291010 11:134439913-134439935 CAGGATCCCAGGTGGTGATCAGG + Intergenic
1093762006 12:22921244-22921266 AAGTATTGGAGGATGTGAGCAGG - Intergenic
1098462045 12:70742701-70742723 CAGAATTCGAGGTGGGGACCAGG + Intronic
1101207647 12:102504738-102504760 CAGCATTTGAGGTGATGATCAGG + Intergenic
1102413366 12:112739494-112739516 CAGAATTTGAGAAGGTCATCTGG + Intronic
1106898516 13:34330919-34330941 CAGTATTGAAGGAGCTCATCAGG - Intergenic
1112114407 13:96336515-96336537 CCATATTAGAGGAGGTGATTAGG + Intronic
1112634263 13:101197675-101197697 CAGTTTGCTATGAGGTGATCTGG + Intronic
1112714059 13:102163634-102163656 CAGTATTCGAGGAGGTGATCTGG + Intronic
1118249613 14:64146981-64147003 CAGTATACGAGCAGGTGAAAAGG - Intronic
1121418696 14:93797339-93797361 CAGTATTCTAAGAGCTGAGCAGG + Intergenic
1122012486 14:98761571-98761593 CAGAATTCCCTGAGGTGATCAGG - Intergenic
1123218161 14:106831469-106831491 CAGGACGCGAGGAGGTGCTCAGG - Intergenic
1125897433 15:43314456-43314478 CAGTAGTCCAGGTGGAGATCTGG + Intergenic
1128766718 15:70255595-70255617 CAGTGTTGGAGGTGGGGATCTGG - Intergenic
1135591396 16:23707404-23707426 AAGTTTTCGAGGAGGTGGTCAGG - Intronic
1136302192 16:29343183-29343205 CAGAGTTCGAGGAAGTGCTCTGG - Intergenic
1139532245 16:67548097-67548119 CAGTATTTGGGGTGGTGAGCTGG + Intergenic
1143197340 17:5086205-5086227 CAGGATTCCAGTAGGAGATCAGG + Intronic
1146925751 17:36743689-36743711 CAGTATTAGAGGGGGTGAGGGGG - Intergenic
1153022350 18:641354-641376 CAGAATTAGACGAGGCGATCAGG + Exonic
1153279457 18:3400660-3400682 TAGGATTAGAGGAGGTCATCAGG + Intergenic
1154344401 18:13530374-13530396 CAGTCTTAGAGGAGATGATGGGG + Intronic
1167408498 19:49330557-49330579 CAGTAAAGGAGGAGGGGATCAGG + Intergenic
1168411629 19:56143840-56143862 CAGCATCGGAGGGGGTGATCTGG + Intronic
926451170 2:13005964-13005986 CAGTATGCGGGAAAGTGATCGGG - Intergenic
929083430 2:38144798-38144820 CAGGTTTGGAGGAGGTGATGAGG - Intergenic
935150046 2:100425888-100425910 CAGGCTTCAAGGAGGAGATCAGG + Intergenic
936281813 2:111147940-111147962 CATTGTTCTAGGAGGTGCTCTGG - Intronic
942201577 2:173576726-173576748 CTCTATTCGAGGAGATGTTCAGG + Intergenic
945250545 2:207762519-207762541 GAGTATTCGAGGAGATAATACGG - Intergenic
946280634 2:218663369-218663391 GAGTCTCTGAGGAGGTGATCAGG + Exonic
946796966 2:223365086-223365108 CAATTTTAGAGGAGATGATCAGG + Intergenic
1170094549 20:12631586-12631608 TAGTATTCAAGGATGGGATCAGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1174681439 20:52412555-52412577 CAGGATTAGATGAGGTTATCAGG + Intergenic
1176067403 20:63205410-63205432 CAGTATTCTAGGATGGGAGCAGG - Intronic
1183814042 22:40284029-40284051 CTGTTTTCTTGGAGGTGATCAGG + Intronic
949196559 3:1316543-1316565 CAGTATTGAAGGTGGGGATCTGG - Intronic
951319291 3:21225771-21225793 CAGTATTCGAGGGGGAAAACAGG - Intergenic
953410135 3:42686196-42686218 CAGTGTTCGAGGCGGTGATGCGG + Exonic
955801979 3:62696093-62696115 CAGTAGTCAAAGAGGTGACCTGG + Intronic
956246664 3:67191135-67191157 CAGTTTTCTGGGAGGTGGTCAGG + Intergenic
962110359 3:132439403-132439425 CAGTATTCCTGGAGGTTATGAGG - Intronic
975441396 4:74414705-74414727 CAGTATTGGAGGAGCTGATCAGG - Intergenic
979020100 4:115486490-115486512 CAGGATTAGAGGAGAGGATCAGG + Intergenic
979324734 4:119365504-119365526 CAGTGTTGGAGGAGCAGATCTGG - Intergenic
979516117 4:121612312-121612334 AAGTATTCGGGGATGTGATTAGG - Intergenic
981087476 4:140698849-140698871 CAGAATTAGAGGAGGTTATCTGG - Intronic
985808221 5:2064005-2064027 CAGGATTGGAGGAGGTCACCAGG - Intergenic
985864886 5:2506921-2506943 CAGTGTGCCAGGGGGTGATCTGG + Intergenic
986771126 5:10974654-10974676 CAGTAATTGGGGAGGAGATCTGG + Intronic
989312617 5:40038164-40038186 CAGAATTCCATGGGGTGATCAGG + Intergenic
990992819 5:61701832-61701854 CAGCATCCGAGGAGCTGCTCTGG + Intronic
991449021 5:66732087-66732109 CAGTAGTCTAGGAAGTGAACTGG - Intronic
995128056 5:108599759-108599781 CAGAAATGGAGGAGGTGAACTGG + Intergenic
1009445099 6:63733193-63733215 CAGTCTTTGAGAATGTGATCTGG - Intronic
1011113519 6:83864862-83864884 ATGTATTGGAGGAGGTGAGCAGG + Intronic
1012971304 6:105734535-105734557 CAGTAGTCGGGGAGGTTATGGGG - Intergenic
1013283664 6:108662324-108662346 CACTATTTCAGTAGGTGATCGGG - Intronic
1015672671 6:135708260-135708282 CAGAATTCTAGCAAGTGATCTGG - Intergenic
1022088231 7:27089237-27089259 CAGTGTTTGAAGAGGTGAGCTGG - Intergenic
1026350043 7:69507866-69507888 CAATTTTAGAGGAAGTGATCAGG + Intergenic
1034432614 7:151048698-151048720 CAGGATTGGAGGAGGTGATCTGG - Intronic
1034885512 7:154795431-154795453 CAGTATTCCAGAATGGGATCTGG + Intronic
1038693580 8:29784873-29784895 CAGAGTTGAAGGAGGTGATCAGG - Intergenic
1039082483 8:33746555-33746577 CAGTGCTCTAGGAGGTGATATGG + Intergenic
1046276742 8:111971348-111971370 CAGTGTTGGAGGAGGGGACCTGG - Intergenic
1052526351 9:29624661-29624683 CAGTTCTTGATGAGGTGATCTGG + Intergenic
1052603927 9:30673260-30673282 CAGTATTCTAGTAGGAGACCGGG + Intergenic
1055605398 9:77965041-77965063 CAGTAATGGAGGCTGTGATCTGG - Intronic
1059749326 9:117233054-117233076 AAGTCTTCTAGGAGGTGAGCTGG + Intronic
1061674869 9:132209938-132209960 CAGGAGCCGAGGAAGTGATCGGG + Intronic
1061797928 9:133099085-133099107 CAGGATTCTGGGAGGTGACCTGG - Intronic
1061822337 9:133235538-133235560 CAGTTTCCCAGGAGGTGACCTGG - Intergenic
1190894724 X:54605789-54605811 AAGGATTTGGGGAGGTGATCAGG - Intergenic
1198709358 X:139484492-139484514 CAGTATGCTGGGAGGTGATAAGG - Intergenic