ID: 1112714971

View in Genome Browser
Species Human (GRCh38)
Location 13:102173811-102173833
Sequence AGCTGAGGGTAGGGGTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1250
Summary {0: 1, 1: 0, 2: 6, 3: 85, 4: 1158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112714971 Original CRISPR AGCTGAGGGTAGGGGTAGGG GGG Intronic
900183453 1:1322536-1322558 AGGGGAGGGGAGGGGTAGGGTGG + Intronic
900227248 1:1539217-1539239 AGCTGAGGGATGGGCTGGGGGGG - Intronic
900323433 1:2095934-2095956 AGGTGAGGGGAGGGGAAAGGAGG - Intronic
900497152 1:2980921-2980943 AGCTGGGGGTGGGGGCGGGGGGG + Intergenic
900549898 1:3249220-3249242 AGTAGGGGGCAGGGGTAGGGAGG + Intronic
900563922 1:3323196-3323218 ACCTGAGGGTACGGGTGGGGTGG - Intronic
901035637 1:6334438-6334460 AGCCCAGGGGAGGGGCAGGGGGG + Intronic
901142346 1:7043238-7043260 AGCTCAGGGTGAGCGTAGGGTGG - Intronic
901411626 1:9088286-9088308 AGCTGGGTGTAGGGTTCGGGTGG - Intronic
901512446 1:9724255-9724277 AGCTGAGGGGAGGGGAGAGGAGG - Exonic
901618129 1:10558364-10558386 CGCAGTGGGTAGGGGTGGGGTGG - Intronic
901648474 1:10729103-10729125 AGGAGAGGGAAGGGGTGGGGAGG + Intronic
901906752 1:12419116-12419138 GGATGAGGGTGGGGGTAGGGAGG - Intronic
902042786 1:13504750-13504772 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
902572583 1:17356269-17356291 TGCTGAGGGTGGGAGTAGTGTGG - Intronic
902825894 1:18974061-18974083 AGCTGGGAGCAGGGGTAGGGTGG - Intergenic
903255156 1:22092591-22092613 AGCTGGGGGTAGGGTGGGGGTGG + Exonic
903292512 1:22323654-22323676 AGGTTAGGGTGGGGGCAGGGAGG + Intergenic
903303353 1:22394366-22394388 AGGGGAGGGAAGGGGAAGGGAGG + Intergenic
903355020 1:22741171-22741193 ATCAGAGGATAGGGGTCGGGGGG - Intronic
903392118 1:22971945-22971967 AGCTCAGCCTAGGGGGAGGGAGG + Intergenic
903477641 1:23630807-23630829 AGCTGGTGGGAGGTGTAGGGGGG + Intronic
903659215 1:24966584-24966606 TGCTGAGGGTGGGGGTGGTGGGG + Intergenic
903787549 1:25871531-25871553 AGTGGAGGGGAGGGGAAGGGAGG - Intergenic
903805683 1:26004184-26004206 AGCGGAGGGGAGGGGAAGGAAGG - Intergenic
904053517 1:27655521-27655543 GGGTGAGGGTAGCGGCAGGGAGG + Intergenic
904180613 1:28664111-28664133 GGGTGAGGGTAGGGGTGCGGTGG + Intergenic
904674150 1:32187933-32187955 AGCTGGGGACAGGGATAGGGAGG - Exonic
904927110 1:34057907-34057929 AGCTGGGGGTTGGGGTGAGGAGG + Intronic
905199090 1:36304288-36304310 GGGTGGGGGCAGGGGTAGGGCGG + Exonic
905284569 1:36870918-36870940 TGGTGGGGGTTGGGGTAGGGGGG + Intronic
905324813 1:37144047-37144069 GGGTGAGGGTTGGGGGAGGGGGG - Intergenic
905369305 1:37474702-37474724 AGCCGAGGGGAGGGGACGGGAGG + Intronic
905563928 1:38948309-38948331 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
905881971 1:41469929-41469951 AGATGAGGGCAGGGGAGGGGCGG - Intergenic
906414364 1:45608657-45608679 AGATGAGGGGTGGGGTAGGTAGG + Intronic
906534618 1:46544560-46544582 AGCTGTGGGGCGGGGGAGGGGGG + Intergenic
906545402 1:46616487-46616509 GGCAGAGGGGAGGGGTTGGGGGG - Intronic
906708122 1:47909761-47909783 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
906808218 1:48800931-48800953 AGGTTGGGGTAGGGTTAGGGGGG + Intronic
907425438 1:54376277-54376299 ACTTGAGGAAAGGGGTAGGGTGG - Intronic
907425629 1:54377543-54377565 TGCTGGGGGGATGGGTAGGGAGG - Intronic
907540760 1:55214522-55214544 AGCTGTGGGTTGGGGTGAGGAGG - Intronic
907588250 1:55640937-55640959 AGCTGAGGTTGGGGGCAGGATGG + Intergenic
907796606 1:57724337-57724359 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
907864909 1:58390227-58390249 GGCTGGGGGTAGGGGTGGGGTGG - Intronic
909175041 1:72346732-72346754 GGCTGTGGGTAGGGGAAGGTAGG + Intergenic
909198534 1:72658529-72658551 AGCGGAGGGGAGGGGAGGGGAGG - Intergenic
909286527 1:73826925-73826947 AAGGGAGGGTAGGGGAAGGGAGG + Intergenic
909583387 1:77262922-77262944 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
909800924 1:79806406-79806428 AGCTGAGGGCTGGAGTGGGGTGG - Intergenic
909885373 1:80935717-80935739 GGCTGAGGGTAGGAGTGGGATGG - Intergenic
910047372 1:82933861-82933883 AGATTAGGGTGGGGGTGGGGAGG - Intergenic
910154501 1:84199298-84199320 ACTTGAGGGTGGAGGTAGGGAGG - Intronic
910337909 1:86155327-86155349 AGCTGAGGGCAGGCGGAGGCAGG - Intronic
910395822 1:86792878-86792900 AGCTGAGGGAAGCTTTAGGGTGG + Intergenic
910952581 1:92666594-92666616 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
911102511 1:94105642-94105664 AGCTGAGGGTGGGGGTGGGAGGG + Intronic
911767955 1:101701722-101701744 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
912503370 1:110137326-110137348 AGCTGGGAGTAGGGGTGGGGGGG - Intergenic
912551546 1:110488401-110488423 AGCGTGGGGTAGGGGTGGGGCGG + Intergenic
912762762 1:112383734-112383756 GGCTGAGGGGAGGGGGAGGTGGG - Intergenic
912775825 1:112505958-112505980 AGCTGAAGGGAGGGGTGAGGGGG - Intronic
912799225 1:112710914-112710936 ACCTGAGGGTAGGGGTGGAAGGG - Intronic
912844441 1:113066782-113066804 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
913170453 1:116227436-116227458 GGGTGTGGGTAGGGGTGGGGTGG - Intergenic
913214687 1:116610565-116610587 GGATGGGGGTAGGGGTAGGGTGG - Intronic
913236999 1:116793879-116793901 ACCTGAGGTTAGGGGGAAGGAGG - Intergenic
913569999 1:120110372-120110394 TGCTGAGGGGAGAGGGAGGGAGG - Intergenic
914290807 1:146271338-146271360 TGCTGAGGGGAGAGGGAGGGAGG - Intergenic
914551851 1:148722121-148722143 TGCTGAGGGGAGAGGGAGGGAGG - Intergenic
914719879 1:150281286-150281308 AGGTGTGGGTAGGGGTGGGTAGG - Intergenic
914750863 1:150534138-150534160 AGCACAGGTTAGGGGTGGGGTGG - Intergenic
914944150 1:152048606-152048628 AGCTGGTGGCAGGGGGAGGGAGG + Intergenic
915438766 1:155930267-155930289 AGATGAAGGGAAGGGTAGGGAGG - Intronic
915597004 1:156901681-156901703 AGCTGAGGGTCAGGGAAGAGGGG + Intronic
915841313 1:159215739-159215761 TGCTGGAGGTAGTGGTAGGGTGG - Intergenic
916015197 1:160743346-160743368 AGCTGAGGATCAGGGGAGGGAGG + Intronic
916088733 1:161290415-161290437 AACTGAGGGTGGGGGTCAGGAGG + Intergenic
916811191 1:168307112-168307134 AGCAGAGTGTAGGGGGAGTGGGG + Intronic
917442678 1:175080881-175080903 AGGTGTGGGTAGGGGTTGGATGG + Intronic
917641762 1:176989927-176989949 AGATGGGGGCAGGGGGAGGGCGG - Intronic
917669197 1:177256578-177256600 GGCGGAGAGTGGGGGTAGGGTGG + Intronic
918071891 1:181139402-181139424 AACTAAGGGTAGGGGCAAGGTGG + Intergenic
918072464 1:181142889-181142911 AGGTGAGGGTTGGGGGTGGGAGG + Intergenic
919579364 1:199352191-199352213 AGCAGAGGGTAGAGGTTGTGGGG + Intergenic
919896184 1:202011108-202011130 ACCTGTGGGTAGGGGGAGAGAGG - Exonic
920037034 1:203072888-203072910 AGCTCTGGGTCGGGGGAGGGGGG - Intronic
920043389 1:203118083-203118105 AACTGAGGCTGGGGGGAGGGAGG - Intronic
920330446 1:205203572-205203594 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
920430734 1:205917257-205917279 AGCTGAGGGAAGGGGCTGTGAGG - Intronic
920682147 1:208081445-208081467 GGCTGAGGGTAGGAGGAGTGTGG + Intronic
920795885 1:209136026-209136048 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
921262203 1:213394427-213394449 AGGTGGGGTGAGGGGTAGGGGGG - Intergenic
921372607 1:214440025-214440047 AGCTAAGGGGAGGGGAGGGGAGG + Intronic
922220772 1:223556928-223556950 AACTGAGGCGAGGGGTAGGAGGG + Intronic
922247298 1:223813120-223813142 AGATGACTGTAGGGGGAGGGTGG - Intronic
922960837 1:229644495-229644517 AGCAGAGGTGAGGGGAAGGGAGG + Intronic
923569553 1:235101577-235101599 AGAGGAGGGGAGGGGAAGGGAGG + Intergenic
923818444 1:237406204-237406226 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
924424009 1:243933982-243934004 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
924424091 1:243934180-243934202 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
924583890 1:245345226-245345248 AGCTGCGGGTAGGGCAGGGGTGG - Intronic
924699429 1:246436462-246436484 AGCTGAGTGAAGGGGTAGATGGG - Intronic
1062844105 10:690948-690970 GGTGGGGGGTAGGGGTAGGGGGG - Intergenic
1062963566 10:1591347-1591369 AGCTGTGGGTGGGGGTACGAAGG - Intronic
1063216821 10:3932521-3932543 GGCAGAGGGGAGGGGTGGGGGGG + Intergenic
1063223433 10:3992506-3992528 AGATGAGGGAAGGGGAGGGGAGG - Intergenic
1063348756 10:5335769-5335791 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1063421343 10:5915051-5915073 ATAGGAGGGTAGGGTTAGGGAGG - Intronic
1063463365 10:6228350-6228372 AGATGGGCGTAGGAGTAGGGAGG + Intronic
1064678060 10:17781500-17781522 GGCTGAGGTTGGGGGTGGGGGGG + Intronic
1065220505 10:23491521-23491543 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1065366096 10:24938462-24938484 AGCTGGGGATAGGGGCTGGGGGG - Intronic
1065368002 10:24953203-24953225 AGGTGAGGGGAGGTGGAGGGAGG - Intergenic
1065609720 10:27460939-27460961 AGATGAGGGGTGGGGTGGGGAGG + Intergenic
1066045904 10:31595365-31595387 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1066367884 10:34794104-34794126 AGCGGGGGGTGGGGGTTGGGGGG + Intronic
1066632676 10:37472010-37472032 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1067108064 10:43378523-43378545 GGCTGTGGGGAGAGGTAGGGGGG + Intergenic
1067713642 10:48670809-48670831 AGCGGGGGGTGGGGGTGGGGTGG + Intergenic
1067772220 10:49135055-49135077 AGGGGAGGGGAGGGGTGGGGTGG - Intergenic
1068058504 10:52038283-52038305 AACTGAGGGAAGGGGTTCGGGGG + Intronic
1068086321 10:52377409-52377431 AGATCAGAGTAGGGGTGGGGAGG + Intergenic
1068558221 10:58482056-58482078 AGGAGAGGGGAGAGGTAGGGAGG - Intergenic
1068573681 10:58659554-58659576 AACTGAGGGTGGAGGGAGGGAGG + Intronic
1068756368 10:60658817-60658839 AGGGGAGGGGAAGGGTAGGGAGG + Intronic
1069176097 10:65290199-65290221 AGACGAGGGGAGGGGAAGGGAGG - Intergenic
1069220080 10:65872328-65872350 AATTGAGGGTTGGGGGAGGGTGG - Intergenic
1069238828 10:66112624-66112646 AGCTGAGGGGAGGGGAAATGAGG - Intronic
1069320487 10:67165358-67165380 GGCAGGTGGTAGGGGTAGGGAGG + Intronic
1069449233 10:68502781-68502803 AGGGGAGGGGAGGGGTAGGGAGG + Intronic
1069705427 10:70456478-70456500 AGCTGAGGGGTGGGGTGGGAGGG - Intergenic
1069727634 10:70591338-70591360 AGTGGAGGGGAGGGGAAGGGAGG + Intergenic
1070638062 10:78145093-78145115 AGATGAGAATGGGGGTAGGGAGG + Intergenic
1070659120 10:78292420-78292442 GGGTGAGGGTCGGGGTGGGGAGG - Intergenic
1070750776 10:78962803-78962825 AGGTGAGGTTAGGGGTTGGGAGG - Intergenic
1071039747 10:81292719-81292741 TCCTGAGGGTAGAGGTTGGGAGG + Intergenic
1071316867 10:84409910-84409932 AGCAGAGGGCAGGGGGTGGGAGG - Intronic
1071532595 10:86401097-86401119 AGAGGAGGCTAGGGGTCGGGGGG - Intergenic
1072161482 10:92771200-92771222 AGGAGAGGGAAGGGGAAGGGAGG - Intergenic
1072575333 10:96694493-96694515 AGCGAAGGGGAGGGGAAGGGAGG - Intronic
1072661691 10:97367229-97367251 AGCTGAGGGGAGGGTTAGCGCGG + Intronic
1073288370 10:102401600-102401622 GGCTGAGGGTAGAGAAAGGGAGG - Intronic
1073359273 10:102884402-102884424 GGCTGGGGGTAGGGGGTGGGAGG - Intronic
1073766773 10:106691190-106691212 AGCTAAGGGATGGGGTAGGGTGG + Intronic
1074408082 10:113197970-113197992 AGCTCAGGGAAGAGGTAAGGTGG + Intergenic
1074580184 10:114711729-114711751 AGCTGAGTGGAGAGGGAGGGGGG + Intergenic
1074764768 10:116692330-116692352 AGGTGAGGGTAGAGTCAGGGCGG - Exonic
1074897162 10:117787202-117787224 GTCTGAGCCTAGGGGTAGGGCGG + Intergenic
1075022426 10:118961530-118961552 AGCAGAGGCAAGGTGTAGGGCGG - Intergenic
1075047783 10:119159655-119159677 AGCTGAGGTTAGGAGGAGAGTGG + Intronic
1075396673 10:122132806-122132828 AGAGGAGGGGAGGGGAAGGGAGG - Intronic
1075576083 10:123578483-123578505 AGCTGAGGGTATGAGAAGGGAGG + Intergenic
1075594075 10:123715167-123715189 TCCTGAGGCTAGGGATAGGGTGG - Intronic
1075719543 10:124576697-124576719 AGCTGAGGGCGGGGGTACTGGGG + Intronic
1075908059 10:126099669-126099691 ATCCAAGGGTAGGGGCAGGGGGG + Intronic
1076256775 10:129032856-129032878 AGCAGAGGTGAGGGGTGGGGCGG - Intergenic
1076369826 10:129945117-129945139 AGGTGAAGGGAGGGGCAGGGAGG + Intronic
1076388231 10:130074878-130074900 AATTGAGGGCAGGGGAAGGGAGG - Intergenic
1077165275 11:1131968-1131990 AGCTGAGTGTATGGGTGGGAAGG - Intergenic
1077299236 11:1839545-1839567 AGGTGAGAGTAGGGGGTGGGCGG + Intronic
1077762574 11:5119032-5119054 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1077906062 11:6534365-6534387 TGCTTAGGGTGGGGGTATGGGGG + Intronic
1078084395 11:8225000-8225022 TGGTGAGTGTAGGGTTAGGGGGG + Intronic
1078180420 11:9005665-9005687 CTGTGGGGGTAGGGGTAGGGGGG + Intergenic
1078395569 11:10978794-10978816 ACTTGAGGGTAGAGGCAGGGAGG + Intergenic
1078535941 11:12174350-12174372 GGCTGGGGGTGGGGGTGGGGAGG - Intronic
1078610044 11:12811852-12811874 GGGTGGGGGTGGGGGTAGGGTGG + Intronic
1078624787 11:12945215-12945237 TGCTGAGGACAGGGGTCGGGAGG - Intergenic
1078807983 11:14725578-14725600 AGGGGAGGGAAGGGGGAGGGAGG - Intronic
1079081555 11:17416873-17416895 AACAAAGGGAAGGGGTAGGGTGG - Intronic
1079107252 11:17579429-17579451 AACTGAGGCCAGGGGAAGGGTGG + Intronic
1079754824 11:24244221-24244243 AGATAAGGGGAGGGGAAGGGAGG - Intergenic
1079934495 11:26600401-26600423 AGAGGAGGGCAGGGGAAGGGAGG - Intronic
1080050279 11:27852049-27852071 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1080582034 11:33651892-33651914 AGGGGAGGGGAGGGGAAGGGGGG - Intronic
1080773506 11:35364208-35364230 AGCTGAGGGTGGGGGCTGTGGGG + Intronic
1081411251 11:42760716-42760738 GGCTGAGGGTAGAGGCTGGGGGG + Intergenic
1081489490 11:43556554-43556576 AGGTGAGGGTAGAGGGAGGGAGG - Intronic
1081605813 11:44526512-44526534 TGCTGAGAGTAGGGGGAGGAAGG + Intergenic
1081794223 11:45808634-45808656 TGCTGGGGGTAGGGTGAGGGGGG - Intronic
1082223884 11:49677650-49677672 AGGAGAGGGAAGGGGAAGGGAGG - Intergenic
1082269563 11:50155264-50155286 AGCTGAGGGGATGGGGAGGAAGG - Intergenic
1082627200 11:55500432-55500454 TGTTGTGGGTTGGGGTAGGGCGG + Intergenic
1083097716 11:60268588-60268610 AGATGAGGGAAGACGTAGGGAGG - Intergenic
1083256681 11:61500466-61500488 AGCTGAGACTAGGGTGAGGGGGG + Intergenic
1083345222 11:61984861-61984883 AGCTGAGGGGAGGGGAAATGGGG - Intergenic
1083367247 11:62148666-62148688 AGCGGAGGGAAGGGGAGGGGAGG + Intronic
1083491332 11:63016836-63016858 AGCACAGGGCAGGGGCAGGGTGG + Intergenic
1083545423 11:63545692-63545714 AGCTGAGGGGAGACTTAGGGAGG - Intronic
1083627127 11:64077534-64077556 AGGTGAGGGGCGGGGCAGGGGGG + Intronic
1083742317 11:64717431-64717453 ATCTGTGGGTAGGGGCAGGGTGG - Intronic
1084000307 11:66292250-66292272 CGTTGGGGGTAGGGGTGGGGCGG + Intronic
1084029421 11:66472533-66472555 AGGTGAGGCTACGGGTTGGGAGG + Intronic
1084112712 11:67024001-67024023 AGCTTAGGAGAGGGGTATGGCGG + Intronic
1084263346 11:67992371-67992393 AGCAGTGGGTGGGGGAAGGGAGG - Intronic
1084268490 11:68016975-68016997 TGCTGAGGGTGGGGACAGGGGGG - Intronic
1084810061 11:71606756-71606778 AGCAGTGGGTGGGGGAAGGGAGG + Intergenic
1084979840 11:72823154-72823176 GGTTGAGGGTAGGGGTTGGGGGG - Intronic
1085121985 11:73973279-73973301 GGCTGAGGGAAGAGGGAGGGTGG + Intergenic
1085281327 11:75332927-75332949 AGCGGTGGGCAGGGGTTGGGGGG - Intronic
1085323957 11:75592569-75592591 AGCAGGTGGTAGGGGAAGGGAGG - Intronic
1086148406 11:83580890-83580912 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1086158085 11:83690672-83690694 TGCTGTGGGTGGGGGTGGGGGGG + Intronic
1086453402 11:86938731-86938753 GGCTGGGGGTAGGGGTGGGGTGG + Intronic
1087361218 11:97162027-97162049 GGCTGGGGGTAGGAGTAGGCTGG + Intergenic
1088059331 11:105627273-105627295 AGAATAGAGTAGGGGTAGGGGGG + Intronic
1088582733 11:111331315-111331337 AGCAGAGGTGAGGGGGAGGGAGG - Intergenic
1088669402 11:112126954-112126976 ATGTGAGGGTAAGGGTAGGGAGG - Intronic
1088672415 11:112155542-112155564 ATCTGAGGGTACAGGCAGGGTGG + Intronic
1088939625 11:114439914-114439936 ATCTGGGCGGAGGGGTAGGGAGG - Intronic
1089057639 11:115599422-115599444 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1089109029 11:116040074-116040096 GGCTAAGGGTAGGAGAAGGGAGG - Intergenic
1089157502 11:116413757-116413779 AGCTGAGCGTAGGGGCAGAAGGG - Intergenic
1089200582 11:116722506-116722528 AGCTGAGGTTTGGGGAAGGATGG + Intergenic
1089255693 11:117192774-117192796 GACTGAGGGCAGGGGCAGGGAGG - Intronic
1089506905 11:118969497-118969519 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1089609816 11:119663020-119663042 AGGGGAGGGGAGGGGTTGGGGGG + Exonic
1090640674 11:128726537-128726559 AGGCGGGGGTGGGGGTAGGGGGG - Intronic
1090654311 11:128831422-128831444 AGGGGAGGGTAGGGGTCGAGGGG - Intergenic
1090670616 11:128942773-128942795 AGGTGAGGAGAGGGGGAGGGAGG - Exonic
1091396146 12:155306-155328 AGGTGAGGGTGGGGCTGGGGTGG - Intronic
1091453803 12:590389-590411 TGCTGAGGGTGGGGAAAGGGAGG + Intronic
1091835944 12:3585869-3585891 TGGTGAGAGTAGGGGTAGTGAGG + Intronic
1091844735 12:3647156-3647178 AGGGGAGGGTAGGGGTGGGACGG - Intronic
1091954352 12:4625986-4626008 AGCTTAGGGTAGGGGGAAGAGGG + Intronic
1092103203 12:5902734-5902756 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1092103214 12:5902754-5902776 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1092742240 12:11641014-11641036 AGAGGAGGGGAGGGGGAGGGAGG - Intergenic
1093412086 12:18879204-18879226 AGATCAAGGTAGGGGCAGGGTGG + Intergenic
1093766847 12:22973523-22973545 AGATGAGGGTGGGGGTGGGGTGG + Intergenic
1094203547 12:27817307-27817329 AGCAGAGGGGAGGGGAGGGGAGG - Intergenic
1094208546 12:27866341-27866363 CGGTGGGGGTGGGGGTAGGGGGG + Intergenic
1094512052 12:31102839-31102861 GGCTGAGGGAAGGGGTAGAACGG + Intronic
1095497038 12:42795948-42795970 ACATGAGGGTAGGGCTGGGGAGG - Intergenic
1096004370 12:48157152-48157174 CGCTGAGGCTAGGGGGCGGGGGG + Intronic
1096103075 12:48981015-48981037 AGCTGAGCCCAGGGGAAGGGAGG - Intronic
1096313783 12:50545387-50545409 AACGGAGGGGAGGGGGAGGGAGG - Intronic
1096319410 12:50598742-50598764 AGGGGAGGGGAGGGGGAGGGGGG - Intronic
1096518200 12:52169973-52169995 AGGTGAGGCAAGGGGCAGGGAGG + Exonic
1096536781 12:52279930-52279952 AGATGAGGTTCTGGGTAGGGAGG + Intronic
1096785807 12:54016636-54016658 GGGTGGGGGTAGGGGTGGGGTGG + Intronic
1096792691 12:54054771-54054793 AGCTGAGGATGGGGTGAGGGTGG + Intronic
1096845389 12:54403724-54403746 AGCAGAAGGGAGGGGTACGGCGG - Exonic
1097154752 12:57004581-57004603 AGCTGAGCGTCTGGGTATGGAGG - Exonic
1097276247 12:57815413-57815435 GGCTCAGGGCAGGGGTTGGGGGG + Intronic
1097502278 12:60419603-60419625 TGCTGATGGTGGGGGTAGGGGGG - Intergenic
1097617208 12:61898187-61898209 AGCTGGGGGTGGTGGTTGGGTGG - Intronic
1098579576 12:72083334-72083356 TGCTAAAGCTAGGGGTAGGGAGG - Intronic
1099148400 12:79076948-79076970 AGTTGGGGTTAGGGGTAGGAAGG - Intronic
1099165953 12:79307612-79307634 GGCTGGGGGTGGGGGTGGGGGGG + Intronic
1099201372 12:79681130-79681152 AGGGGAGGGGAGGGGTGGGGAGG + Intronic
1099881696 12:88475178-88475200 TGCTGAGGGTAAGAATAGGGTGG + Intergenic
1100256301 12:92886544-92886566 AGGGGAGGGAAGGGGAAGGGAGG + Intronic
1100375565 12:94013193-94013215 AGGGGAGGGGAGGGGGAGGGAGG + Intergenic
1100627240 12:96347579-96347601 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1100633128 12:96408043-96408065 TGCTGAGAGTATGGGAAGGGCGG + Intergenic
1100846989 12:98669871-98669893 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1101034810 12:100694820-100694842 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1101593011 12:106139534-106139556 AGCTGGGGGAGGGGGCAGGGAGG + Exonic
1101745949 12:107541757-107541779 ACCTGAGGGTAGGGGATGAGGGG + Intronic
1101786782 12:107891238-107891260 TACTGAGGGTTGGGGTGGGGAGG - Intergenic
1102123479 12:110461781-110461803 TGCTGAGGGAGGGGGTAGGAAGG - Intronic
1102318607 12:111911385-111911407 AGTTGAGGGTAGGGGGAGGTAGG + Intergenic
1102503157 12:113366802-113366824 AGGGGAGGGAAGGGGGAGGGAGG - Intronic
1102879549 12:116474071-116474093 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1102993791 12:117333116-117333138 ATCTGTGGGTGTGGGTAGGGTGG + Intronic
1103301139 12:119927375-119927397 AGCGGAGGGGAGGGGAGGGGAGG + Intergenic
1103425586 12:120830533-120830555 AGCAGAGGGGAGGGGAGGGGAGG + Intronic
1103732792 12:123039019-123039041 AGCTGAGGGTAGGTGTGAGAAGG + Intronic
1103846690 12:123907023-123907045 TGCTCAGGGCAGGGGTGGGGTGG - Intronic
1104075867 12:125389332-125389354 AGTTGAGGGGAGGGGAGGGGAGG - Intronic
1104756042 12:131269814-131269836 AGCTGAGGGGAGCGGTGGGGCGG + Intergenic
1105007378 12:132729608-132729630 AGGTGAGGGGAGGGGGAGGGGGG + Intronic
1105218411 13:18304038-18304060 GGGTAGGGGTAGGGGTAGGGTGG - Intergenic
1105550642 13:21392447-21392469 AGCTGAAGGCATGGGTAAGGTGG - Intronic
1105818374 13:24057622-24057644 GGTTGGGGATAGGGGTAGGGTGG - Intronic
1105940968 13:25147684-25147706 AACTGAGACTGGGGGTAGGGAGG + Intergenic
1106199033 13:27520760-27520782 AGGGGAGGGAAGGGGAAGGGAGG + Intergenic
1106227554 13:27796447-27796469 AGCTGAGGATGGGGGTGGGAGGG + Intergenic
1106606784 13:31235824-31235846 AGCCAGGGGTTGGGGTAGGGAGG - Intronic
1107322105 13:39200955-39200977 AGATGGGGGTGGGGGTGGGGAGG + Intergenic
1107382714 13:39874906-39874928 AGCTGAGGGGTGGGGTTGAGTGG - Intergenic
1107752200 13:43579966-43579988 CAAGGAGGGTAGGGGTAGGGTGG + Intronic
1108299648 13:49061446-49061468 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1108299683 13:49061518-49061540 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1108856781 13:54802505-54802527 AAATGAGGGTTGGGGTAGGGAGG + Intergenic
1109854160 13:68107090-68107112 AGCTGTGGGCATGTGTAGGGTGG - Intergenic
1110086263 13:71384706-71384728 TGCTGTGGGTGGGGGGAGGGGGG - Intergenic
1110368742 13:74717688-74717710 GGCTGAGGATGGTGGTAGGGTGG + Intergenic
1110552886 13:76827972-76827994 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1110703214 13:78574207-78574229 AGAGGAGGGAAGGGGTGGGGGGG - Intergenic
1111982771 13:95034397-95034419 AGAAGCGGGTAGGGGTTGGGGGG - Intronic
1111997158 13:95176214-95176236 AGCCGAGGGCAGGGGGGGGGGGG + Intronic
1112095379 13:96126887-96126909 AGCTGGGGGTAGAGGAAAGGAGG - Intronic
1112330650 13:98474800-98474822 AGGTGAGGGGAGGGTGAGGGCGG - Exonic
1112714971 13:102173811-102173833 AGCTGAGGGTAGGGGTAGGGGGG + Intronic
1113010923 13:105764972-105764994 AGAAGAGGGGAGGGGAAGGGAGG - Intergenic
1113358584 13:109607179-109607201 ACCTGAGGGTAGAGGGTGGGAGG - Intergenic
1113738305 13:112693454-112693476 AGCTGTGGGTACGGGGAGAGGGG + Intronic
1113909809 13:113836552-113836574 AGGTGAGGGAGGGGGTGGGGAGG + Intronic
1113991898 14:16034567-16034589 AGTTGGGGGTTGGGGGAGGGTGG - Intergenic
1114160209 14:20157274-20157296 ACCAGAGGGTAGTAGTAGGGTGG - Intergenic
1114638986 14:24206430-24206452 AGCTGAGGGTAGGAGACGGCTGG + Intronic
1115041098 14:28929328-28929350 ACATGGGGGTGGGGGTAGGGTGG + Intergenic
1115074025 14:29363486-29363508 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1115106556 14:29768986-29769008 ATGTGAGGGTGGTGGTAGGGTGG - Intronic
1115328869 14:32171928-32171950 ATCTGAGGGTAGGAGTGAGGTGG - Intergenic
1115816686 14:37171127-37171149 AGGGGAGGGGAGGGGTGGGGAGG + Intronic
1115958364 14:38808042-38808064 GTCAGAGGGTGGGGGTAGGGAGG + Intergenic
1115961599 14:38839690-38839712 GTCTGAGGGTGGAGGTAGGGTGG - Intergenic
1116766593 14:49079539-49079561 ATTTGAGGGTAGAGGTTGGGAGG - Intergenic
1117077532 14:52119246-52119268 CGCTGGGGGTTGGGGCAGGGCGG - Intergenic
1118141768 14:63091682-63091704 AGCGGAGGGGAGGGGAGGGGAGG + Intronic
1118663129 14:68037108-68037130 AGGGGAGGGTAGGGGAGGGGAGG - Intronic
1118685527 14:68286752-68286774 AGCAGAGGGTAGGTGTAGCCTGG + Intronic
1118744303 14:68762868-68762890 ATCTGGGGGTGGGGGTGGGGTGG + Intergenic
1118772821 14:68953331-68953353 GGCTGAGGGTAGGGAGTGGGTGG - Intronic
1118883511 14:69848597-69848619 AGCAGAGGCTAGGGGTGTGGAGG + Intergenic
1119364909 14:74083865-74083887 ATCTGAGGTAAGGGGGAGGGGGG - Intronic
1119635025 14:76266835-76266857 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1119673823 14:76539147-76539169 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1119714259 14:76847533-76847555 AACTGAGGGTGGAGGGAGGGAGG + Intronic
1119735183 14:76977063-76977085 GGCTGAGGGTAGTTGTAGAGAGG - Intergenic
1119771015 14:77220790-77220812 AGCTGTGTGTGGGGGTGGGGAGG - Intronic
1119880031 14:78092533-78092555 AGATGGGGGTAGGCCTAGGGAGG - Intergenic
1120030921 14:79639876-79639898 GGCTGATGGTGGGGGTGGGGAGG - Intronic
1120711892 14:87801220-87801242 AGCAGTGGGTGGGGGTAGGAAGG + Intergenic
1121001117 14:90452682-90452704 AGCTTATGGTGGGTGTAGGGTGG + Intergenic
1121292027 14:92783704-92783726 AGCTGAGGATAGGGAGAGAGGGG + Intergenic
1121551402 14:94805211-94805233 AGCGGAGGGGAGGGGAGGGGAGG - Intergenic
1121740008 14:96245064-96245086 AGTGGAGGGTGGGGGTTGGGAGG - Intronic
1121855465 14:97265544-97265566 CGGTGAGGGTTGGGGGAGGGGGG + Intergenic
1122052164 14:99067553-99067575 AGCTGGGGTTAGGGCTAGGCTGG - Intergenic
1122055546 14:99095922-99095944 AGCAGAGGGCAGGGGAAGGCTGG - Intergenic
1122096496 14:99376577-99376599 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1122190971 14:100043460-100043482 AGCCCAGGGTGGGGGTGGGGTGG + Intronic
1122330724 14:100910652-100910674 AGCTGGGGGGAGGGGTAAGAAGG + Intergenic
1122373412 14:101242189-101242211 AGGAGAGGGGAGGGGAAGGGAGG + Intergenic
1122422780 14:101587964-101587986 AGCTGAGGCCTGGGGTAGTGGGG - Intergenic
1122439259 14:101718909-101718931 AGGGGAGGGAAGGGGAAGGGAGG + Intergenic
1122460722 14:101892367-101892389 GGCTGAGGGAAGGTGTTGGGTGG + Intronic
1122627296 14:103091085-103091107 AGCTCAGGTGAGGGGTGGGGCGG + Intergenic
1122628558 14:103097118-103097140 AGCTGAGGCTGGGGGTAGGGAGG + Intergenic
1122653510 14:103240771-103240793 GGCTGATGGCAGGGGTGGGGTGG + Intergenic
1122803148 14:104242722-104242744 AGCAGAGGGGAGGGGAGGGGAGG - Intergenic
1122931321 14:104934002-104934024 GGCTGAGGGGACGGGGAGGGCGG + Exonic
1122931337 14:104934037-104934059 GGCTGAGGGGACGGGGAGGGCGG + Exonic
1122931353 14:104934072-104934094 GGCTGAGGGGACGGGGAGGGCGG + Exonic
1122985385 14:105209380-105209402 AGCTCTGGGCGGGGGTAGGGGGG + Exonic
1123004970 14:105316695-105316717 TGGGGAGGGTATGGGTAGGGCGG + Intronic
1123457764 15:20441394-20441416 AGCTGAGGGCAGGGTGGGGGAGG - Intergenic
1123660306 15:22559023-22559045 AGCTGAGGGCAGGGTGGGGGAGG + Intergenic
1123889434 15:24761443-24761465 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
1124263910 15:28216548-28216570 AGCTGAGGGCAGGGTGGGGGAGG - Intronic
1124314164 15:28653512-28653534 AGCTGAGGGCAGGGTGGGGGAGG + Intergenic
1124682086 15:31740422-31740444 AGCAGATGGTGGGGGGAGGGTGG + Intronic
1124685359 15:31777635-31777657 GGCTGAGGGTGGGGGATGGGGGG - Intronic
1125519414 15:40339783-40339805 GGCTGGGGCCAGGGGTAGGGTGG - Intronic
1126346591 15:47701356-47701378 AGCTGAGGGGAGGGGGATTGGGG + Intronic
1126385938 15:48093472-48093494 AGATGAGGGAAGGGGGAGGAAGG - Intergenic
1126970751 15:54109290-54109312 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1127149681 15:56060547-56060569 ACCTAAGGGCAGGGGTAGAGGGG + Intergenic
1127536829 15:59897890-59897912 AGATGGGGTTAGGAGTAGGGTGG + Intergenic
1127570274 15:60234878-60234900 AGCTGATGGTGGGGGTAGGGAGG - Intergenic
1127657611 15:61071254-61071276 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1127657660 15:61071359-61071381 AGGAGAGGGGAGGGGAAGGGAGG + Intronic
1127657671 15:61071379-61071401 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1127657766 15:61071595-61071617 AGGGGAGGGGAGGGGTGGGGAGG + Intronic
1127761158 15:62140197-62140219 TGGTGAGGGTCGGGGTGGGGGGG + Intergenic
1128083774 15:64872300-64872322 ACATGAGGGTAGGGGTGGGGAGG - Intronic
1128155952 15:65392103-65392125 GGCTGGGGGGAGGGGGAGGGAGG - Intronic
1128333777 15:66773201-66773223 AGCTGAGGTGGGGGGTGGGGAGG + Intronic
1128338204 15:66802154-66802176 AGATCAGGATGGGGGTAGGGTGG - Intergenic
1128580649 15:68807459-68807481 AGCGGAGGGGAGGGGCAGGGAGG - Intronic
1128713092 15:69886605-69886627 AGCTGAGGGTAGGCATAGAGTGG - Intergenic
1129225523 15:74168369-74168391 GGGTGAGGGAAGGGGGAGGGAGG - Intergenic
1129447023 15:75625738-75625760 AGCTGGGGGCGGGGGGAGGGCGG - Intronic
1129462474 15:75706520-75706542 AGGTGAGGGTAGGGGAAGAAAGG + Intronic
1129473326 15:75767002-75767024 ACCTGGGGGAAGGGGTTGGGGGG + Intergenic
1129660357 15:77549697-77549719 TGCTGGGGTTGGGGGTAGGGTGG + Intergenic
1129679392 15:77649639-77649661 AGCTGGGGCTAGGGGTACTGGGG + Intronic
1129722390 15:77884894-77884916 AGCTGAGGGTAGGGGAAGAAAGG - Intergenic
1129738772 15:77979887-77979909 AGCTGGGAGTTGGGGTCGGGAGG - Intergenic
1129847183 15:78773293-78773315 AGCTGGGAGTTGGGGTCGGGAGG + Intronic
1129887595 15:79049369-79049391 AGCTGAGGTTGGGGGATGGGGGG + Intronic
1130223866 15:82043891-82043913 AGCTCAGGGCGGGGCTAGGGGGG + Exonic
1130254713 15:82320595-82320617 AGCTGGGAGTGGGGGTCGGGAGG - Intergenic
1130458952 15:84143933-84143955 CCCTGGGGGTAGGGGTAGGAGGG + Intergenic
1130509875 15:84580724-84580746 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1130600260 15:85269411-85269433 AGCTGGGAGTGGGGGTCGGGAGG + Intergenic
1130736015 15:86549852-86549874 AGAGGAGGGGAGGGGAAGGGTGG + Intronic
1130842254 15:87711769-87711791 AGCTGGAGGCAGGGGTAGAGGGG + Intergenic
1130921320 15:88347534-88347556 GGCTGAGGGTGGGGGCAGGAGGG - Intergenic
1130955271 15:88623022-88623044 GGCTGAGGCTAGGAGTAGGGTGG - Intronic
1130996189 15:88905729-88905751 TGCTGGGGGTGCGGGTAGGGGGG - Intronic
1131070064 15:89460623-89460645 AGATGAAGGATGGGGTAGGGAGG - Intergenic
1131070337 15:89461796-89461818 AGCTCAGGATAGGAGTGGGGTGG + Intergenic
1131109269 15:89754622-89754644 GGGTGAGTGGAGGGGTAGGGAGG - Intergenic
1131279583 15:91009702-91009724 AGCTGGTGGTGGGGGTGGGGTGG + Intronic
1132214768 15:100054336-100054358 AGCTGGGGTTAGGGGTGGAGGGG + Intronic
1132279934 15:100603419-100603441 AACTGGGGGTGGGGGTGGGGGGG - Intronic
1132652878 16:1029408-1029430 AGCTCGGGGTAGGGGGAGAGTGG - Intergenic
1132670023 16:1098728-1098750 AGCCGAGGGTTGGGGCACGGGGG - Intergenic
1132712227 16:1274141-1274163 AGCTGAGGCTGGGGGCAGGGAGG - Intergenic
1132738970 16:1401529-1401551 AGCTGAGGGCGGTGGTGGGGGGG - Intronic
1132843497 16:1989830-1989852 AGGTGAGGGTGGGGGATGGGAGG + Intronic
1133042799 16:3069396-3069418 AGCTGAGGGAGGGGTCAGGGTGG - Exonic
1133044840 16:3082038-3082060 AGCTGAGGGAGGGGTCAGGGTGG - Intronic
1133330161 16:4967966-4967988 AGGAGAGGGGAGGGGAAGGGAGG - Intronic
1133377322 16:5298502-5298524 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1133377339 16:5298537-5298559 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1133377360 16:5298577-5298599 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1133448584 16:5884465-5884487 AGCCGGGGGCGGGGGTAGGGGGG - Intergenic
1133867523 16:9658074-9658096 GGCGGGGGGTAGGGGTAGCGGGG + Intergenic
1133964299 16:10519545-10519567 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1134373680 16:13649722-13649744 AGTTGAGGGAAGAGGTTGGGAGG - Intergenic
1134374736 16:13661348-13661370 AGCTGAGGAAAGGGTGAGGGAGG - Intergenic
1134741714 16:16553414-16553436 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1134872677 16:17666101-17666123 ACCTGTGGCTAGGGGTGGGGAGG - Intergenic
1135518588 16:23156129-23156151 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1135731088 16:24895558-24895580 AGGAGAGGGGAGGGGAAGGGAGG + Intronic
1136017869 16:27416773-27416795 AGCTGAGGCTGAGGGGAGGGGGG - Intronic
1136287714 16:29254112-29254134 AGCTGGAGGTGGGGGTTGGGGGG - Intergenic
1136998571 16:35208249-35208271 AGCTCTGGGGAGGGGCAGGGCGG + Intergenic
1137573051 16:49579212-49579234 AGCAGTGGGTGGGGGTGGGGGGG - Intronic
1137617491 16:49856210-49856232 GGGTGAGGGTGGCGGTAGGGTGG - Intronic
1137727782 16:50668764-50668786 ACCTGCTGGTAGGGGTAGGTTGG - Intronic
1138200050 16:55081873-55081895 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1138443726 16:57050339-57050361 AGCTGGGGGGCAGGGTAGGGCGG - Intronic
1138449764 16:57086676-57086698 GGCGGGGGGTAGGGGTGGGGTGG + Intergenic
1138667694 16:58586257-58586279 AGGCGAGGGGAGGGGGAGGGGGG + Intronic
1138667735 16:58586338-58586360 AGGGGAGGGGAGGGGGAGGGAGG + Intronic
1138750839 16:59418734-59418756 AGTTGAAGATAGGTGTAGGGGGG - Intergenic
1139182193 16:64761630-64761652 ACCTTAGGGTTGGGGAAGGGAGG - Intergenic
1139514046 16:67443030-67443052 GGCTGTGGGAAGTGGTAGGGTGG - Intronic
1139598324 16:67970653-67970675 AGATGAGGGGTGGGGTGGGGTGG - Intergenic
1140253966 16:73319082-73319104 TGCTGAGGGGAGGGGAGGGGAGG + Intergenic
1140409489 16:74733435-74733457 AGCTGGGGGAAGGGGGAGGGAGG - Intronic
1140423585 16:74841633-74841655 AGGGGAGGGTAGGAGAAGGGAGG + Intergenic
1140941867 16:79729294-79729316 AGCTTGGGGTAGAGGTGGGGAGG + Intergenic
1141168546 16:81676802-81676824 AGCTGGGGGAAGGGGTGGGAGGG - Intronic
1141557589 16:84846227-84846249 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1141624532 16:85254306-85254328 GGCTGAGGGCAGGGGCAGGCAGG - Intergenic
1141673155 16:85503360-85503382 AGCTGAGGGCAGGTGGAGGCTGG - Intergenic
1141805974 16:86341770-86341792 TGCTGAGGGTTGGGGTGGGGTGG - Intergenic
1141841554 16:86577154-86577176 AGATGAGGGAAGGGGGAGGATGG - Intronic
1141952940 16:87350756-87350778 AGCTGAGGGGAGGGGATAGGAGG - Intronic
1141973091 16:87495821-87495843 AGATGGGGGTAGGGGAGGGGTGG - Intergenic
1142093338 16:88226740-88226762 AGCTGGAGGTGGGGGTTGGGGGG - Intergenic
1142157719 16:88540173-88540195 GGCAGAGGTTAGGGTTAGGGCGG + Intergenic
1142205394 16:88780382-88780404 GGGTGGGGGTAGGGGAAGGGGGG + Intronic
1142223113 16:88864939-88864961 AACTGAGGGGAGGGGCAGGGAGG + Exonic
1142441566 16:90101692-90101714 AGCTGAGGGAAGGAGATGGGAGG - Intergenic
1142865502 17:2788732-2788754 AGCTGAGGGCAGGAGAAGGCGGG + Intronic
1142870153 17:2814736-2814758 AGCTGGGTGTTGGGGTTGGGGGG - Intronic
1142872624 17:2830944-2830966 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1142872637 17:2830969-2830991 AGGGAAGGGTAGGGGAAGGGAGG - Intronic
1143083452 17:4398140-4398162 ACTAGAGGGTAGGGGTGGGGAGG - Intergenic
1143182533 17:4992632-4992654 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1143389735 17:6553225-6553247 AGGTGGGGGCAGGGGTGGGGAGG - Intronic
1143524979 17:7466592-7466614 AGCTGGTGGAAGGGGTAGTGGGG + Exonic
1143751680 17:9032730-9032752 GGCTGAGGGTAGGGGCTGGGGGG - Intronic
1143781297 17:9230960-9230982 AGCTCAGAGTAGGGGTGGGGTGG + Intronic
1144134413 17:12279608-12279630 ACTTGAGGGTAGCGGTTGGGAGG - Intergenic
1145279745 17:21458428-21458450 AGGTGAGGAGAGGGGAAGGGAGG + Intergenic
1145286917 17:21512606-21512628 AGGTAAGGGTAGGGGGATGGGGG + Intergenic
1145398138 17:22512054-22512076 AGGTGAGGAGAGGGGAAGGGAGG - Intergenic
1145825354 17:27872926-27872948 GGCTGGGGGTAGGGGTGGGGAGG - Intronic
1145877833 17:28333251-28333273 AGCTGAGGCTGGGGGCAGTGGGG - Intronic
1146577179 17:34004872-34004894 AGGGGTGGGTGGGGGTAGGGAGG + Intronic
1146667929 17:34717032-34717054 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1146667940 17:34717052-34717074 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1146667956 17:34717082-34717104 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1147027028 17:37595566-37595588 TGCTGAGGGTTGGGGTATGATGG - Intronic
1147178586 17:38671652-38671674 GGGTGAGGGTGGGGGTGGGGTGG - Intergenic
1147228238 17:38997694-38997716 AGGGGAGGGCAGGGGAAGGGAGG - Intergenic
1147250049 17:39147676-39147698 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1147317658 17:39628431-39628453 AGCTGAGGGGCGGGGCGGGGAGG + Intronic
1147378229 17:40035701-40035723 AGGTAAGGGCAGGGGTAAGGGGG - Exonic
1147387579 17:40091195-40091217 GGCTGAGGGTCAGGGTGGGGTGG - Intronic
1147460649 17:40565964-40565986 AGGGGAGGGGAGGGGAAGGGGGG - Intergenic
1147514302 17:41101627-41101649 AGAGGAGGGGAGGGGAAGGGCGG + Exonic
1147529621 17:41263282-41263304 AGGGGAGGGGAGGGGTGGGGAGG + Intergenic
1147659817 17:42111534-42111556 ATCTGGGGCCAGGGGTAGGGAGG + Intronic
1147873255 17:43602820-43602842 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1147944876 17:44075240-44075262 AGCTGGGGGTCGGGGTGGGGAGG + Intronic
1147957806 17:44146802-44146824 AGCAGAGGGTGGGGGTGGTGGGG + Intronic
1148075334 17:44932375-44932397 AGCTGAGGGTAGGAGGAGTCAGG + Intronic
1148111770 17:45148542-45148564 AGCTGTGGGAAGGGGGAGGAGGG + Exonic
1148219782 17:45853255-45853277 ACCTGGGGGTGGGGGTGGGGAGG - Intergenic
1148835200 17:50462367-50462389 GGCTGAGGGAGGGGGCAGGGTGG - Intronic
1149552645 17:57551644-57551666 AGCAGTGGGTGGGGGAAGGGCGG - Intronic
1150201568 17:63362562-63362584 GGCTGAGGGTAGGCTGAGGGTGG - Intronic
1150784968 17:68154829-68154851 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1151145158 17:72033652-72033674 AGGTGGGGGGCGGGGTAGGGGGG + Intergenic
1151391045 17:73786786-73786808 AACCCAGGGTAGGGGTGGGGTGG + Intergenic
1151599739 17:75098892-75098914 AGCTGAGCATAAGGATAGGGAGG + Intronic
1151731157 17:75912122-75912144 AGCTCAGGGCAGAGGCAGGGAGG - Intronic
1151951650 17:77357595-77357617 AGGAGAGGGGAGGGGAAGGGAGG - Intronic
1152101491 17:78304392-78304414 AGCTCAGGATAGGGGCAGCGAGG + Intergenic
1152300210 17:79491115-79491137 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1152326032 17:79637754-79637776 AGAGGAGGGGAGGGGAAGGGAGG + Intergenic
1152757167 17:82091857-82091879 AGCTGAGGGCAGGGCCATGGCGG - Intronic
1152841504 17:82571736-82571758 AGCTGCGCGTAGGAGTAAGGCGG - Exonic
1152945267 17:83194519-83194541 AGCCAAGGGTGGGGGGAGGGTGG + Intergenic
1153015908 18:582545-582567 ATCTGAGGGCAGGGGAAGGAGGG + Intergenic
1153760381 18:8325310-8325332 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
1154071903 18:11160165-11160187 ATCTGAGTGTATGAGTAGGGGGG + Intergenic
1154099003 18:11451144-11451166 TGCTGAGGTTTGGGGTATGGTGG - Intergenic
1154972981 18:21429183-21429205 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1155068438 18:22289652-22289674 ACCAGTGGGTAGGGGGAGGGAGG - Intergenic
1155374239 18:25138510-25138532 AGTGGAGGGTGGGGGTGGGGAGG + Intronic
1155431292 18:25762039-25762061 GGCTGAGGGTAGGGGAAAGAGGG - Intergenic
1155502771 18:26503841-26503863 AGCTGGGGGTGGGGGTGGGGTGG + Intronic
1155886732 18:31217437-31217459 AGGTGAGGGCAGGGTTAGGTGGG - Intergenic
1156388412 18:36627280-36627302 TGCTGAGGGTAGGAGTTAGGTGG + Intronic
1156476638 18:37409706-37409728 AGCTGAGGGACATGGTAGGGAGG + Intronic
1156532968 18:37835864-37835886 AGCTGAGGTTAAGGGTTAGGTGG - Intergenic
1156863291 18:41863000-41863022 AGGTGAGGGAATGGGAAGGGAGG + Intergenic
1156920908 18:42521623-42521645 AGGGGAGGGGAGGGGTGGGGAGG - Intergenic
1157356637 18:46941212-46941234 TACTGGGGGTAGGGGTAGGGGGG + Intronic
1157418455 18:47525871-47525893 GGCTGAGGGGAGGGGTGGGGCGG - Intergenic
1157484349 18:48076408-48076430 AGAGGAGGGTAAGGGGAGGGAGG + Intronic
1158202226 18:54953992-54954014 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1158308020 18:56127871-56127893 ACCTGGGTGTTGGGGTAGGGAGG - Intergenic
1158321677 18:56270579-56270601 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1158372190 18:56820624-56820646 AACTGAGGGCAGGGGGAGGAGGG - Intronic
1158431073 18:57388066-57388088 AGATGAGGGCAGGGTTGGGGAGG + Intergenic
1158896278 18:61916601-61916623 AGGTGAGGCCAGGGGTGGGGAGG + Intergenic
1159164056 18:64680978-64681000 ACCAGAGGTTAGGGGGAGGGGGG - Intergenic
1159493015 18:69162977-69162999 AGGAGAGGGGAGGGGAAGGGAGG - Intergenic
1160146981 18:76373248-76373270 AGCGGAGGGGAGGGGAAAGGAGG + Intronic
1160191697 18:76719923-76719945 AGCTGAGGGAGGGGGGAGTGGGG + Intergenic
1160360206 18:78268666-78268688 AGGTGAAGGGAGGGGAAGGGAGG - Intergenic
1161315314 19:3614763-3614785 AGCGGAGGGGAGGGGGTGGGCGG + Intronic
1161327072 19:3669116-3669138 GGCTGAGGGTTGGGGAAGGGAGG + Intronic
1161635908 19:5388721-5388743 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1162237747 19:9321803-9321825 AGAGGAGGGTGGGGGTGGGGAGG - Intergenic
1162327473 19:10007561-10007583 TGCTGAGGGTTGGGGGATGGGGG - Intronic
1162345786 19:10117214-10117236 AGTTGAGGGCAGGGGCAGGCTGG + Intronic
1162751748 19:12833830-12833852 GGCTGAGGGGAGGGGTGGCGGGG - Intronic
1162802732 19:13119901-13119923 AGCTGAGGCTCGGGGTGGTGTGG + Intronic
1162876859 19:13626829-13626851 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1163351128 19:16777362-16777384 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1163371894 19:16905785-16905807 TGCTGGGGGTAGGGGTGGAGTGG + Intronic
1163398273 19:17076473-17076495 AACTGAGGGTAGGCTTAGGGAGG + Intronic
1163414972 19:17180906-17180928 CGCTGAGGGGAGGGGTGGAGGGG - Exonic
1163484858 19:17579668-17579690 AGGTGGGGGTGGGGGCAGGGTGG + Intronic
1163488465 19:17603415-17603437 GGCTGAGGGTAGGGGTCGGGTGG - Exonic
1163726783 19:18927728-18927750 AGCCGGGGGTGGGGGTGGGGAGG - Intronic
1163785291 19:19272029-19272051 AGATCAGGGCAGGGGTAGGGTGG - Intronic
1164489197 19:28691211-28691233 TGCTGAGGGTAGGGTTTGGTGGG + Intergenic
1164700673 19:30281822-30281844 AGCTCAGAGTAGGGGTGGGAAGG - Intronic
1164714903 19:30384310-30384332 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1165140192 19:33694917-33694939 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1165428294 19:35757461-35757483 GGCTGAGGATAAGGGTAGGGAGG - Intronic
1165743325 19:38216451-38216473 GGCTGAGGCTGGGGGCAGGGTGG - Intronic
1165743519 19:38217378-38217400 AGCTGGGGGTGGGGGTGGGGGGG - Intronic
1166572933 19:43810550-43810572 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1166782708 19:45350800-45350822 AGATGGGGGTGGGGGTGGGGTGG - Exonic
1166882835 19:45939776-45939798 AGCTGAGGTCAGGAGTTGGGGGG + Exonic
1166977025 19:46610631-46610653 AGCTGAGGGTAAGGGCAGGTAGG + Exonic
1167066074 19:47187002-47187024 AGCATAGGGTAGGGGTGGAGGGG + Intronic
1167554210 19:50183115-50183137 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1168063213 19:53905733-53905755 AGGGAAGGGTAGGGGGAGGGAGG - Intronic
1168188632 19:54720936-54720958 AGATGGGGGGAGGAGTAGGGAGG + Intergenic
1168236829 19:55068950-55068972 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1168261356 19:55196840-55196862 AACTGGGGGTAGGGGTGGAGGGG - Intronic
1168299563 19:55396487-55396509 AGGGGAGGGGAGGGGTGGGGAGG - Intronic
1168299578 19:55396512-55396534 AGGGGAGGGGAGGGGTGGGGAGG - Intronic
1168377601 19:55893531-55893553 ATCTGTGGGTAAGGCTAGGGTGG - Intronic
1168405530 19:56108380-56108402 AGCTCTGGGCAGGGGTTGGGTGG - Intronic
1168405543 19:56108415-56108437 AGCTCTGGGCAGGGGCAGGGTGG - Intronic
1168670072 19:58234313-58234335 AGATGAGGTTAAGGGAAGGGAGG - Intronic
925005607 2:440961-440983 AGCAGAGGGTGGGGGGATGGAGG + Intergenic
925327511 2:3035117-3035139 AGCGCAGGGCAGGGGTTGGGAGG - Intergenic
925376471 2:3389364-3389386 AACTGAGTGTAGGGGTCCGGGGG + Intronic
925493100 2:4417855-4417877 AGCTGAGAGAAGGGGCAGGGAGG - Intergenic
926010082 2:9400393-9400415 AGAGGAGGGGAGGGGAAGGGAGG - Intronic
926247224 2:11130383-11130405 AGCTGGCGGGAGGGGCAGGGCGG + Intergenic
926337377 2:11874983-11875005 AGCGGACGGTGGGGGGAGGGGGG - Intergenic
926429822 2:12774410-12774432 TGTTGAGGGTGGGAGTAGGGAGG + Intergenic
927178922 2:20430081-20430103 AGCTGAGGGAGTGGGGAGGGTGG - Intergenic
927186526 2:20486257-20486279 AGGGGAGGGAAGGGGAAGGGAGG - Intergenic
927269606 2:21191795-21191817 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
927328627 2:21835875-21835897 TGTTCAGGGTAGGGGAAGGGTGG + Intergenic
927537760 2:23877524-23877546 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
927537770 2:23877544-23877566 AGGGGAGGGCAGGGGAAGGGAGG + Intronic
927659697 2:24982490-24982512 AGCAGAGGGAAGGGGAGGGGAGG + Intergenic
928003914 2:27546232-27546254 CACTGGGGATAGGGGTAGGGAGG - Intronic
928146427 2:28781487-28781509 TGCTGGGGGTAGGGGTGGGATGG - Intronic
928666222 2:33553056-33553078 TGCTGGGGGTGGGGGTGGGGAGG - Intronic
928792486 2:34974786-34974808 AGCTGAGGGTGGAGGGTGGGAGG - Intergenic
929215064 2:39403779-39403801 AGCTGGGGTTAGGGGAGGGGTGG - Intronic
929217026 2:39425115-39425137 AGCTGAGTGGAGGGGCTGGGGGG - Intronic
929444532 2:41992018-41992040 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
929980110 2:46670253-46670275 AGCAGAGAGTTGGGGGAGGGTGG - Intergenic
930033076 2:47069984-47070006 ACTTGAGGGCAGGGGTGGGGAGG + Intronic
930136458 2:47906923-47906945 GGGTGAAGGTTGGGGTAGGGGGG - Intergenic
931357614 2:61550824-61550846 AGGTGAGGGTGGGGGTTAGGGGG + Intergenic
931644206 2:64406580-64406602 GCCTGAGGGTGGGGGAAGGGAGG + Intergenic
931709246 2:64974089-64974111 AGGGGAGGGGAGGGGTGGGGAGG - Intergenic
931744928 2:65283495-65283517 AGCTGAGGGTGGGGTGAGGAGGG + Intergenic
931790821 2:65662503-65662525 CGCTGAGGGTAGCGGCAGGCTGG + Intergenic
931937752 2:67217013-67217035 GGATGAGGGTGGGGGGAGGGAGG + Intergenic
932405617 2:71511112-71511134 GGGTGAGGGTTGGGGTGGGGTGG + Intronic
932438370 2:71716513-71716535 AGGAGGGGGTATGGGTAGGGAGG + Intergenic
932488515 2:72103582-72103604 AGCAGAGGGTAGGGGTGAGGGGG - Intergenic
932621191 2:73265699-73265721 AGCTGATGGTAGGGGCAGGATGG - Intronic
932699734 2:73984758-73984780 CGCGGAGGGGAGGGGTCGGGTGG - Intergenic
933225194 2:79740160-79740182 ATCAGAGGGTAGAGGTTGGGAGG - Intronic
933773114 2:85756040-85756062 TGCTGGGGGTTGGGGTGGGGTGG + Intronic
933886892 2:86726792-86726814 GGCTGAGGTTAGGGCTAGGCTGG + Intronic
933923286 2:87069916-87069938 GGCTGAGGTTAGGGCTAGGCTGG - Intergenic
934056143 2:88253044-88253066 AGATGAGGGGAGGGGAGGGGAGG - Intergenic
934295894 2:91742595-91742617 GGGTAGGGGTAGGGGTAGGGTGG + Intergenic
934561891 2:95317805-95317827 AGCTGAGGGCAGGAGTCGGGCGG + Intronic
935030498 2:99317344-99317366 GGCAGAGGGTAGGGGTTGGAGGG - Intronic
935315986 2:101834237-101834259 AGCGGAGGGGAGGGGAGGGGAGG - Intronic
935708524 2:105877230-105877252 AGCTGTGGCCAGGGGGAGGGAGG - Intronic
935750826 2:106232503-106232525 AGCTGCTGCTAGGGGTGGGGTGG - Intergenic
935789249 2:106576001-106576023 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
936618970 2:114075377-114075399 AGGTGGGGGTGGGGGTGGGGTGG + Intergenic
937206065 2:120237900-120237922 AGGAGAGGGGAGGGGAAGGGAGG - Intergenic
938539773 2:132276189-132276211 GGCTGGGGGTGGGGGTGGGGGGG + Intergenic
938844833 2:135197727-135197749 GCCTGTGGGTAGGGGTAGGGTGG - Intronic
939176243 2:138751021-138751043 AGATGGGGGTGGGGGTGGGGAGG - Intronic
939476023 2:142687167-142687189 AGGGGAGGGGAGGGGAAGGGGGG + Intergenic
939606736 2:144262980-144263002 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
939787674 2:146537403-146537425 AGGGGAGGGTAGGGGAGGGGAGG + Intergenic
940049629 2:149448536-149448558 AGGTGGGGGTAGGGGTGGAGAGG - Intronic
940150998 2:150600403-150600425 AACTGAGGGGAGAGGGAGGGAGG + Intergenic
940650788 2:156438195-156438217 AGCTGAGGGTAGTTGTGGAGCGG + Intronic
940860012 2:158761841-158761863 AAGTGAGGGAAGGGGGAGGGAGG - Intergenic
942076980 2:172365142-172365164 AGCTGAGAGTGGGGGTGGTGTGG + Intergenic
942577103 2:177375293-177375315 AGAAGAGTGCAGGGGTAGGGGGG + Intronic
942760703 2:179394199-179394221 ACCTGAGGGTGGAGGTTGGGAGG + Intergenic
942890429 2:180980865-180980887 AGCTGTGGGGGGGGGAAGGGGGG - Exonic
943207717 2:184921757-184921779 AGCTGGGGGTAGGGTAAGTGGGG - Intronic
943394267 2:187312997-187313019 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
943986317 2:194624055-194624077 ATCTGAGGGTGGAGGTTGGGAGG + Intergenic
944256195 2:197625723-197625745 AGAGGAGGGGAGGGGAAGGGAGG - Intronic
944741118 2:202613783-202613805 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
945214168 2:207415320-207415342 AGCAGAGGGAAGGGGTTGGCAGG + Intergenic
945242254 2:207686849-207686871 AGGGGAGGGAAGGGGAAGGGTGG + Intergenic
945821555 2:214671884-214671906 TGGTGAGGGGAGGGGAAGGGAGG - Intergenic
945908356 2:215619241-215619263 AGCTGAGAGAAGGGGAAGGAGGG + Intergenic
946010540 2:216560239-216560261 AGGAGAGGGGAGGGGGAGGGAGG - Intronic
947140476 2:227015522-227015544 AGCTGAACCTGGGGGTAGGGAGG - Intronic
947189174 2:227484050-227484072 AATGGAGGGTGGGGGTAGGGGGG - Intronic
947505594 2:230706119-230706141 GTCTGAGGGTGTGGGTAGGGTGG + Intergenic
947692054 2:232147966-232147988 AGCGGAGGGGAGGGGAGGGGAGG - Intronic
947698272 2:232211138-232211160 AGAGGAGGGGAGGGGAAGGGAGG - Intronic
947746898 2:232512522-232512544 AGCTGTGGGCAGGGGTGGGCAGG + Intergenic
947889659 2:233605731-233605753 AGCTGAGGCTAGAGCTAGAGTGG + Intergenic
948048094 2:234958686-234958708 AGATGGGGGTAGGGGGAGAGGGG + Intronic
948334242 2:237195020-237195042 AGCTGTGGCTATGGGTGGGGAGG + Intergenic
948485691 2:238279476-238279498 AGCTGAGCCTGGGTGTAGGGTGG - Intronic
948597088 2:239087048-239087070 AGCTGAGGATCTGGGCAGGGTGG - Intronic
948721875 2:239905797-239905819 AGAGGAGGGGAGGGGAAGGGAGG + Intronic
948726001 2:239934361-239934383 GGCTGGGGGTGGGGGTGGGGAGG - Intronic
948806528 2:240455618-240455640 AGCTGAGAGAAGTGGTGGGGAGG + Intronic
948845336 2:240680331-240680353 AGGTAAGGGCAGGGGCAGGGTGG - Exonic
948848525 2:240694548-240694570 AGGTAAGGGCAGGGGCAGGGTGG + Exonic
948886784 2:240888739-240888761 AGGTGTGGGTAGGAGCAGGGAGG - Intronic
1168751687 20:286555-286577 AGGAGAGGGGAGGGGAAGGGAGG + Intronic
1169456669 20:5758323-5758345 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1169780409 20:9303335-9303357 GGCTGAGGGTAGGGGGAATGTGG - Intronic
1170116231 20:12863135-12863157 AGGGGATGGTAGTGGTAGGGTGG - Intergenic
1170220153 20:13933427-13933449 TGCTTAGGGCTGGGGTAGGGAGG - Intronic
1170375216 20:15692613-15692635 AGGTGAGGGCAGGGGTAGGGTGG + Intronic
1170836079 20:19885961-19885983 AGCGGAGGGGATGGGAAGGGTGG + Intergenic
1170990143 20:21293715-21293737 ACCTGAGGCTAGGGCTAGGGAGG + Intergenic
1171015519 20:21537594-21537616 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1171077863 20:22147392-22147414 GGTTGAGGGTAGTGGTAGTGAGG + Intergenic
1171769962 20:29314701-29314723 AGTTGGGGGTTGGGGGAGGGTGG + Intergenic
1171812680 20:29757882-29757904 AGTTGAGGGTTGGGGGAGGATGG + Intergenic
1171868699 20:30509098-30509120 GGCTGGGGGTGGGGGTAGGGGGG + Intergenic
1172170601 20:32929466-32929488 AGCGGAGGGGAGGGGAGGGGAGG - Intronic
1172408104 20:34704195-34704217 AGGGGAGGGGAGGGGCAGGGGGG + Intronic
1172614590 20:36274860-36274882 ACCTGTGGGTAGGGGGTGGGGGG + Intergenic
1172658070 20:36549056-36549078 ACCTGCGGGCAGGGGCAGGGTGG - Exonic
1172846620 20:37933472-37933494 AGCACAGGGTGGGGGTGGGGTGG - Intronic
1173016205 20:39228089-39228111 GGTTGGGGGTAGGGGGAGGGGGG - Intergenic
1173188612 20:40859777-40859799 AGCTGCTGGTAGTGGTGGGGAGG - Intergenic
1173257926 20:41408219-41408241 AGCTGGGGGTGGGGGTGGGGAGG + Intronic
1173380485 20:42535318-42535340 ACTTGAGGGTAGAGGGAGGGAGG + Intronic
1173614223 20:44392438-44392460 ATCTTGGGGTAGGGGTGGGGAGG - Intronic
1173632235 20:44525281-44525303 AGATGGGGGTGGGGGAAGGGTGG - Intergenic
1173836667 20:46130434-46130456 AGCAGAGGGGAGGGGAGGGGAGG + Intergenic
1174352827 20:49980740-49980762 AGATGTGGGTGGGGGTGGGGTGG + Intergenic
1174364536 20:50048545-50048567 AGCTGGGGGTAGGGGGAGCCGGG - Intergenic
1174398409 20:50262095-50262117 AGATGAGGGGAGGGGAGGGGAGG - Intergenic
1174520038 20:51122283-51122305 GGGTGAGGGTAGAGGCAGGGAGG - Intergenic
1174614407 20:51824929-51824951 AGTTGAGGTTAGGGGTGGGTGGG + Intergenic
1174835609 20:53853604-53853626 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1175047650 20:56122449-56122471 CGCTGGGGGTGGGGGTCGGGGGG - Intergenic
1175173188 20:57093891-57093913 AGCGCAGGGCAGGGGTGGGGTGG - Intergenic
1175389560 20:58618300-58618322 TCGTGAGGGTTGGGGTAGGGAGG - Intergenic
1175444528 20:59010836-59010858 AGGTGGGGGTGGGGGTTGGGAGG + Intergenic
1175755685 20:61528383-61528405 AGATGAGAGGAGGGGAAGGGAGG + Intronic
1175832715 20:61975631-61975653 AGCGGAGTGGAGGGGAAGGGAGG + Exonic
1176035401 20:63033889-63033911 GGCTGGGGGTGGGGGTGGGGTGG + Intergenic
1176037793 20:63048812-63048834 AGCGGAGGGGGCGGGTAGGGAGG + Intergenic
1176061857 20:63175984-63176006 AGCTAAGGGTGGGGGACGGGAGG + Intergenic
1176241429 20:64077497-64077519 TGCTGAGGGTGTGGGAAGGGGGG + Intronic
1176257014 20:64158146-64158168 AGGTGGGGGCAGGGGTAGGTGGG - Intronic
1176296999 21:5079080-5079102 AGCTGAGGGCAGGTGTGAGGAGG + Intergenic
1176371981 21:6067703-6067725 AGCTGGGGGCAGGGGTAATGGGG + Intergenic
1178275130 21:31230131-31230153 GGGTGAGGGTAGGGGCTGGGAGG - Intronic
1179455783 21:41498882-41498904 AGCTGAGGGTTGTGGGAGAGTGG + Intronic
1179647583 21:42784874-42784896 AGATGAGGGTGGGGGTGGGGTGG - Intergenic
1179730005 21:43362422-43362444 AGCTGATGTGGGGGGTAGGGGGG - Intergenic
1179751538 21:43470836-43470858 AGCTGGGGGCAGGGGTAATGGGG - Intergenic
1179860029 21:44182867-44182889 AGCTGAGGGCAGGTGTGAGGAGG - Intergenic
1180258681 21:46651327-46651349 GGCTGGGGGCCGGGGTAGGGAGG + Intronic
1180315374 22:11272959-11272981 AGTTGGGGGTTGGGGGAGGGTGG + Intergenic
1180740698 22:18051321-18051343 AGGAGAGGGGAGGGGAAGGGAGG + Intergenic
1181569107 22:23757613-23757635 AGGGGAGGGGAGGGGCAGGGGGG - Intergenic
1182248934 22:28984056-28984078 AGCTGAGGGCAGTGCTAGGCAGG + Intronic
1182506445 22:30786709-30786731 AGCAGAGGGTGGGGGTGGGGTGG + Intronic
1182615443 22:31585934-31585956 AGATGGAGGTACGGGTAGGGTGG - Intronic
1183031683 22:35111152-35111174 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1183123472 22:35751394-35751416 AGCAGAGGGTTGGGGGATGGCGG + Intronic
1183280719 22:36930634-36930656 AGCTGAGGGCAGGGAGAGGGAGG - Intronic
1183528072 22:38336087-38336109 AGCTGGGGGTAGGTGCTGGGAGG - Intronic
1183748985 22:39708629-39708651 GGCGGAGGGTAGGGTGAGGGGGG - Intergenic
1183868584 22:40723573-40723595 AGAAGAGGGTAGGGCCAGGGAGG + Intergenic
1183937521 22:41271884-41271906 AGCCCAGGGCAGGGGCAGGGTGG - Intronic
1184128778 22:42504953-42504975 AGCAGAGGGCAGGGCTAGGAGGG + Intergenic
1184137573 22:42558268-42558290 AGCAGAGGGCAGGGCTAGGAGGG + Intronic
1184333501 22:43840306-43840328 AGGTGAGGCCAGGAGTAGGGAGG + Intronic
1184399847 22:44267467-44267489 GGCTGAGGGTGGTGGTGGGGAGG - Intronic
1184730551 22:46368968-46368990 AGCTGAGGGGAGGGGGCTGGAGG - Intronic
1185309201 22:50144314-50144336 AGGGGAGGGCAGGGGTAGGAGGG + Intronic
949497427 3:4645721-4645743 AGGTGGAGGTAAGGGTAGGGTGG + Exonic
949947932 3:9204755-9204777 GGCTGGGGCTGGGGGTAGGGAGG - Intronic
950177533 3:10885783-10885805 TGCTGATGGCAGGGGGAGGGAGG - Intronic
950260986 3:11543409-11543431 AGCTGAGGGCTGAGGCAGGGGGG - Intronic
950402568 3:12781258-12781280 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
950929728 3:16776270-16776292 AGGGGAGGGTGGGGGAAGGGAGG + Intergenic
951134839 3:19093199-19093221 AGTTGGGGGTAGGGATATGGGGG - Intergenic
951149727 3:19274835-19274857 AGGGGAGGGGAGGGGTGGGGAGG - Intronic
951149748 3:19274870-19274892 AGGGGAGGGGAGGGGTGGGGAGG - Intronic
951523432 3:23630529-23630551 AGAGGAAGGGAGGGGTAGGGAGG + Intergenic
951854553 3:27180424-27180446 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
951927556 3:27925071-27925093 GCCTGGGGGTGGGGGTAGGGAGG + Intergenic
952456749 3:33479633-33479655 AGCTAAGGGTCGGGGCATGGTGG - Intergenic
952490458 3:33866472-33866494 GGCTGAGGGAAGGGGTATGAAGG - Exonic
952849123 3:37713397-37713419 AGCTGAGGGTTGGTGGAGGAGGG - Intronic
952852596 3:37741273-37741295 TGCTGGGGGTGGGGGTGGGGTGG - Intronic
952853960 3:37752384-37752406 GGCTGAGAGTGGGGGTGGGGAGG - Intronic
952913098 3:38207901-38207923 AGGGGAGGGGAGGGGGAGGGGGG - Intronic
952993608 3:38855396-38855418 AGGTGAGGGCAGGGTTAGGCAGG - Intronic
953230568 3:41061543-41061565 ACTTGAGGGTAGGGGGTGGGAGG - Intergenic
953230626 3:41062017-41062039 ACTTGAGGGTAGGGGGCGGGAGG - Intergenic
953329815 3:42043491-42043513 GGCTGGGGGTAGGGGTGGAGGGG - Intronic
953752676 3:45621194-45621216 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
954013371 3:47663183-47663205 AGGGGAGGGGAGGGGTGGGGAGG + Intronic
954031943 3:47825744-47825766 AGCTGAAGGTGGGGGCGGGGTGG + Intronic
954142243 3:48614146-48614168 AGCAGTGGGTATAGGTAGGGAGG - Intergenic
954145383 3:48631855-48631877 GAGTGAGGGTAGGGGGAGGGAGG - Intronic
954156915 3:48690480-48690502 AGGGGAGGGGAGGGGCAGGGAGG + Intronic
954263637 3:49457417-49457439 TGCTTAGGGTAGGGTGAGGGTGG + Intergenic
954294982 3:49669419-49669441 GGCTCAGGGTTGGGGTAGGAAGG - Exonic
954344652 3:49986748-49986770 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
954392648 3:50275624-50275646 GGCTGAGGGTAGGGGCAGCTGGG - Intronic
954656774 3:52198631-52198653 AAATGAGGGTAGGGGTATGAGGG - Intronic
954688294 3:52382469-52382491 AGCAGAGGGCAGGGCTCGGGGGG + Intronic
955006113 3:54970482-54970504 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
955006145 3:54970570-54970592 AGAGGAGGGGAGGGGAAGGGAGG - Intronic
955225790 3:57059503-57059525 AGTTGGGGGTGGGGGGAGGGAGG + Intronic
955286328 3:57644772-57644794 AGGGGAGGGGAGGGGTGGGGAGG + Intronic
956097724 3:65734880-65734902 AGGTGAGGGGAGGAGAAGGGAGG + Intronic
957078779 3:75620313-75620335 AGCAGTGGGTGGGGGGAGGGAGG - Intergenic
958619264 3:96534772-96534794 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
958881056 3:99670758-99670780 GGCTGAGGGTATGGGGAGGGAGG - Intronic
959006004 3:101020587-101020609 AGATGTGGGGAGGGGTAGGTTGG + Intergenic
959204513 3:103288144-103288166 ATCTGAGGGGAGGGGTAAGAGGG - Intergenic
959243411 3:103830031-103830053 GGGTGAGGGAAGGGGAAGGGAGG - Intergenic
959260863 3:104077731-104077753 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
959591721 3:108089993-108090015 AGCTCGGGGTGGGGGTGGGGGGG + Intronic
959698372 3:109273984-109274006 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
959784414 3:110276656-110276678 AGATGAGGGGAGGGGAAGGGAGG - Intergenic
959809113 3:110594428-110594450 AGCAGGGGGTAGGGGTAGAATGG + Intergenic
960101568 3:113747469-113747491 AGCTGAGGGTAAGGACAGTGAGG - Intronic
960351303 3:116596624-116596646 AGCTGAGAGATGGGGTAGTGGGG - Intronic
960699453 3:120426337-120426359 AGCTGGGGGTGGGTGGAGGGTGG - Intronic
960952037 3:123005616-123005638 GGCTGAGGTTGAGGGTAGGGAGG + Intronic
961049467 3:123734231-123734253 TGGTGAGGGTGGGGGTAGGGTGG + Intronic
961330333 3:126134570-126134592 AGATTAGGGTTGGGGCAGGGAGG - Intronic
961511583 3:127407023-127407045 AGGAGAGGGCAGGGGCAGGGCGG - Intergenic
961669510 3:128518793-128518815 AGATGGGGGTGGGAGTAGGGAGG - Intergenic
961709751 3:128819071-128819093 AGCTGAGGAGAGGGGTTGAGAGG - Intergenic
962072235 3:132044741-132044763 AGGGGAGGGGAGGGGGAGGGAGG + Intronic
962072301 3:132044870-132044892 AGGGGAGGGGAGGGGGAGGGGGG + Intronic
962278131 3:134030658-134030680 TGCTGGGGGGAGGGGTAGAGGGG + Intronic
962408167 3:135117936-135117958 AGGTGAGGGCTGGGGTGGGGTGG + Intronic
962478328 3:135777354-135777376 ACTTGAGGGTAGAGGTGGGGAGG + Intergenic
963626424 3:147679383-147679405 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
963638725 3:147832915-147832937 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
964148684 3:153497756-153497778 AGCTGAGGGGAGAGGGAGGAGGG - Intronic
964376378 3:156052236-156052258 AGGGGAGGGTGGGGGTGGGGTGG - Intronic
965755183 3:172018502-172018524 AGTTCAGGGAAGGGGTAGGGTGG + Intergenic
966102209 3:176284352-176284374 AGCTGATGAAAGGGGTAGAGAGG + Intergenic
966479772 3:180393961-180393983 ATCTCCGGGTGGGGGTAGGGGGG - Intergenic
966553416 3:181230629-181230651 AGCTGGGGGCAGGGCTAGGTGGG + Intergenic
966807036 3:183815722-183815744 GGGTGAGGGTAGGGGACGGGTGG + Intergenic
967774085 3:193367999-193368021 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
967873666 3:194251929-194251951 TGCTGTGGGGAGGGGGAGGGGGG + Intergenic
967909275 3:194527854-194527876 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
968361825 3:198152668-198152690 AGCTGAGGGAAGGAGATGGGAGG - Intergenic
968542091 4:1172875-1172897 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
968600442 4:1506204-1506226 ACCTGAGAGCAGGGGGAGGGTGG - Intergenic
968611361 4:1558627-1558649 AGCGGAGGGGAGGGGAGGGGAGG + Intergenic
968620121 4:1600190-1600212 AGCTGAGGGCTGGGGCAGGAGGG + Intergenic
968650989 4:1760216-1760238 AGCTCAGGGTAGGAGCAGGTAGG + Intergenic
969021859 4:4144281-4144303 AGCAGTGGGTGGGGGAAGGGAGG - Intergenic
969454808 4:7294944-7294966 AGAGGAGGGGAGGGGGAGGGGGG - Intronic
969475955 4:7422531-7422553 AGCTGGGGGCAGAGGTGGGGTGG + Intronic
969551010 4:7867129-7867151 AGCGGAGGGGAGGGGAGGGGAGG + Intronic
969662988 4:8541138-8541160 AGCTGAGGCACGGGGTGGGGAGG + Intergenic
969669059 4:8579772-8579794 AGGTGAGGGTGGGTGTGGGGAGG + Intronic
969732008 4:8963134-8963156 AGCAGTGGGTGGGGGAAGGGAGG + Intergenic
970199285 4:13586348-13586370 AGTTTTGGGTGGGGGTAGGGAGG - Intronic
971024571 4:22575936-22575958 AGTTCAGGGTAGGGCGAGGGGGG + Intergenic
971045574 4:22801710-22801732 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
971296728 4:25400464-25400486 AGCTGAGAGTAAGGATGGGGAGG + Intronic
972127571 4:35789071-35789093 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
972142070 4:35973265-35973287 AGAGGAGGGGAGGGGAAGGGAGG + Intronic
972168073 4:36311459-36311481 GGGTGAGGGTGGGGGTGGGGAGG - Intronic
972328273 4:38039007-38039029 ACCTGGGGGAAGGGGTAGTGAGG - Intronic
972348488 4:38213408-38213430 AGGTGATGGTAGAGGTAGGAAGG + Intergenic
972565520 4:40265672-40265694 AGCAGAGGGAAGGGAGAGGGAGG + Intergenic
972647041 4:40978678-40978700 AACTGAGGATAGGGATAGGAAGG - Intronic
973532998 4:51851553-51851575 AGCTGGTGGCAGGGGTGGGGTGG + Intronic
973761041 4:54116078-54116100 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
973982488 4:56317751-56317773 GGGTGAGGGTAGGGGGTGGGTGG - Intronic
974482973 4:62470275-62470297 AGGGGAGGGGAGGGGGAGGGGGG - Intergenic
975372795 4:73607839-73607861 AGTAGAGAGGAGGGGTAGGGAGG - Intronic
975504500 4:75123053-75123075 AGATGAGGGTAGGGGAGAGGAGG + Intergenic
976217784 4:82731150-82731172 AGCTGGGGGTAGGGGCAGAGAGG + Intronic
976221806 4:82762180-82762202 AGGAGAGGGGAGGGGAAGGGAGG + Intronic
976751681 4:88456384-88456406 GGGTGGGGGTAGGGGTGGGGGGG + Intergenic
976753766 4:88477307-88477329 AGGGGAGGGAAGGGGAAGGGAGG + Intronic
977258244 4:94764264-94764286 AGCAGAGAGTAGAGGGAGGGTGG + Intronic
977321210 4:95518963-95518985 AGCTCAGAGTTGGGGTTGGGAGG + Intronic
977398721 4:96504144-96504166 AGTTGAGAGTATGGGTAGTGGGG - Intergenic
977997972 4:103517645-103517667 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
978157758 4:105509287-105509309 AGGGGAGGGAAGGGGAAGGGAGG + Intergenic
978291789 4:107150553-107150575 AGGGGAGGGGAGGGGCAGGGAGG + Intronic
978347588 4:107788161-107788183 AGCAGAGGGTTGGGGGGGGGGGG + Intergenic
979730548 4:124018359-124018381 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
979784483 4:124698452-124698474 AGCTAAGAGTAAGGGTTGGGAGG + Intronic
980187046 4:129475395-129475417 AGGTGGGGGCAGGGTTAGGGAGG + Intergenic
980202556 4:129675341-129675363 TGGTGGGGGTAGGGGTAGGGAGG - Intergenic
980600042 4:135011171-135011193 AGCAGAGGGTAAGGTGAGGGAGG - Intergenic
981177852 4:141702872-141702894 AGGTGAGGGCAGGGTTAGGTGGG + Intronic
981493329 4:145364706-145364728 AGTTGAGGGTGGGGGTAGACTGG + Intergenic
981624742 4:146742701-146742723 AGGGGAGGGAAGGGGAAGGGGGG - Intronic
982541166 4:156673545-156673567 AGCTTAGGGTGAGGGTAGCGGGG - Intergenic
983012525 4:162564837-162564859 AGGGGAGGGGAGGGGTGGGGAGG + Intergenic
983713498 4:170749238-170749260 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
983764663 4:171463700-171463722 GGTGGAGGGTAGGGGGAGGGAGG + Intergenic
985937204 5:3106449-3106471 AGCAGAGGGAAGGGTAAGGGAGG - Intergenic
985938800 5:3117355-3117377 GGCTGAGTGTAGGGATAGTGTGG + Intergenic
986026765 5:3858406-3858428 TGCTGAGGGAAGGGGTCAGGAGG + Intergenic
986300564 5:6475650-6475672 AGCCAAGGGAAGGGGTAGGAAGG + Intronic
986330024 5:6711165-6711187 AGGTGAGGGCAGGGGAAGAGGGG + Intergenic
987047736 5:14123489-14123511 AGCTGAGGGAGGGGGTGGGATGG + Intergenic
987079802 5:14416745-14416767 GGCTGCGGGTGGGGGAAGGGTGG - Intronic
987796350 5:22632057-22632079 AGCAGAGGGTAGAGGTTGGGAGG + Intronic
988910088 5:35830857-35830879 AGATGTGGGTAGTGGTAGGGAGG - Intergenic
989164757 5:38423427-38423449 AGGTGGGGGTAGGGGAGGGGAGG - Intronic
989530283 5:42499981-42500003 AGTGGAGGGGAGGGGAAGGGAGG - Intronic
989602135 5:43210154-43210176 ACCAGAGGGGAGGGGAAGGGAGG + Intronic
990091540 5:52057193-52057215 AGTTGAGGGTGGAGGTTGGGAGG - Intronic
990426445 5:55694706-55694728 AGCGGAGGGGAGGGGAGGGGAGG - Intronic
990776171 5:59308650-59308672 TGCAGGGGGTAGGGGTTGGGGGG + Intronic
991007504 5:61844194-61844216 AAGTGGGGGTGGGGGTAGGGAGG + Intergenic
991540287 5:67720420-67720442 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
991598522 5:68329022-68329044 GGCGGAGGGTAGGAGGAGGGAGG + Intergenic
991994465 5:72373785-72373807 AGCTGGGGGTAGGTGTGGGTGGG - Intergenic
993275898 5:85858219-85858241 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
993929660 5:93922590-93922612 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
994526004 5:100904969-100904991 GGCTGAGGGCAGGGGTCGGGTGG + Intergenic
995002292 5:107148825-107148847 AGCGGAGGGGAGGGGAGGGGAGG + Intergenic
995154833 5:108898570-108898592 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
995506279 5:112863550-112863572 GTGTGTGGGTAGGGGTAGGGAGG + Intronic
995653369 5:114396870-114396892 ACCTGAGGGTAGAGGGTGGGAGG - Intronic
996367336 5:122716784-122716806 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
996588749 5:125121492-125121514 ACTTGAGGGTAGAGGTTGGGAGG - Intergenic
997119234 5:131157232-131157254 TGTTGAGGGAAGGTGTAGGGAGG - Intergenic
997160214 5:131600583-131600605 AGGAGAGGGGAGGGGAAGGGAGG + Intronic
997468682 5:134104548-134104570 TGCTGGGGGTAGGGAGAGGGAGG + Intergenic
997509755 5:134446105-134446127 AGCTGGGGATGGGGGTAAGGAGG + Intergenic
997679926 5:135743000-135743022 AGGGGAGGGAAGGGGAAGGGAGG - Intergenic
997907199 5:137830050-137830072 TGCTGGGGGTAGGGGTAGTAGGG - Intergenic
997952348 5:138252612-138252634 AGATTAGGGTTAGGGTAGGGAGG - Exonic
997976300 5:138443480-138443502 AGATGAGAGTAGGGCAAGGGTGG + Intronic
998134920 5:139669506-139669528 TGCTGGGTCTAGGGGTAGGGTGG - Intronic
998142784 5:139709521-139709543 CGCTGAGGGGAGGGGTTGTGGGG + Intergenic
998226936 5:140334404-140334426 AGGAGAGGGGAGGGGAAGGGAGG + Intronic
998507687 5:142685313-142685335 AGCTCAGGGTTTTGGTAGGGTGG - Intronic
998568187 5:143234560-143234582 AGGTGAGGGGAGAGGCAGGGTGG - Intergenic
998666847 5:144307410-144307432 TGCTGAGGGTGGGGGTATGGAGG - Intronic
998692902 5:144606858-144606880 ACTTGAGGGTAGAGGTAGGGAGG - Intergenic
998846299 5:146313538-146313560 AGGTGAGGGAAAGGGTTGGGAGG - Intronic
999295776 5:150458781-150458803 TGCTGAGGGGAGGGGGTGGGTGG + Intergenic
999522431 5:152364382-152364404 GTCAGAGGGTAGGGGTTGGGAGG + Intergenic
999698951 5:154210490-154210512 GGCTGAGGGTTGGGGTAGAAGGG - Intronic
999824819 5:155263904-155263926 ATCTTAGGGTATGGGGAGGGAGG + Intergenic
1000002447 5:157151807-157151829 GGCTGAAAGTAGGGGTAGAGTGG - Intronic
1000179912 5:158798872-158798894 TGCTGAGTGTAGAGGTAGGAGGG - Intronic
1000455179 5:161439820-161439842 TGGTGGGGGTAGGGGGAGGGAGG + Intronic
1001344741 5:170883606-170883628 AGATCAGGGTTGGGGGAGGGTGG - Intronic
1001582337 5:172807370-172807392 AGCTAATGGGAGGGGCAGGGCGG - Intergenic
1001711507 5:173782376-173782398 AACAGAGGGCAGGGGCAGGGAGG - Intergenic
1001731614 5:173964513-173964535 GGGTGAGGGTTGGGGTGGGGTGG + Intergenic
1001731643 5:173964573-173964595 GGGTGAGGGTTGGGGTGGGGTGG + Intergenic
1001999501 5:176189713-176189735 AGCTGAGGTTTGGGGGAAGGAGG + Intergenic
1002060915 5:176625565-176625587 AGCTGAGGCTGGGGGTAGGTGGG + Intronic
1002186594 5:177457569-177457591 AGCGGTGGGTAGTGGTGGGGTGG + Intronic
1002309842 5:178307679-178307701 AGGTGAGGGGAGGGAGAGGGAGG - Intronic
1002527331 5:179821815-179821837 TGCTGGGGGTGGGGTTAGGGAGG + Intronic
1002636547 5:180611619-180611641 GGCTGAGGGCAGGGCGAGGGCGG - Intronic
1002649669 5:180682192-180682214 AGCTGAGGTTTGGGGGAAGGAGG - Intergenic
1002697088 5:181098550-181098572 AGGCGAGGGGAGGGGTGGGGAGG + Intergenic
1002697106 5:181098585-181098607 AGGCGAGGGGAGGGGTGGGGAGG + Intergenic
1002697141 5:181098650-181098672 AGGCGAGGGGAGGGGTGGGGAGG + Intergenic
1002697154 5:181098675-181098697 AGGGCAGGGGAGGGGTAGGGAGG + Intergenic
1003248494 6:4404028-4404050 AGCTGAGGGTGGGGACAAGGAGG + Intergenic
1003289519 6:4767589-4767611 AGATGAGGGGAGGGGAGGGGAGG + Intronic
1003671860 6:8166588-8166610 AGGGGAGGGAAGGGGTAAGGAGG - Intergenic
1003735752 6:8876093-8876115 AGCTGGGGCTGGGGGCAGGGCGG + Intergenic
1003945398 6:11070857-11070879 AGCTGAAGAGAGGGGTAGGCTGG + Intergenic
1004542537 6:16564695-16564717 AGCTGAGGGTAGAGGATTGGGGG + Intronic
1004805269 6:19197457-19197479 ACATGAGGGTAGGGGTTGGGAGG - Intergenic
1005067229 6:21830465-21830487 AGGAGAGGGGAGGGGAAGGGAGG - Intergenic
1005821542 6:29603526-29603548 AAGTGAGGGTAGGGTGAGGGAGG - Exonic
1006320494 6:33316830-33316852 AGCTGCTGGCAGGGGTAGTGGGG + Exonic
1006595778 6:35191879-35191901 AGCTGAGGGAAGGGGGTGAGAGG - Intergenic
1007259760 6:40555305-40555327 AGCTGAGGGTTGCGGTGGGGAGG + Intronic
1007271409 6:40640405-40640427 AGGTGGAGGTGGGGGTAGGGGGG - Intergenic
1007745811 6:44042392-44042414 AGCAGAGGGGAGGGGAGGGGAGG + Intergenic
1007818135 6:44539278-44539300 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1008286198 6:49654090-49654112 AGCGGAGGGGAGGGGAGGGGAGG - Intergenic
1008460621 6:51765503-51765525 GGCCTAGGGTGGGGGTAGGGGGG - Intronic
1008972903 6:57390536-57390558 ACCTGAGGGTGGAGGTTGGGAGG - Intronic
1009161812 6:60292099-60292121 ACCTGAGGGTGGAGGTTGGGAGG - Intergenic
1009441780 6:63688320-63688342 AGAGGAGGGGAGGGGAAGGGAGG - Intronic
1009556920 6:65182053-65182075 TGTTTTGGGTAGGGGTAGGGGGG + Intronic
1009826713 6:68875259-68875281 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1010004535 6:70981123-70981145 AGCGGAGGGGAGGGGAGGGGAGG + Intergenic
1010004570 6:70981228-70981250 AGCGGAGGGGAGGGGAGGGGAGG + Intergenic
1010023280 6:71186496-71186518 ACTTGAGGGTAGGGGTTGGGAGG + Intergenic
1010116443 6:72317061-72317083 AGAGGAGGGCAGGGGTGGGGTGG + Intronic
1010507221 6:76675405-76675427 ATTTGAGGGTAGAGGGAGGGAGG - Intergenic
1010773677 6:79861330-79861352 AGCTGGGGGGCGGGGTGGGGAGG + Intergenic
1010960839 6:82143970-82143992 AGCAGAGGGGAGGGGAAGGGAGG + Intergenic
1011114350 6:83874150-83874172 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1012029832 6:94044882-94044904 GACTGAGGGTAGGGGAATGGAGG + Intergenic
1012559170 6:100557698-100557720 AGAGGATGGGAGGGGTAGGGTGG + Intronic
1012568082 6:100685268-100685290 AGCTGAGGCTTGGGGTAGGGAGG + Intronic
1012577150 6:100816748-100816770 ACCTGAGGGTAGAGGGTGGGAGG + Intronic
1013299990 6:108796002-108796024 ATCTCTGGGGAGGGGTAGGGTGG - Intergenic
1013372573 6:109483313-109483335 AGCGGCGGGGAGGGGAAGGGAGG + Intergenic
1013474814 6:110497450-110497472 AGCTGAGAGTGGCGGTGGGGCGG + Intergenic
1013589766 6:111610179-111610201 AATGGAGGGTAGGGGTTGGGGGG - Intergenic
1013988852 6:116229629-116229651 TGCTGAGGGTGGGGATACGGGGG + Intronic
1015556796 6:134470842-134470864 AGGAGAGGGGAGGGGAAGGGAGG - Intergenic
1015846142 6:137522854-137522876 AGGTGGGGGCGGGGGTAGGGGGG - Intergenic
1016017912 6:139204985-139205007 AGGTGAGGGCAGGGTTAGGCAGG - Intergenic
1016389034 6:143556996-143557018 AACTGAGGCTGGGGTTAGGGAGG - Intronic
1016504629 6:144765034-144765056 AGATGAGGGTAGGGTTGGGTGGG + Intronic
1016623496 6:146139931-146139953 AGGGGAGGGCAGGGGAAGGGAGG - Intronic
1016848507 6:148593113-148593135 AGCAGAGGGTAGGGCTTGGAAGG + Intergenic
1016943431 6:149503948-149503970 GGGTGGGGGTTGGGGTAGGGTGG + Intergenic
1017038610 6:150289413-150289435 AGCTGAGGGTGAGGGAAGAGGGG + Intergenic
1017151133 6:151281842-151281864 AGCTGGGTGTTGGGGAAGGGAGG - Intronic
1017293251 6:152765625-152765647 AGGAGAGGGGAGGGGAAGGGAGG - Intergenic
1017332743 6:153218479-153218501 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1017570042 6:155734431-155734453 AGCTGAGGGTTGGGAAGGGGTGG + Intergenic
1017805226 6:157939953-157939975 AGTTGGGGGCAGGGGCAGGGGGG + Intronic
1017876472 6:158529136-158529158 AGCGGAAGGGAGGGGAAGGGAGG - Intergenic
1017929947 6:158943711-158943733 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1017929966 6:158943746-158943768 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1017929993 6:158943796-158943818 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1017988977 6:159469923-159469945 AGATGAGGGAAGAGGAAGGGAGG + Intergenic
1018001448 6:159582014-159582036 ACCTGAGGGTAGAGGGTGGGAGG + Intergenic
1018016564 6:159717708-159717730 TGGAAAGGGTAGGGGTAGGGAGG - Intronic
1018429727 6:163713479-163713501 AGGAGAAGGTGGGGGTAGGGAGG - Intergenic
1018981765 6:168606976-168606998 AGCTGAGTGGAGGGGAAGCGAGG + Intronic
1019117596 6:169777772-169777794 AGCTGTGGGTGGGGGGAAGGGGG - Intronic
1019253858 7:36054-36076 AGCTGAGGGAAGGAGATGGGAGG + Intergenic
1019377025 7:698021-698043 AGCGGAGGGGAGGGGAGGGGAGG + Intronic
1019381816 7:727776-727798 AGGTGAGGGTCGCGGGAGGGCGG - Intronic
1019514812 7:1434983-1435005 AGCTGGGGGTGGGGGGGGGGCGG - Intronic
1020041094 7:5002277-5002299 TGGTGAGGGTGGGGGAAGGGCGG - Intronic
1020309280 7:6856311-6856333 AGCAGTGGGTGGGGGAAGGGAGG - Intergenic
1020708090 7:11570787-11570809 AGCAGTGGGTAGGGGTGGAGAGG + Intronic
1020726323 7:11820019-11820041 GGGTGGGGGCAGGGGTAGGGTGG - Intronic
1020877176 7:13712545-13712567 ACCTGAGGGTGGAGGAAGGGAGG + Intergenic
1021271598 7:18594139-18594161 TGCTGGGGGCAGGGGTGGGGAGG - Intronic
1021694336 7:23261627-23261649 GTCGGGGGGTAGGGGTAGGGAGG + Intronic
1021890185 7:25180006-25180028 AGCTGCGGGGAGGGGAGGGGAGG - Intronic
1022102230 7:27175407-27175429 AGCTGAGGGTATGGGAGGGAGGG - Intronic
1022332300 7:29391351-29391373 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1022510806 7:30933783-30933805 AGCAGAGGGTAGGGGCGGTGTGG - Intergenic
1022560091 7:31338622-31338644 AGCTCAGGGCTGTGGTAGGGTGG + Exonic
1022567308 7:31416160-31416182 AGCTGAGGGTATGAGTAAGATGG - Intergenic
1022801245 7:33779488-33779510 AGCTCAGTGTAGGGGGAAGGGGG + Intergenic
1023062643 7:36343368-36343390 AGAGGAGGGGAGGGGAAGGGAGG + Intronic
1023513292 7:40976061-40976083 AGCTGAGGGTCAGGGTTGGATGG + Intergenic
1023858515 7:44201350-44201372 GGCCAAGGGTAGGGGCAGGGCGG + Intronic
1023982995 7:45080466-45080488 AGCTGAGGGAAGGCGTAGGATGG + Exonic
1024158115 7:46647147-46647169 AGCTGATGGTTTGGTTAGGGAGG - Intergenic
1024171385 7:46791235-46791257 AGGAGAGGGAAGGGGAAGGGAGG + Intergenic
1024471301 7:49770805-49770827 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1024471312 7:49770825-49770847 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1024771062 7:52723920-52723942 GCCGGGGGGTAGGGGTAGGGGGG - Intergenic
1025198686 7:56949375-56949397 AGGGGAGAGGAGGGGTAGGGAGG - Intergenic
1025673262 7:63627556-63627578 AGGGGAGAGGAGGGGTAGGGAGG + Intergenic
1026040757 7:66865942-66865964 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1026040769 7:66865967-66865989 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1026060241 7:67019275-67019297 AGCTGGGGGAAGGGTTGGGGAGG - Intronic
1026155002 7:67818909-67818931 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1026406644 7:70073031-70073053 AGGAGAGGGGAGGGGAAGGGAGG - Intronic
1026406656 7:70073056-70073078 AGGAGAGGGGAGGGGAAGGGAGG - Intronic
1026477747 7:70751242-70751264 AGCAGAGGGCAGCGGTAGGAAGG + Intronic
1026487767 7:70836117-70836139 AGCTGCTGGTAGAGGTAGGAAGG - Intergenic
1026857327 7:73763338-73763360 AGGAGAGGGGAGGGGAAGGGAGG - Intergenic
1027029845 7:74880052-74880074 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1027222650 7:76223891-76223913 AGGGGAGGGAAGGGGTGGGGAGG - Intronic
1027404612 7:77846608-77846630 AGGGGAGGGAAGGGGAAGGGAGG - Intronic
1028052745 7:86206712-86206734 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1028328618 7:89559702-89559724 AGAGGAGGGGAGGGGTGGGGAGG + Intergenic
1028443840 7:90895535-90895557 AGGAGAGGGGAGGGGAAGGGAGG - Intronic
1028454901 7:91027912-91027934 AGCGGAGGGGAGGGGAGGGGAGG - Intronic
1028638338 7:93016040-93016062 AGCAAAGGGAAGGGGGAGGGAGG - Intergenic
1029537611 7:101165401-101165423 AGAGGAGGGTCGGGGCAGGGTGG + Exonic
1029640205 7:101815742-101815764 CGCGGAGGGGAGGGGGAGGGCGG + Intergenic
1030028221 7:105345191-105345213 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1030191712 7:106817190-106817212 CACTGGGGGTGGGGGTAGGGAGG - Intergenic
1030793000 7:113752498-113752520 AGCAGCAGGTAGGGGTGGGGAGG - Intergenic
1031361800 7:120857320-120857342 AGCTGCGGGACGGGGTAGAGGGG - Intronic
1031919737 7:127591798-127591820 AGCTGAGGGTATGTGTGGGTGGG - Intronic
1032625004 7:133582122-133582144 ACTTGAGGGTAGAGGGAGGGAGG - Intronic
1032913428 7:136460153-136460175 AGCTGAGAGTAGGGGCAGAGAGG + Intergenic
1033092838 7:138402848-138402870 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1033439636 7:141367081-141367103 AGCAGGGGGGAGGGGTGGGGGGG + Intronic
1033502376 7:141965251-141965273 AGAAAAGGGTGGGGGTAGGGGGG - Intronic
1033641132 7:143264010-143264032 AGCCGAGGGAAAGGGAAGGGAGG - Intronic
1033802774 7:144920346-144920368 GGGTGAGGGGAGGGGGAGGGGGG + Intergenic
1033912762 7:146285720-146285742 AGGCGAGGGGAGGGGAAGGGAGG - Intronic
1033912804 7:146285804-146285826 AGGCGAGGGGAGGGGAAGGGAGG - Intronic
1033912855 7:146285905-146285927 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1033969782 7:147025344-147025366 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1034033845 7:147799287-147799309 AGATGAGGTGAGGGGTAGAGGGG + Intronic
1034065800 7:148135852-148135874 AGCAGAGGGGAGGGGAGGGGGGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034091783 7:148370634-148370656 AGGGAAGGGCAGGGGTAGGGGGG - Intronic
1034272335 7:149809290-149809312 AGCTCTGGGTATGGGTGGGGTGG - Intergenic
1034419116 7:150979708-150979730 AGGTGAGAGTCCGGGTAGGGTGG - Intergenic
1034653836 7:152712991-152713013 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1034890540 7:154835340-154835362 AGATGAAGGTGGGGGCAGGGCGG - Intronic
1035142102 7:156772858-156772880 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1035332444 7:158105180-158105202 AGCTGAGGGTGAAGCTAGGGTGG - Intronic
1035385600 7:158470554-158470576 AGCAAAGGGTGGGGGTAGGAAGG + Intronic
1035436375 7:158863113-158863135 GGCTGGGGGTGGGGGGAGGGGGG + Intronic
1035650675 8:1261545-1261567 AGCCGAGGGTGGGGGTGGGAGGG + Intergenic
1036222122 8:6929741-6929763 GGCTGAGGGGAGGGACAGGGCGG - Intergenic
1036224395 8:6945457-6945479 GGCTGAGGGGAGGGGCAGGGTGG - Intergenic
1036236498 8:7043556-7043578 GGCTGAGGGGAGGGACAGGGTGG - Intergenic
1037118816 8:15258387-15258409 AGGCGAGGGGAGGGGAAGGGAGG - Intergenic
1037362739 8:18091125-18091147 AGCTGAGGGCAGGGTGAGGATGG - Intergenic
1037445017 8:18956821-18956843 AGAGGAGATTAGGGGTAGGGAGG - Intronic
1037478106 8:19277585-19277607 AGCTGAGGGTGGGGGCTGGATGG - Intergenic
1037604228 8:20423849-20423871 AGCTGAAGGAAGGGCTGGGGCGG + Intergenic
1037676442 8:21055008-21055030 AGATGAGGGTGAGGGAAGGGTGG + Intergenic
1037804507 8:22051546-22051568 AGCTGAGGGCAGGCCGAGGGGGG - Intronic
1037818143 8:22122607-22122629 AGCTGGGGGTGGGGGTGGGCAGG + Exonic
1038044149 8:23751990-23752012 ATCTGTGGGAAGGGGAAGGGTGG + Intergenic
1038297196 8:26305071-26305093 AGCTGAGGGGAGGGGAAGAAGGG - Intronic
1038317781 8:26502344-26502366 AGGGGAGGGGAGGGGAAGGGAGG - Intronic
1038954117 8:32448759-32448781 GGCTGAGGGCAGTGGCAGGGGGG - Intronic
1039232159 8:35460221-35460243 TGCTGAGAATGGGGGTAGGGGGG + Intronic
1039506707 8:38057403-38057425 GGGTGAGAGTAGGGGTGGGGAGG + Intronic
1039921315 8:41896281-41896303 TGCTGGGGGCAGGGGTCGGGCGG - Intronic
1039922508 8:41903403-41903425 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1040550349 8:48432616-48432638 AGCACAGGACAGGGGTAGGGTGG - Intergenic
1040553041 8:48453425-48453447 TGCTGTGGGCAGGGGTGGGGGGG + Intergenic
1040580412 8:48694324-48694346 AGCTGAGGGGAGGGGCATGAAGG - Intergenic
1041628153 8:60054963-60054985 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1041652491 8:60314650-60314672 GGTTGGGGGTAGGGGTAGGAGGG - Intergenic
1042695286 8:71548160-71548182 GGCTGTGGGTGGGGGTACGGGGG - Intronic
1042953038 8:74220613-74220635 AGCTGAGGGTATGTGTGTGGTGG + Intergenic
1043053920 8:75413332-75413354 AGGGGAGGGGAGGGGTGGGGAGG + Intronic
1043147787 8:76678325-76678347 GGCTGAGGGAAGGGGCAGAGAGG - Intergenic
1043375656 8:79646635-79646657 AGCTGAGAGCAGGGGGAGAGTGG + Intronic
1043541190 8:81264538-81264560 ATCGGAGGGTAGAGGTTGGGAGG + Intergenic
1044013649 8:87025059-87025081 AGCTGGGCGTCTGGGTAGGGTGG + Intronic
1044610615 8:94088456-94088478 ACCTGGGGGAAGGGGTAGTGTGG - Intergenic
1044767936 8:95597111-95597133 AGGGGAGGGGAGGGGGAGGGAGG - Intergenic
1044782035 8:95753051-95753073 GGGTGAGGGTAGGGGTGGTGGGG - Intergenic
1044904763 8:96989424-96989446 AGCGGAGGGAAGGGGAGGGGAGG + Intronic
1044954131 8:97462215-97462237 GGCTGAGGGTTGGGGTGTGGTGG - Intergenic
1045127786 8:99113044-99113066 AACAGAGGGGAGGGGAAGGGTGG - Intronic
1045264479 8:100607456-100607478 GGCTGGGGGTAGGAGTAGGTAGG + Intronic
1045478033 8:102569658-102569680 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1045922171 8:107544322-107544344 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1046029893 8:108770883-108770905 TGTGGAGGGTAGGGGTAGGAAGG - Intronic
1046048196 8:108987978-108988000 ACTTGAGGGTAGAGGGAGGGAGG + Intergenic
1046380512 8:113444228-113444250 AGGGGAGGGGAGGGGTGGGGAGG - Intergenic
1046380524 8:113444248-113444270 AGGGGAGGGGAGGGGTGGGGAGG - Intergenic
1047237208 8:123052249-123052271 AGGGGAGGGGAGGGGAAGGGAGG + Intronic
1047300767 8:123612093-123612115 AGGGGAGGGGAGGGGGAGGGGGG - Intergenic
1047478655 8:125259509-125259531 TGGTGGGGGCAGGGGTAGGGAGG - Intronic
1047526434 8:125638131-125638153 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1047675730 8:127199170-127199192 ACCTGAGGGTGGAGGTTGGGAGG + Intergenic
1047919130 8:129615108-129615130 AGGTGAGGGATGGGGTAGGCAGG - Intergenic
1049165584 8:141123613-141123635 AGCTGGGGGTGAGGGAAGGGAGG + Intronic
1049205907 8:141363549-141363571 AGCTGTGGGTGAGGGCAGGGAGG - Intronic
1049440434 8:142607165-142607187 AGGAGAGGGGAGGGGAAGGGAGG + Intergenic
1049513021 8:143039320-143039342 AGCTGAGGCTGGGGGTTGTGAGG - Exonic
1049580763 8:143409518-143409540 GGGTGAGCGGAGGGGTAGGGAGG + Intergenic
1049609967 8:143550342-143550364 AGATGGGGTTAGGGGTGGGGTGG - Intergenic
1049651862 8:143773534-143773556 GGGTGAGGTTAGGGGTGGGGTGG - Intergenic
1049672225 8:143875042-143875064 AGCTGAGGGTAGGTGGGAGGAGG - Intronic
1049758373 8:144320775-144320797 AGCTGAGGGAAGGGGCCAGGAGG + Intronic
1049791528 8:144474700-144474722 AGAAGAGGGAAGGGGTGGGGTGG + Exonic
1050295217 9:4197454-4197476 AGTTGGGGGTGGGGGCAGGGGGG - Intronic
1050309625 9:4339806-4339828 AGGGGAGGGGAGGGGGAGGGGGG + Intronic
1050537705 9:6645158-6645180 AGCTCAGGGTAGGAGCCGGGAGG + Intronic
1050920929 9:11199603-11199625 TGATGAGGGCTGGGGTAGGGAGG + Intergenic
1051342862 9:16127850-16127872 AGCTGTGGGCAGGAGTAGGGTGG + Intergenic
1051510083 9:17867973-17867995 AGAGAAGGGTAGGGGAAGGGAGG - Intergenic
1051518631 9:17959372-17959394 AGCTGTGGGTAGAGGAAGGAGGG - Intergenic
1051591215 9:18777847-18777869 AGCTGATGGTAGGCCTTGGGTGG - Exonic
1052171630 9:25404865-25404887 AGATGAGGTAAGGGGCAGGGTGG + Intergenic
1052743501 9:32416535-32416557 ACCTGGGGGTGGGGGTTGGGGGG - Intronic
1052974261 9:34400191-34400213 GGGTGAGGGTGGGGGCAGGGTGG + Exonic
1053180090 9:35961240-35961262 AGCTGAGGTGAGGGGCAGGCAGG - Intergenic
1053826558 9:42030690-42030712 AGCTGCAGGTGGGGGAAGGGTGG - Intronic
1054604002 9:67156707-67156729 AGCTGCAGGTGGGGGAAGGGTGG + Intergenic
1054758360 9:68981468-68981490 GGCGGAGGGTGGGGGTGGGGAGG + Intronic
1055280681 9:74670767-74670789 AGCTTAGGGAAGGGAGAGGGAGG + Intronic
1055969773 9:81900377-81900399 AGCAGAGGGGAGGGGAGGGGAGG - Intergenic
1056063124 9:82905333-82905355 AGCTGAGGGTTTGGGTGGGCTGG - Intergenic
1056191143 9:84185377-84185399 TCCTGAGGGTAGGGATTGGGAGG + Intergenic
1056522280 9:87412118-87412140 AACTGAGGGAAGGGGTTTGGGGG - Intergenic
1056524795 9:87433094-87433116 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1056867563 9:90242698-90242720 AGAAGAGGGGAGGGGAAGGGAGG + Intergenic
1056901924 9:90607806-90607828 GGCGGAGGGTTGGAGTAGGGAGG + Intergenic
1057195897 9:93115549-93115571 AGGTGAGGGAAGGAGTTGGGGGG + Intergenic
1057354178 9:94321300-94321322 AGCTGAGGGCAGGGATGGGAGGG + Intronic
1057499010 9:95582052-95582074 AGCTGTAGGGAGGGGAAGGGTGG - Intergenic
1058073987 9:100631894-100631916 TGCTGAGGGGAGGGGTCAGGTGG + Intergenic
1058339432 9:103876329-103876351 TACTGAGGGTTGGGGTGGGGTGG - Intergenic
1058418103 9:104808901-104808923 AAGTGAGTGTAGGGGAAGGGAGG - Intronic
1058432395 9:104930324-104930346 AGATGAGGGGAGGGGAGGGGAGG - Intergenic
1059214986 9:112553126-112553148 AGCAGAGGGGAGGGGAGGGGAGG - Intronic
1059373532 9:113863121-113863143 AGATGAGGATAAGGGGAGGGGGG + Intergenic
1059866331 9:118518650-118518672 AAGAGAGGGTAGGGGTAGGGTGG - Intergenic
1060138671 9:121184232-121184254 AGCTGGGAGTAGGGGTTTGGGGG + Intronic
1060270034 9:122133672-122133694 ATCTGAGGGTGGGGGTTGGGTGG + Intergenic
1060494239 9:124106283-124106305 AGGTGAGGGGAGGGGAGGGGAGG - Intergenic
1060507766 9:124210991-124211013 AGCTGGGGGTGGAGGAAGGGAGG - Intergenic
1060544889 9:124453865-124453887 AGCTCGGGGTGGGGGTAAGGGGG - Intronic
1060554641 9:124501940-124501962 AGCTGGGGTTGAGGGTAGGGAGG + Intronic
1060834910 9:126748282-126748304 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1060882338 9:127126138-127126160 AGTTGGGGGTAGGGGTGGGGTGG - Intronic
1061192130 9:129088126-129088148 AGCTGGGGGTGGGGGGAGGTGGG + Intronic
1061202982 9:129147976-129147998 AGCTGTGGGCTGGGGTGGGGTGG + Exonic
1061244171 9:129392650-129392672 AGCAGAGGGTGGGGGTTGGGGGG + Intergenic
1061380308 9:130252568-130252590 AGCTTTGGGTGGGGGTAAGGGGG + Intergenic
1061487778 9:130929002-130929024 GGCTGGGGGCAGGGGTGGGGAGG + Intronic
1061885528 9:133589490-133589512 AGCTGAGGGTGGGGGATGGAAGG - Intergenic
1061954786 9:133955813-133955835 AGCTGTGGGGAGGAGTGGGGAGG - Intronic
1061954951 9:133956532-133956554 AGCTTTGGGTTGGGTTAGGGAGG + Intronic
1062017960 9:134301149-134301171 AGGAGAGGGGAGGGGAAGGGAGG + Intergenic
1062030427 9:134359686-134359708 GGCTGAGGGCAGGGGAAGCGTGG + Intronic
1062035340 9:134380306-134380328 GCCTGGGGGCAGGGGTAGGGTGG + Intronic
1062063680 9:134514507-134514529 AGCTCAGGGTGGGGCTGGGGTGG - Intergenic
1062266796 9:135690302-135690324 CCCTGAGGGGAGGGGTGGGGTGG - Intergenic
1062350062 9:136134122-136134144 TGCTGAGGGTAGGTGTAGACAGG + Intergenic
1062350921 9:136138316-136138338 AGAGGAGGGAAGGGGAAGGGAGG - Intergenic
1062565695 9:137163039-137163061 AGGTGCGGGGAGGGGGAGGGTGG + Intronic
1062580652 9:137227921-137227943 AGCGGAGGGAAGGGGAGGGGAGG + Intronic
1062598681 9:137310573-137310595 TGCTGGGGGTGGGGGCAGGGAGG + Intronic
1062682241 9:137788123-137788145 AGAGGAGGGCAGGGGTGGGGTGG + Intronic
1062712504 9:137984270-137984292 AGGCGAGGGCAGGTGTAGGGTGG + Intronic
1062746540 9:138216489-138216511 AGCTGAGGGAAGGAGATGGGAGG - Intergenic
1203363665 Un_KI270442v1:238870-238892 AGTTGGGGGTTGGGGGAGGGTGG + Intergenic
1185459871 X:328952-328974 AGGAGAGGGGAGGGGGAGGGGGG - Intergenic
1185581221 X:1212937-1212959 AGGGGAGGGGAGGGGGAGGGAGG - Intergenic
1185627577 X:1493352-1493374 AGGGGAGGGGAGGGGGAGGGAGG + Intronic
1185640448 X:1587717-1587739 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1185640465 X:1587752-1587774 AGGAGAGGGGAGGGGAAGGGAGG - Intergenic
1185640488 X:1587802-1587824 AGGAGAGGGGAGGGGAAGGGAGG - Intergenic
1185640498 X:1587825-1587847 AGGGGAGGGGAGGGGAAGGGGGG - Intergenic
1185640522 X:1587865-1587887 AGGAGAGGGGAGGGGAAGGGGGG - Intergenic
1185640544 X:1587911-1587933 AGGAGAGGGGAGGGGAAGGGGGG - Intergenic
1185640556 X:1587934-1587956 AGGAGAGGGCAGGGGAAGGGGGG - Intergenic
1185640578 X:1587982-1588004 AGGAGAGGGGAGGGGAAGGGGGG - Intergenic
1185640621 X:1588083-1588105 AGGGGAGGGCAGGGGAAGGGAGG - Intergenic
1185640745 X:1588349-1588371 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1185640867 X:1588595-1588617 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1185640913 X:1588695-1588717 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1185641100 X:1589089-1589111 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1185641153 X:1589204-1589226 AGAGGAGGGGAGGGGAAGGGAGG - Intergenic
1185641176 X:1589254-1589276 AGGGGAGGGGAGGGGAAGGGAGG - Intergenic
1185648008 X:1628781-1628803 AGGTGAAGGGAGGGGAAGGGAGG - Intronic
1185717033 X:2351083-2351105 AGCTGGGGGCAAGGGGAGGGAGG + Intronic
1186415187 X:9377217-9377239 ACCTGAGGGTGGGGGGTGGGAGG - Intergenic
1186637023 X:11417322-11417344 GGATGAGGGCAGGAGTAGGGTGG + Intronic
1187067780 X:15856778-15856800 AGGTGGGGGTAGGGGTAGGGAGG + Intergenic
1187678213 X:21739100-21739122 GGTTGAGGGTAAGGGTGGGGTGG - Intronic
1188806429 X:34596285-34596307 ACTTGAGGGTAGGGGATGGGAGG - Intergenic
1189315928 X:40056495-40056517 AGCTGGGGGTTGGGGTTGGCAGG + Intronic
1189492850 X:41483284-41483306 AGCGGAAGGGAGGGGAAGGGAGG - Intergenic
1189723306 X:43942815-43942837 AGCTGAGGTTGGGGGAGGGGGGG + Intergenic
1190595470 X:52049154-52049176 TGTTGTGGGTAGGGGGAGGGGGG + Intergenic
1190613354 X:52204919-52204941 TGTTGTGGGTAGGGGGAGGGGGG - Intergenic
1190911317 X:54774844-54774866 AGCTGAGGGAAGGGGAGGGGAGG + Intronic
1192196751 X:69033851-69033873 AGCTGAGGGTAGGAACAGGGTGG + Intergenic
1192456842 X:71283344-71283366 AGCTGGGGGTGGGGGTCGGAAGG - Intronic
1194522196 X:94932424-94932446 AGCTGGGGGTAGGGGTGTGAAGG + Intergenic
1194942411 X:100027047-100027069 AGGGGAGGGGAGGGGAAGGGAGG + Intergenic
1195227775 X:102815883-102815905 ACCTGAGGGTAGAGGGAGAGAGG + Intergenic
1195429887 X:104777211-104777233 ACCAGTGGGTAGGGGGAGGGTGG - Intronic
1195604719 X:106792357-106792379 TTCTGTGGGTAGGGGTGGGGTGG + Intronic
1196100576 X:111843392-111843414 AGCTGAGAGTGGGGTTAGAGTGG + Intronic
1197135980 X:123059988-123060010 AGTGGAGGGGAGGGGAAGGGAGG + Intergenic
1197666890 X:129233926-129233948 AGGTGAGGTCAGGGGTAGAGGGG - Intergenic
1197871819 X:131068621-131068643 GGCTGAGGGTGGGGGTGCGGAGG - Intronic
1198220082 X:134590856-134590878 AGCTAAGGGGTGGGGTGGGGGGG - Intronic
1198528110 X:137522491-137522513 ACTTGAGGGTAGAGGTTGGGAGG - Intergenic
1198658387 X:138939565-138939587 ACCTGAGGGTGGGGGTTGGGAGG - Intronic
1199113059 X:143957734-143957756 ATTTGAGGGTAGAGGTTGGGAGG - Intergenic
1199894930 X:152119289-152119311 AGATGAGGGTGGGGGTGGGGTGG + Intergenic
1199897124 X:152136571-152136593 GGCTGACAGAAGGGGTAGGGTGG + Intronic
1199935293 X:152567573-152567595 AGCTGAGGATGGGGCTAGGTAGG + Intergenic
1200234053 X:154459785-154459807 AGCTGAGGGGAGAGGGAGGCAGG - Intronic
1200317321 X:155147644-155147666 AGCTGAGGTAAGGAGGAGGGTGG - Intronic
1201074652 Y:10177960-10177982 AGTTGGGGGTTGGGGGAGGGTGG - Intergenic
1201567366 Y:15380394-15380416 AGCTGAGGGTAGGGGGAAATGGG + Intergenic
1201594545 Y:15653069-15653091 AGCTGAGGTCAGGGGTAAAGGGG - Intergenic