ID: 1112715708

View in Genome Browser
Species Human (GRCh38)
Location 13:102182350-102182372
Sequence CTAAAATCAAGGCGTCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5108
Summary {0: 1, 1: 16, 2: 329, 3: 1499, 4: 3263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112715708_1112715715 12 Left 1112715708 13:102182350-102182372 CCCTGCCGACGCCTTGATTTTAG 0: 1
1: 16
2: 329
3: 1499
4: 3263
Right 1112715715 13:102182385-102182407 TGTGTTGGACTTTTGACCTCTGG 0: 1
1: 1
2: 1
3: 197
4: 4164
1112715708_1112715712 -3 Left 1112715708 13:102182350-102182372 CCCTGCCGACGCCTTGATTTTAG 0: 1
1: 16
2: 329
3: 1499
4: 3263
Right 1112715712 13:102182370-102182392 TAGCCCAGTGAGAACTGTGTTGG 0: 2
1: 14
2: 38
3: 117
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112715708 Original CRISPR CTAAAATCAAGGCGTCGGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr