ID: 1112717915

View in Genome Browser
Species Human (GRCh38)
Location 13:102207590-102207612
Sequence CATCTGTCCTTGAGAAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112717915 Original CRISPR CATCTGTCCTTGAGAAAAAA GGG Intronic
901210453 1:7521945-7521967 CATTTGTCATTGTCAAAAAATGG - Intronic
901298486 1:8180394-8180416 CATGTGTCCTTAAGAAGAATGGG + Intergenic
904751978 1:32746561-32746583 CATTTGTAGGTGAGAAAAAAGGG + Intronic
905496864 1:38396840-38396862 AATCTGTCCTTCAGAAATGAAGG + Intergenic
906250252 1:44305594-44305616 CATCTGGCTTTGACAAAAGATGG + Intronic
907279185 1:53334428-53334450 CATCTGTCCTGGAATAAACAGGG - Intergenic
910666034 1:89726765-89726787 CATCTGAACTTCAGAGAAAAGGG - Intronic
912077407 1:105892535-105892557 GATCTCTCTTTGAGAAAAAGAGG + Intergenic
912153974 1:106893058-106893080 AAACTGTCCTTGAAAAAATATGG + Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913369460 1:118082405-118082427 CATCTTTGCTGGAGAGAAAATGG - Intronic
913403157 1:118458201-118458223 CTTATGCCCTTGAGAAAAGAGGG - Intergenic
916419899 1:164627199-164627221 CATTTTTCCTTAAGGAAAAAAGG - Intronic
916926438 1:169525900-169525922 CCTCTGTCCATGATAAGAAATGG + Exonic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917498229 1:175562222-175562244 CTTCAGTGCTGGAGAAAAAATGG - Intronic
920413230 1:205779001-205779023 CAACTGTCTTTCAAAAAAAAAGG + Intergenic
921035224 1:211371560-211371582 CATCTGTCCAGGATAAACAATGG + Intronic
923499150 1:234550310-234550332 CATGTGTTCTTGGGAAGAAAGGG + Intergenic
924109845 1:240688011-240688033 CTACTGTCCTTCAGAGAAAAAGG - Intergenic
924634568 1:245773757-245773779 AATACATCCTTGAGAAAAAATGG + Intronic
924801915 1:247334019-247334041 GATCTGTGCTACAGAAAAAAAGG + Intergenic
924837327 1:247664414-247664436 AATCTATCCTTCAGAAATAAGGG - Intergenic
1064432731 10:15285223-15285245 CATGTTTCCTGGAGAAACAATGG + Intronic
1066071806 10:31823341-31823363 TATCTGTCCTAGAGAAGAAAAGG + Intronic
1068326707 10:55498922-55498944 CATCTGGCCCTGAGCAAACATGG - Intronic
1068550715 10:58404844-58404866 CATGTATCCTTGGGAAAGAAAGG - Intergenic
1069504704 10:68987393-68987415 CATCTGGCCTGGAGACAAAGTGG + Intergenic
1070731617 10:78832371-78832393 CAGCTGTCCTGGAGACAAGATGG - Intergenic
1071151104 10:82635563-82635585 CTTTTGTCTATGAGAAAAAATGG - Intronic
1071370506 10:84946454-84946476 CCTGTGTCCTTGAGAAAGAAAGG + Intergenic
1071751985 10:88489628-88489650 TATCTGTTCTTGTGAGAAAATGG - Intronic
1073584403 10:104694624-104694646 CATCCTTCCTTGAGACAAGATGG - Intronic
1074461306 10:113639776-113639798 CATGTGCTCCTGAGAAAAAATGG + Intronic
1074695775 10:116049207-116049229 CATCTGCCCTGCAGAAAAAGAGG - Intergenic
1075170095 10:120105203-120105225 CATCTGTCCCTGAGAGGACAAGG - Intergenic
1075364089 10:121867501-121867523 CATCTAACCTTGGGAAAAAGGGG - Intronic
1076941422 10:133612500-133612522 AATCTGTCCTTCAGAAATGAAGG + Intergenic
1078576773 11:12509488-12509510 CAGCTGTGCTGGAGAAAAGATGG - Intronic
1080711310 11:34750287-34750309 CATCTCTCTTTGAAAATAAATGG - Intergenic
1081416761 11:42824543-42824565 CATCTATCATTGAGAAAAAGAGG + Intergenic
1082636020 11:55595398-55595420 AATCTGTTCTTCAGAAAAAAAGG - Intergenic
1083706678 11:64521365-64521387 CATCAGTCCTTGAGAAATCTGGG + Intergenic
1085663953 11:78395623-78395645 CATCTGTCCTTGAGAGGAGAAGG + Intronic
1086449841 11:86905086-86905108 CATCTGTTTTTGAAAATAAATGG - Intronic
1086855588 11:91861371-91861393 CATGTGTCCTGGAGGAAACATGG + Intergenic
1086898319 11:92338737-92338759 CATTAGTCCTTGGGAACAAACGG + Intergenic
1087583922 11:100094073-100094095 CATCTGACAATGAGAAAAGAAGG + Intronic
1088315693 11:108504325-108504347 CTCCTGTCCTTGATAGAAAAAGG + Intergenic
1088320395 11:108549534-108549556 AATTTGTCCTGGAGAAAAGATGG - Intronic
1089790624 11:120940884-120940906 GATCTGTCCTGGAGAATAAATGG + Intronic
1090291505 11:125549683-125549705 AATCTGCCCTTTAGAAAAAGGGG - Intergenic
1090322060 11:125854690-125854712 AATCTGTCCTTCAAAAATAAGGG + Intergenic
1091145436 11:133275196-133275218 CATATTTTTTTGAGAAAAAAAGG - Intronic
1091252036 11:134152222-134152244 CATCCCTTCTTGGGAAAAAATGG - Intronic
1091997760 12:5008361-5008383 CACCTGGCATTGGGAAAAAAGGG + Intergenic
1092989574 12:13882259-13882281 GATCTGTCCTTTGGACAAAATGG + Intronic
1093616908 12:21236445-21236467 CATCTTTCCTTTAGATAGAAAGG + Intronic
1094680963 12:32666705-32666727 CATCTGCCACTCAGAAAAAAGGG + Intergenic
1095756196 12:45769947-45769969 AATCTGTCTTTGAAAAATAAAGG + Intronic
1096071914 12:48780203-48780225 TATCTGACTATGAGAAAAAATGG + Intronic
1097079787 12:56421637-56421659 AATCTTTCCTTGGGAATAAAAGG + Intronic
1097204811 12:57311730-57311752 CATCTGTCCTTCAGAAAGATTGG + Intronic
1098743785 12:74208897-74208919 CATCTGTGAAAGAGAAAAAAAGG + Intergenic
1099298752 12:80865305-80865327 CATCTGTCATTTTAAAAAAAAGG + Intronic
1099378207 12:81920075-81920097 TATGTGTCCCTGAGATAAAATGG - Intergenic
1100005252 12:89887891-89887913 CTTCTGTACTTGAGAACCAAAGG + Intergenic
1100946655 12:99791403-99791425 AATCTGCACTTTAGAAAAAATGG + Intronic
1101287748 12:103333038-103333060 CATCAGGCCTTTAAAAAAAATGG + Intronic
1101670762 12:106870240-106870262 GATCTGGCCTAGACAAAAAAAGG - Intronic
1101971549 12:109317101-109317123 AATCTGCCCTTGAGATGAAAAGG + Intergenic
1103402167 12:120650504-120650526 CATCCGTCCTGGAGGAAGAACGG + Intronic
1104476767 12:129076957-129076979 CATCCTTCCTTGAGAAAAGGAGG + Intronic
1105382203 13:19898040-19898062 CATGTGTACCTGAGAAAAATGGG - Intergenic
1106001588 13:25728567-25728589 TCTCTGTCTTAGAGAAAAAATGG + Intronic
1106182982 13:27384012-27384034 CTTCTGTCCTTGTGATAATATGG + Intergenic
1108690578 13:52856009-52856031 CATCTGTCCATGACAAATGATGG + Intergenic
1108945417 13:56017452-56017474 AAGCTGTCCTTCAGAAACAAAGG - Intergenic
1109509829 13:63355632-63355654 CATGTGTTCTTTAGAACAAATGG - Intergenic
1109851340 13:68068509-68068531 CATGTGAACTTGAGAAGAAAAGG + Intergenic
1111384981 13:87513480-87513502 CTTCTCTCCTTTAGAAAAGAAGG + Intergenic
1111507864 13:89218262-89218284 CATGTGTTATTGAGAAAAATAGG + Intergenic
1112327742 13:98454461-98454483 CATCTCTCCCAGAGAACAAATGG + Intronic
1112717915 13:102207590-102207612 CATCTGTCCTTGAGAAAAAAGGG + Intronic
1112775571 13:102840280-102840302 CATCTGCCCTTAAAAAAAATTGG + Exonic
1113010715 13:105762477-105762499 CATCAGTCCTAGAGAAGAAGGGG + Intergenic
1113597289 13:111542313-111542335 CATCTGTCCTGGTGGAAAACAGG + Intergenic
1114911492 14:27204531-27204553 CTTCTGTCCCTGAGAACAAGTGG + Intergenic
1116013727 14:39381520-39381542 CAGCTGTCATGGTGAAAAAAGGG + Intronic
1116577934 14:46599319-46599341 TATTTCTCCTTGAGAAAAGAAGG - Intergenic
1117834874 14:59793415-59793437 CTTCTGTACTTAAGAAAAAAAGG - Intronic
1118659377 14:67990865-67990887 CAATAGTCTTTGAGAAAAAAAGG - Intronic
1118913277 14:70079703-70079725 CCTCAGTCCTTGAGAAACACAGG + Intronic
1119057487 14:71437955-71437977 CATCTATCCTAAAGAAAACATGG + Intronic
1119585601 14:75832072-75832094 CATCTGTTCTTTCGTAAAAAGGG - Intronic
1120096479 14:80394490-80394512 CATCTATTATTGAGAAACAAAGG - Intergenic
1120259345 14:82162150-82162172 CATCTGTCCTGGATAAAATCTGG + Intergenic
1120588305 14:86344325-86344347 AAACTGTCCTTGAGAAAAGATGG - Intergenic
1121935499 14:98014740-98014762 CATCTTTTCTTTAGAAATAAAGG - Intergenic
1122077390 14:99245375-99245397 CTTTTGTCCTTGAGAAAAGCGGG + Intronic
1122199854 14:100115901-100115923 CATTTGTCTTTGGGAAACAAAGG - Intronic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1124197391 15:27644460-27644482 CATCTGTCCATGAGAACAACAGG + Intergenic
1126841151 15:52718570-52718592 AAACTGTCCTTGAGAATAAAAGG + Intergenic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1129296878 15:74604586-74604608 CATCTGTCCGTGAACAGAAAGGG - Intronic
1131019533 15:89086936-89086958 CATGTTACCTTGAAAAAAAAAGG - Intergenic
1131328530 15:91472562-91472584 CAAATGTCCTTCAGAGAAAAGGG - Intergenic
1131612632 15:93981233-93981255 CTTCTATCCTTGAGCTAAAAGGG - Intergenic
1131773260 15:95764194-95764216 AATATCTCCTGGAGAAAAAAAGG + Intergenic
1133589257 16:7226984-7227006 CATCTCTCCAGGATAAAAAATGG + Intronic
1134026556 16:10958370-10958392 TATGTGACCTTGAGCAAAAAAGG - Intronic
1135552744 16:23410650-23410672 GCTTTGTCCTTGAGAAAAACAGG + Intronic
1136456989 16:30385701-30385723 CACCTATCCTTCAGAAAAATTGG + Intronic
1136670679 16:31854354-31854376 CAACTGACCTTATGAAAAAATGG + Intergenic
1137393692 16:48102122-48102144 CATCTGTCATCCAGAAAAAGGGG - Intronic
1137796387 16:51223847-51223869 AAACTGCCCTTGAGATAAAATGG + Intergenic
1138782754 16:59809216-59809238 AAACTGTCCTTAAGAAAGAAAGG + Intergenic
1139287307 16:65827102-65827124 CATCTGTCCTTAAGAAAGGGAGG - Intergenic
1139710311 16:68770892-68770914 TATCTGTCCTTCAGAAGATAAGG - Intronic
1140158341 16:72457465-72457487 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1140180706 16:72715066-72715088 CATCTCTACTTGAGAAAAAAGGG - Intergenic
1141262179 16:82463896-82463918 TTTCTGTCCTAGAGACAAAATGG + Intergenic
1141354105 16:83327426-83327448 GATCTGTCCTCCAGAAAAAAGGG + Intronic
1143160323 17:4865512-4865534 CATTTGTCCTTATGAGAAAAAGG - Intronic
1145951275 17:28819966-28819988 CACTTGTCCTTGATACAAAAAGG + Intronic
1146576675 17:33999992-34000014 AAGCTGTCCTTGAGAAATGAAGG - Intronic
1147509218 17:41052282-41052304 CATTTGTCAGTGAGAAAATATGG + Intergenic
1148989535 17:51653386-51653408 CTTCTGTCCTAGAAAGAAAAAGG - Intronic
1149900108 17:60468314-60468336 AAAAAGTCCTTGAGAAAAAAAGG + Intronic
1153557979 18:6336681-6336703 CATCTGCCTTGCAGAAAAAAGGG + Intronic
1154015921 18:10617112-10617134 CATCTAGCCTTGAGCCAAAAAGG + Intergenic
1154189590 18:12218531-12218553 CATCTAGCCTTGAGCCAAAAAGG - Intergenic
1158055015 18:53268605-53268627 TATTTGGCCTTGAAAAAAAATGG + Intronic
1158597228 18:58827058-58827080 CATCTGTCACACAGAAAAAAGGG - Intergenic
1158914674 18:62111151-62111173 CATGTGTCCTTGTGGAAAACAGG + Intronic
1159242844 18:65765282-65765304 CATATATCCTTGGAAAAAAATGG + Intronic
1159616506 18:70586136-70586158 AAGCTGTCCTTCAGAAAGAAAGG + Intergenic
1160099394 18:75905973-75905995 CATTTGTCCATGAAAAAAGATGG + Intergenic
1162821584 19:13226579-13226601 CATCTGTCCTTGGGCACCAAGGG + Intronic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1166995678 19:46718651-46718673 CATCTGCCCTTCAGGAAAAAGGG - Intergenic
1167682162 19:50930480-50930502 CATCTATCCTGTAGGAAAAAGGG - Intergenic
1168115775 19:54220823-54220845 GATCTGTCCTGGAGAGAAGAAGG + Exonic
1168118759 19:54240569-54240591 GATCTGTCCTGGAGAGAAGAAGG + Exonic
1168125090 19:54278555-54278577 GATCTGTCCTGGAGAGAAGAAGG + Exonic
1168133701 19:54337136-54337158 GATCTGTCCTGGAGAAAAGAAGG + Exonic
1168182611 19:54672333-54672355 GATCTGTCCTGGAGAGAAGAAGG - Intronic
1168187682 19:54710092-54710114 GATCTGTCCTGGAGAGAAGAAGG - Intergenic
925471869 2:4171455-4171477 TATCTGCCCTTTAGCAAAAAAGG - Intergenic
925662686 2:6219699-6219721 CATCTGTAAATGGGAAAAAATGG - Intergenic
927832568 2:26365254-26365276 CACATGTCCTTCAGAAGAAAGGG - Intronic
928306232 2:30172421-30172443 CCTCTGCCCTTGAGAAGAAAGGG + Intergenic
931613601 2:64131543-64131565 CAACTGTACTCGAGAAACAAAGG + Intronic
932066189 2:68564032-68564054 CATCTTTACTTTAGAAAAAATGG - Intronic
938654875 2:133421070-133421092 CATGTCACCTTGAGAAAAAAAGG - Intronic
939309525 2:140457022-140457044 CATCTGGCCTTGTGAAATAAAGG - Intronic
939418252 2:141929473-141929495 CTTCTGTCTTTTAAAAAAAATGG - Intronic
939882534 2:147646571-147646593 CATTTGTACCTCAGAAAAAATGG + Intergenic
940091087 2:149918122-149918144 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
940304324 2:152209298-152209320 CATCTGTCATTTTCAAAAAAGGG + Intergenic
940988096 2:160069361-160069383 AATGTGTCCTTTAAAAAAAAAGG - Intergenic
945797337 2:214381063-214381085 CAACTTTCCTGGGGAAAAAAAGG - Intronic
946593360 2:221276887-221276909 CATACGTCCATGAGAAATAATGG - Intergenic
946892545 2:224293161-224293183 CATCTGTCCTTGGCCAAAAGAGG + Intergenic
947251658 2:228112973-228112995 CATCTTTGCTTTAGAAGAAACGG + Intronic
948013030 2:234665062-234665084 AATCTGTCCATGAGAAAAAAGGG - Intergenic
948036467 2:234862262-234862284 CCACTGTCCTTAAGAAAGAAAGG + Intergenic
948067762 2:235093954-235093976 TGTCTGTCCTTGAGAAAGATAGG + Intergenic
948164304 2:235849746-235849768 CATCTGTCCTGGAGAAGTGAGGG - Intronic
1169103991 20:2978573-2978595 CTTCTTTCCTTGAAAACAAAGGG - Intronic
1171775755 20:29365880-29365902 CATCTTTCCTTATTAAAAAAAGG + Intergenic
1172153742 20:32809372-32809394 CATCTGACCTGCAGAAGAAAAGG - Intergenic
1173017188 20:39236391-39236413 CATCTGTCCATGAGAAATTCAGG - Intergenic
1173044025 20:39492268-39492290 CATCTGAGCCTGAGATAAAAGGG + Intergenic
1173869195 20:46331099-46331121 CATCTGCCCTTGAGAGAAGTAGG + Intergenic
1174767700 20:53269372-53269394 GATATGCCCCTGAGAAAAAATGG + Intronic
1174855574 20:54042189-54042211 CATATGTCCTTGAGGACACAGGG + Intronic
1176937548 21:14884268-14884290 CATCTGTCCTTCTGAAATAATGG + Intergenic
1177190022 21:17840494-17840516 CATCTTTCCCTGAGTACAAAAGG - Intergenic
1177460920 21:21409412-21409434 CATCTGTGGTTTAGTAAAAATGG + Intronic
1177587056 21:23110736-23110758 AATTTGTCCTTGAGAAAAGTAGG + Intergenic
1177774664 21:25554775-25554797 CATCTGACCTTTAGAAACCAAGG - Intergenic
1177935362 21:27338529-27338551 CTGATGTCCTTCAGAAAAAAAGG + Intergenic
1177996867 21:28111210-28111232 CATCTGTTTTTGTGAAAACATGG - Intergenic
1178585255 21:33865988-33866010 CACATCTCCTGGAGAAAAAAAGG + Intronic
1178609750 21:34070741-34070763 CTTCTGTGCTTGTTAAAAAAAGG + Intergenic
1178884036 21:36471066-36471088 CATTTGTCATTGATAAAAACAGG + Intronic
1178972973 21:37197272-37197294 CATCTCTTCTTAAAAAAAAATGG + Intronic
1179027550 21:37692296-37692318 CCTTTACCCTTGAGAAAAAAAGG + Intronic
1182398907 22:30059488-30059510 CATGTATGCTTGAGAAAAATGGG - Intergenic
1183869173 22:40728297-40728319 CCTCTGTCCTTCTGAAAAAAAGG + Intergenic
949621567 3:5818613-5818635 CATCTGCCCAGGAGAAGAAAGGG + Intergenic
949829915 3:8203038-8203060 CAACTGTCCTTAACAATAAATGG + Intergenic
950325013 3:12099256-12099278 CATGTGCCCTTGAGAAGAATAGG - Intronic
951671351 3:25186244-25186266 CATCTGTACTGGATATAAAATGG - Intronic
952035316 3:29194234-29194256 AAACTGTCCTTTAGAAATAAAGG - Intergenic
955025308 3:55161875-55161897 CATCTGTCTTTGACCCAAAAGGG - Intergenic
956636263 3:71368501-71368523 CATTAGTCTCTGAGAAAAAAAGG + Intronic
957377699 3:79380139-79380161 CAACTTTCATTGAGAATAAAAGG + Intronic
958853209 3:99353685-99353707 CATCTGTCCTGCAGAAAGTAAGG + Intergenic
958993935 3:100879557-100879579 CATTTGTCCTTGTCAAAAAATGG - Intronic
959012018 3:101088741-101088763 CATGTTTTCTTGACAAAAAATGG + Intergenic
959105020 3:102055922-102055944 CATCTCTCCAGGAGACAAAATGG - Intergenic
959223338 3:103550623-103550645 TATCTTTCCTTCAGAAAAATTGG - Intergenic
959275747 3:104275607-104275629 AATCTGTCCTTTAGCAAAAGGGG - Intergenic
959570415 3:107877127-107877149 AAATTCTCCTTGAGAAAAAAAGG + Intergenic
961941124 3:130638049-130638071 CATATGTCCCAGGGAAAAAAAGG + Intronic
962455098 3:135557846-135557868 TATTTCTCCTTGTGAAAAAAAGG - Intergenic
962968870 3:140380537-140380559 CATTTCTTCTTGAGAAAATATGG + Intronic
963610001 3:147454754-147454776 CGTCTGTGGTTGAGAACAAATGG - Intronic
963680378 3:148367432-148367454 TATTTTTCCTTGTGAAAAAAAGG - Intergenic
965922331 3:173932469-173932491 CATCTGTCTATGAGAGAGAAAGG + Intronic
966518023 3:180841200-180841222 AAACTGTCCTTCAGAAATAAAGG + Intronic
971511823 4:27435944-27435966 CATCTGTCCTTTGAGAAAAAGGG + Intergenic
972558668 4:40205876-40205898 AATCTGTCTTTGAGATAGAAAGG + Intronic
973833766 4:54789051-54789073 CATTTGGCCTTGAGACAGAAGGG - Intergenic
973882126 4:55283968-55283990 TAGCTGTCCTTCAGAAATAAAGG - Intergenic
974606983 4:64165520-64165542 CAACTGTCCTCGGGAAAATAGGG - Intergenic
974652014 4:64766458-64766480 ATTCTGTCCTTGGGAGAAAATGG + Intergenic
975890270 4:79019203-79019225 CAGCTGTCCTTGAGAAGTCAGGG + Intergenic
979603538 4:122612726-122612748 CATCTGTCCTCTAGAACACACGG - Exonic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
980623935 4:135346560-135346582 AATCTGTCCTTCAAAAATAAAGG + Intergenic
981163474 4:141527546-141527568 AATCTGTCCTTTAGAAATGAAGG + Intergenic
981967847 4:150628265-150628287 CATTTGTCTTTGTCAAAAAAAGG - Intronic
982266042 4:153539105-153539127 AATTTTTCCTTGAGAAATAATGG - Intronic
982414726 4:155116238-155116260 CACATGTCCTTGAGAAAATGGGG - Intergenic
982954365 4:161744102-161744124 CATCTATCTTTGAAAAAAACAGG - Intronic
984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG + Intergenic
984558962 4:181245826-181245848 CATCTATCCTCAAGAATAAATGG - Intergenic
985690816 5:1311306-1311328 CATCTGCCACTCAGAAAAAAGGG + Intergenic
985767813 5:1789371-1789393 CATCTGCCACTCAGAAAAAAGGG - Intergenic
986121872 5:4846761-4846783 CATCTGACCTTGACAAAGGATGG + Intergenic
987005730 5:13707391-13707413 CCTCTGTCCTTGCGATAAAGAGG + Intronic
988716404 5:33833093-33833115 CATGTGTTCTTAGGAAAAAATGG - Intronic
988892977 5:35639323-35639345 CATGTGCCCTGGGGAAAAAATGG - Intronic
990125589 5:52513280-52513302 CATGTGTGCTTGAGAAGAATGGG - Intergenic
990237586 5:53784352-53784374 CAGCTGCCCTTGAGAAGAGATGG - Intergenic
990502821 5:56413646-56413668 CATCTGTCCAGAAAAAAAAAGGG + Intergenic
990560604 5:56979924-56979946 CCTCTGTCCTTGTGACAAGATGG - Intergenic
991341659 5:65617392-65617414 CAACTGACCTGGAAAAAAAATGG + Intronic
992012370 5:72541546-72541568 CAGCTGGCCTGGAGAAAACATGG - Intergenic
993771013 5:91926271-91926293 CATCTTCCCTTGTGACAAAATGG + Intergenic
994065516 5:95535764-95535786 CATGTGTCATAGTGAAAAAAGGG - Intronic
995381341 5:111537538-111537560 AATTTCTCCTTGAGAAAAACTGG - Intergenic
996178559 5:120390336-120390358 AGTCTGTCTTTAAGAAAAAATGG - Intergenic
996696356 5:126400690-126400712 AAGCTGTCCTTCAGAAATAAAGG - Intronic
997085980 5:130799244-130799266 AAGCTGTCCTTGAGAAATGAAGG + Intergenic
997930592 5:138069512-138069534 CAGCTTTCCTAGAGAAAACAAGG - Intergenic
999180518 5:149666916-149666938 CATTTGTCCCTGAAAAGAAATGG + Intergenic
1001293490 5:170483040-170483062 CATCTGTCCTTGGAAACAAAAGG - Intronic
1001518358 5:172373152-172373174 CATCTGTCATTGCCCAAAAAGGG + Intronic
1002338418 5:178496368-178496390 CAGCTGCCCATGAGAAAGAAGGG + Intronic
1002677023 5:180925552-180925574 AATCTGTCCTTCAGAAATGAGGG + Intronic
1004397550 6:15259188-15259210 CATCTTGCCTGGAGAATAAAAGG - Intronic
1004571155 6:16846610-16846632 CTTCTGCCCTAGGGAAAAAATGG - Intergenic
1004965675 6:20848205-20848227 CATCTGCCCTGCAGAAAAGATGG + Intronic
1008142678 6:47850130-47850152 CATCTGGGCTTGAGCAAGAACGG + Intergenic
1008793984 6:55277393-55277415 CATCTGTAGTTCAGAGAAAATGG + Exonic
1008881045 6:56380398-56380420 CACCTGCCCATTAGAAAAAATGG - Intronic
1009058533 6:58368951-58368973 AAACTGTCCTTCAGAAAATAAGG + Intergenic
1009232306 6:61078169-61078191 AAACTGTCCTTCAGAAAATAAGG - Intergenic
1009344637 6:62597976-62597998 CCTCTGTCCCAGAAAAAAAAAGG - Intergenic
1010595531 6:77758425-77758447 CTCTTGTCCTTCAGAAAAAAAGG - Intronic
1011097737 6:83684855-83684877 CATCTGTTCTTTTGAAAAAGTGG - Intronic
1011274260 6:85614491-85614513 CATTTGTGCTTGAGAAAATTTGG - Exonic
1013444304 6:110206317-110206339 GATGTGCCCTTTAGAAAAAATGG + Intronic
1013700561 6:112764531-112764553 CATCTGTCATTGTGATAAAGTGG - Intergenic
1013872026 6:114775692-114775714 AATCTGTGCTAGAAAAAAAATGG - Intergenic
1013912261 6:115290492-115290514 CATCTTTTCTTCAGAAAGAATGG + Intergenic
1014279959 6:119431192-119431214 GAACAGTCCTTGAGAAAACATGG + Intergenic
1016279749 6:142402075-142402097 ATTTTGTCCTTGAGAAATAAAGG - Intronic
1016630668 6:146226468-146226490 CATCTTTCCTGAAGAACAAAGGG - Intronic
1017714107 6:157196183-157196205 CATCTGTCCTTGCGTCATAAAGG - Exonic
1018765613 6:166930998-166931020 CCTGTCTTCTTGAGAAAAAAAGG + Intronic
1020014301 7:4821948-4821970 CATCTGTCCTTCTGGAATAACGG + Intronic
1020032991 7:4945880-4945902 CCTCTGTCCTGGAGGAAAGAAGG - Intronic
1020660182 7:10972957-10972979 CATCTGCCCTGCAGAAAAAGTGG - Intergenic
1020778921 7:12493954-12493976 CATTAGTACTTGAGAAAAAGAGG + Intergenic
1023148972 7:37181811-37181833 CATGTTTCTTTGAGAAAATATGG + Intronic
1023568580 7:41549443-41549465 AATCTGTAGTTGAGAAAGAAAGG + Intergenic
1024334594 7:48194561-48194583 CATCACTCCTTGAGAAATAGTGG + Intronic
1024474406 7:49795064-49795086 TATCTCTCCTTGAGAACACAAGG + Intronic
1025193701 7:56916125-56916147 TATCTTTCCATGAAAAAAAAAGG - Intergenic
1026188307 7:68101490-68101512 TATCTGTCCTTGGCATAAAATGG + Intergenic
1027808274 7:82858483-82858505 CATCTATACTGGAGAAGAAAAGG + Intronic
1029682054 7:102118064-102118086 AATCTGTCCTGGAAAATAAAAGG - Intronic
1030167396 7:106569125-106569147 CATCTGTCCTTAAGTGATAAGGG + Intergenic
1030398872 7:109023017-109023039 CATATGTCTTTTAGAAAAATTGG - Intergenic
1031465499 7:122105355-122105377 GATCTGTGCTTTAGACAAAATGG + Intronic
1032913228 7:136458261-136458283 CGTGTGTCCTTCAGAGAAAAAGG - Intergenic
1032921129 7:136549499-136549521 CATCTGTCACTGACAGAAAAAGG + Intergenic
1033669208 7:143474396-143474418 CATGTGCCCTTGAGAAGAATGGG - Intergenic
1034732934 7:153403635-153403657 TTTCGGTGCTTGAGAAAAAAAGG + Intergenic
1034831363 7:154310935-154310957 CCTCTGTCATTGAGAAAGAGAGG + Intronic
1035903289 8:3480794-3480816 AATCTATCCTTCAGAAATAAAGG + Intronic
1036061484 8:5326647-5326669 CATCTCTGCTTGATAAAAACTGG - Intergenic
1036429778 8:8679400-8679422 CCTCTGCCCTTGGGAAAAGAAGG + Intergenic
1036975171 8:13403074-13403096 AATCTGTCTTTGTGAAAACAGGG - Intronic
1037513919 8:19610818-19610840 CCTCTGTCCTTGAGACAAGGTGG + Intronic
1038360950 8:26876578-26876600 AATCTGTACTTCAGAAATAAGGG - Intergenic
1039025785 8:33256475-33256497 TCTCTGTGCTTGAGAAGAAAAGG + Intergenic
1039213949 8:35246984-35247006 AATTTGTACATGAGAAAAAAAGG + Intronic
1040711141 8:50190506-50190528 GATTTCTCTTTGAGAAAAAAAGG + Intronic
1041007640 8:53510638-53510660 AAACTGTCATTGACAAAAAATGG + Intergenic
1041586160 8:59522354-59522376 CATTTGTTCTTGAAAAGAAAGGG - Intergenic
1041969706 8:63725221-63725243 CATATGTCCTTAAAAAATAAAGG + Intergenic
1043553418 8:81401472-81401494 CATTTGTCCTAGAGAAACCATGG - Intergenic
1044146601 8:88723709-88723731 AATATGTCCTTCAGAAAGAAAGG - Intergenic
1044644271 8:94421490-94421512 AATCTGGGCTAGAGAAAAAAAGG - Intronic
1045098642 8:98824610-98824632 CATCTGTTCAGGTGAAAAAAAGG - Intronic
1045732077 8:105254405-105254427 AATCTGTCCTACAGAACAAATGG - Intronic
1046799964 8:118415196-118415218 CTCCTGTCCTTCAGAAGAAAAGG + Intronic
1046821821 8:118642202-118642224 CATCTCTTCTTGGGAACAAAGGG - Intergenic
1047919917 8:129624483-129624505 CATCTGACCTTCAGCAAAATTGG - Intergenic
1047995469 8:130330935-130330957 CATCTGCTACTGAGAAAAAAAGG - Intronic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1050006648 9:1139140-1139162 AAGCTGTCCTTCAGAAATAAGGG - Intergenic
1051259635 9:15250433-15250455 CATTTTTCCTTAAGACAAAAGGG - Intronic
1052584880 9:30413804-30413826 TAGCTGTCCTTCAGAAATAAAGG - Intergenic
1052887155 9:33660853-33660875 CATCTCACATTGAGAAAAACTGG + Intergenic
1053082501 9:35188923-35188945 AATCTGCCCTTTAGTAAAAAGGG - Intronic
1053267736 9:36727665-36727687 CCTCTGTCTTTGAGACAAAAGGG - Intergenic
1054964538 9:71007415-71007437 CGTGTGTTGTTGAGAAAAAATGG - Intronic
1056862580 9:90200328-90200350 CTTCTGTCCCTTAGATAAAATGG + Intergenic
1056896657 9:90557224-90557246 CTTCTCTCCTTGAGTAAATATGG + Intergenic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1060366749 9:123024058-123024080 CATTTGTCCTTGGGTTAAAATGG - Intronic
1060705704 9:125798146-125798168 CATCTGTCAATGAGCTAAAAAGG + Intronic
1062059664 9:134488309-134488331 CCTCTGTCCTGGAGGAAATAAGG - Intergenic
1062367164 9:136216348-136216370 CACCTGTCCTTTGGACAAAATGG - Intronic
1186101936 X:6166768-6166790 CATAAGTACTTGAGAATAAATGG + Intronic
1186301477 X:8204451-8204473 CATCTTTCCTTCAAAGAAAAAGG + Intergenic
1186717448 X:12267409-12267431 CATCTGTCTTAGAAAAAAGAAGG - Intronic
1186977052 X:14918842-14918864 TTTATGTCCGTGAGAAAAAAAGG - Intronic
1186997989 X:15144075-15144097 CAGATGTCCTTAAGAAAACAAGG - Intergenic
1187104529 X:16227457-16227479 TCTTTTTCCTTGAGAAAAAAAGG + Intergenic
1187123959 X:16435969-16435991 CACATTCCCTTGAGAAAAAAAGG + Intergenic
1188256952 X:27974269-27974291 CAACAGTCCTTGAGCCAAAATGG + Intergenic
1189936150 X:46070725-46070747 CATCAGTCCTAGAGAAAACTTGG - Intergenic
1191860390 X:65661692-65661714 GATGTGTTCTTGAGAAAAACTGG - Intronic
1193188046 X:78536974-78536996 CAATTGTCTTTGAGAAAAATTGG + Intergenic
1193606714 X:83578042-83578064 TATGTGTCCTTGAGAAAGAAGGG - Intergenic
1194960638 X:100231462-100231484 CATCTGTCATGTAGAAATAAAGG + Intergenic
1197655760 X:129114434-129114456 CATCTGTCTTTGTGAAAGAGAGG - Intergenic
1197900059 X:131361296-131361318 CATCTTTCCTTATTAAAAAAGGG + Intronic
1198151766 X:133917679-133917701 CATTTGTCCTAGAGAGAAAAAGG + Intronic
1198192131 X:134317660-134317682 AAGCTGTCCTTCAGAAATAAAGG + Intergenic
1199157691 X:144570029-144570051 CATCTCTCATTGGGAAATAATGG + Intergenic
1199734717 X:150674874-150674896 CATCTTTCCTTCAGGAAATAGGG - Intergenic
1200070396 X:153526224-153526246 CATCTGTCCATGAGCACAGAGGG + Intronic
1200082085 X:153582294-153582316 AATGTGCCCTTTAGAAAAAAGGG - Exonic
1200467509 Y:3537816-3537838 AATCTATCCTTCAGAAATAAAGG + Intergenic
1202178086 Y:22115960-22115982 TATCTGCCCCTGAAAAAAAAAGG - Intergenic
1202213275 Y:22470435-22470457 TATCTGCCCCTGAAAAAAAAAGG + Intergenic