ID: 1112718655

View in Genome Browser
Species Human (GRCh38)
Location 13:102216336-102216358
Sequence CACTTTGAGGAAATGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112718655_1112718662 9 Left 1112718655 13:102216336-102216358 CCAAACTCCATTTCCTCAAAGTG 0: 1
1: 0
2: 1
3: 34
4: 292
Right 1112718662 13:102216368-102216390 ATTTATTCACAGCAGGATTGAGG 0: 1
1: 0
2: 0
3: 13
4: 179
1112718655_1112718663 18 Left 1112718655 13:102216336-102216358 CCAAACTCCATTTCCTCAAAGTG 0: 1
1: 0
2: 1
3: 34
4: 292
Right 1112718663 13:102216377-102216399 CAGCAGGATTGAGGTAACATAGG 0: 1
1: 0
2: 0
3: 8
4: 163
1112718655_1112718661 2 Left 1112718655 13:102216336-102216358 CCAAACTCCATTTCCTCAAAGTG 0: 1
1: 0
2: 1
3: 34
4: 292
Right 1112718661 13:102216361-102216383 GACAATCATTTATTCACAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112718655 Original CRISPR CACTTTGAGGAAATGGAGTT TGG (reversed) Intronic
900613653 1:3554787-3554809 CACTTTCAGGAATTTGAGATGGG - Intronic
901351006 1:8596755-8596777 CACTTTGGGGAGTTGGAGATGGG - Intronic
902529585 1:17082137-17082159 CACTTTGAGGCTATGGTTTTTGG - Intronic
902660853 1:17902325-17902347 CACTTTAAGACAAGGGAGTTGGG - Intergenic
903817802 1:26077728-26077750 CACTTCTAGGAAATGGACTGGGG + Intergenic
904519772 1:31085880-31085902 CACTTTGAGCAAGTGGAGAGTGG - Intergenic
904673322 1:32181816-32181838 CTCTTTGAGAAAATGGAGACGGG + Intronic
905955204 1:41987657-41987679 CACATTGGGGAAGTGGTGTTGGG + Intronic
908408219 1:63835862-63835884 CTTTTAGAGGAAATGGAGCTTGG + Intronic
908736971 1:67286613-67286635 CATTCTGAGGTACTGGAGTTGGG + Intergenic
908891141 1:68849319-68849341 CATTTTGAGGTACTGAAGTTTGG + Intergenic
911603249 1:99869897-99869919 CACTTTGTGGGAGTGGAGGTTGG - Intronic
911808759 1:102246062-102246084 CTGTTTGTGGAAATGTAGTTGGG - Intergenic
912295639 1:108468030-108468052 CACAAAGAGGCAATGGAGTTGGG - Intronic
915011221 1:152687872-152687894 CACTTTGAGGAACTGAAGCTAGG - Intergenic
915939327 1:160108831-160108853 AAGTTTGAGGAAATGGAAGTGGG + Intergenic
915983608 1:160440592-160440614 CACTATTAAGAAATGGGGTTGGG - Intergenic
916493397 1:165322989-165323011 GCATTTGAGGAAATAGAGTTTGG - Intronic
917952147 1:180050028-180050050 TGAGTTGAGGAAATGGAGTTAGG + Intronic
918036306 1:180875772-180875794 CATTTTAAGGAAATTAAGTTTGG - Intronic
918213831 1:182375656-182375678 CACTTTTAGCAAATGAAGTATGG + Intergenic
920054113 1:203180456-203180478 TACTATGAGGTAATGGAGTTGGG - Exonic
920963167 1:210681757-210681779 AACTTGGAGGGAATGGAATTAGG - Exonic
921542627 1:216434904-216434926 CACTTTTAGGAACTGCATTTAGG - Intergenic
924169546 1:241323783-241323805 GACTCTGTGGAATTGGAGTTGGG - Intronic
924394093 1:243598713-243598735 CTCTTTGAGGAAGTAGTGTTAGG - Intronic
1062890861 10:1058439-1058461 CACCTTGGGGAAAGGGACTTAGG - Intronic
1063500587 10:6550190-6550212 AACTTTGAGGAAATTATGTTAGG - Intronic
1066641603 10:37559650-37559672 CATTTTGAGGTACTGGGGTTAGG + Intergenic
1066668115 10:37806911-37806933 TACTTTGAGAACATGGTGTTAGG + Intronic
1069254746 10:66318578-66318600 CACTTAGAGGGCATGGATTTTGG - Intronic
1069499866 10:68942146-68942168 AATTTTGAGGACATGCAGTTTGG + Intronic
1070955417 10:80460401-80460423 CTCTTAGAGAGAATGGAGTTAGG + Intronic
1071364924 10:84889911-84889933 CACTTTGAGGTAATAGCCTTGGG - Intergenic
1073107838 10:101042731-101042753 CACTGGGAGGAAATGGGGCTTGG - Intergenic
1073239353 10:102045422-102045444 CTCTTTGAGGAAATGGCACTTGG + Intronic
1073928990 10:108552124-108552146 CACCTAAAGGAAGTGGAGTTGGG + Intergenic
1074598385 10:114888411-114888433 CAGTTTGGGGAAGTGGAGGTAGG + Intronic
1075989164 10:126818866-126818888 CTCTCAAAGGAAATGGAGTTTGG + Intergenic
1076483033 10:130797231-130797253 CTCTTTGAGGAAGTTGAGTTGGG + Intergenic
1076540042 10:131207982-131208004 CTCATTGTGGAAGTGGAGTTCGG - Intronic
1076945474 10:133646219-133646241 CACTTTGAGTAACTGCAGCTGGG + Intergenic
1079866018 11:25735119-25735141 CATTTTGAGGAACTGGATTTAGG - Intergenic
1080575563 11:33596108-33596130 CATTCTGAGGACATGGAGCTGGG - Intronic
1080766757 11:35304337-35304359 CACTTTGACAAAAGGGGGTTGGG + Intronic
1080972073 11:37289792-37289814 CACTTTGATGTTATGGAGATGGG + Intergenic
1081092034 11:38883531-38883553 TAGTGTGAGGAAATGGTGTTGGG - Intergenic
1081821414 11:45999346-45999368 TACTTTGCAGAAATGGAGTAAGG + Intronic
1081941491 11:46946132-46946154 TACTTTGGAGAAATGGAGGTAGG - Intronic
1082743412 11:56936448-56936470 CAGTTTGAAAAAATTGAGTTGGG + Intergenic
1087448919 11:98292523-98292545 CATTATGGGGAGATGGAGTTTGG - Intergenic
1088170702 11:106993036-106993058 GGTTTTGAGGGAATGGAGTTAGG - Intronic
1089142346 11:116296025-116296047 CCCTTAGATGAAATGGAGTCTGG + Intergenic
1090827331 11:130397015-130397037 GACTTTGAGCAAATTGAGTCAGG + Intergenic
1091057828 11:132435482-132435504 CAGTGTGGGAAAATGGAGTTAGG + Intronic
1092118823 12:6029433-6029455 CACTTTGAGGTGGTGGAGTCTGG - Exonic
1092514625 12:9196369-9196391 CACTTTCACGAATTTGAGTTTGG + Exonic
1094182242 12:27604195-27604217 CAGTTGGAGAAAATGGAGATAGG + Intronic
1095352152 12:41226390-41226412 CTCTTTGAGGTCATGGATTTTGG + Intronic
1095465604 12:42484738-42484760 CACTGAGAGAAAGTGGAGTTTGG + Intronic
1095594023 12:43938547-43938569 CACACTGAGGAAATGGAGCTGGG + Intronic
1095913427 12:47451858-47451880 CACTTTTAGGTAATGGTGTCTGG - Intergenic
1097925716 12:65123739-65123761 CACTCAGAGGAAACCGAGTTAGG - Intergenic
1098286512 12:68912777-68912799 CCCTTAGAGGAAATACAGTTTGG + Intronic
1099472320 12:83066571-83066593 GTGTTTGAGGAAATAGAGTTGGG + Intronic
1100477395 12:94947059-94947081 CATTTTGAGGTACTGGGGTTAGG - Intronic
1102663123 12:114546934-114546956 CACTCTGAGGTACTGGGGTTTGG - Intergenic
1102664924 12:114563694-114563716 CACTCTGAGGTGCTGGAGTTTGG + Intergenic
1104319260 12:127735157-127735179 CACTTTGTGGAAATGGAATGAGG - Intergenic
1104388756 12:128374085-128374107 CACGATGAGGAAATGCAGGTGGG + Intronic
1104911844 12:132243488-132243510 CTCTTTGGGGAAACGAAGTTGGG + Intronic
1105245404 13:18645682-18645704 CATTTTGAGGAAAGGGAGTCAGG - Intergenic
1105606062 13:21927432-21927454 CACTTTGAGGTACTGGGGATTGG - Intergenic
1106106004 13:26734120-26734142 GACTTCCAGGAAATGGACTTTGG + Intergenic
1106438681 13:29745990-29746012 GAGTTTGAGGAAATGGGGTGGGG - Intergenic
1107539212 13:41370450-41370472 CATTTTGTGCAAATGCAGTTGGG + Intronic
1107688607 13:42929276-42929298 CACTTAGAGGAGATGATGTTTGG - Intronic
1107873154 13:44765180-44765202 CATTTTGAGTAAAGGGAGTCAGG + Intergenic
1109696504 13:65967096-65967118 AACTTTGATGAAATGGAGGGAGG + Intergenic
1110985088 13:81956836-81956858 CACTTTGAGAAAGTGTATTTTGG + Intergenic
1111265320 13:85803838-85803860 CACTTTGGGGAATTGGAGGAAGG + Intergenic
1112243540 13:97706174-97706196 CACTTTGAGGGAGGGGAGTGTGG - Intergenic
1112718655 13:102216336-102216358 CACTTTGAGGAAATGGAGTTTGG - Intronic
1115699385 14:35935550-35935572 CACTTCGGGGAAGTGGAGGTGGG - Intergenic
1117105199 14:52391239-52391261 CAGTATTAAGAAATGGAGTTGGG + Intergenic
1117449544 14:55837557-55837579 TACTTTGAACTAATGGAGTTTGG - Intergenic
1119103670 14:71904211-71904233 TGCTTTGAATAAATGGAGTTTGG + Intergenic
1119283136 14:73427707-73427729 CATATTCAGGAAATGGAGATTGG - Intronic
1119515026 14:75241117-75241139 ATCTTTGAGGAAGTGGAGATAGG + Intronic
1120095655 14:80384743-80384765 CAGTTTGAAGAACTGGAGGTAGG + Intronic
1122017858 14:98811594-98811616 CTCTCTTAGGAAATGGAATTGGG + Intergenic
1124194559 15:27610147-27610169 CACTTTTATGAAATGAATTTTGG + Intergenic
1127138751 15:55952553-55952575 TGGTATGAGGAAATGGAGTTGGG - Intronic
1129339869 15:74878714-74878736 CACCTTGGGGAAATAGATTTGGG - Intergenic
1129488314 15:75899012-75899034 CACTTTGGGGAGGTGGAGGTGGG + Intronic
1129751197 15:78065779-78065801 AAGTTTTAGGAAACGGAGTTGGG + Intronic
1130137985 15:81197566-81197588 CACTTTGGAGAAAAGGAGTCTGG - Intronic
1131354281 15:91731007-91731029 CACTTTGAGAGATTGGAGGTGGG + Intergenic
1131741572 15:95398593-95398615 CATTTTGAGGTATTGGGGTTTGG + Intergenic
1132176752 15:99721933-99721955 CAAGTAGAGGAGATGGAGTTTGG + Intronic
1133198159 16:4184983-4185005 CACTGTGGGGCTATGGAGTTTGG - Intergenic
1134423774 16:14118553-14118575 CACTTTGGGGAAACTGAGTTGGG + Intronic
1135923186 16:26669467-26669489 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1136495905 16:30643949-30643971 GACTTTAAGGAAAGGGAGTTGGG - Intergenic
1137511820 16:49107262-49107284 CACTTTGAGGCAAGGGGATTGGG + Intergenic
1137737175 16:50733580-50733602 CACTTTGAGGGAATCGAGGGGGG - Intergenic
1140706305 16:77633443-77633465 CATTTTGAGGTACTGGGGTTAGG + Intergenic
1141268105 16:82515179-82515201 TACTCTGAGGAACTGGAGTTTGG - Intergenic
1203144963 16_KI270728v1_random:1793489-1793511 GAGTTGGAGGAAATGGAGATGGG - Intergenic
1146289196 17:31596081-31596103 GCCTGTGAGGAAAGGGAGTTGGG - Intergenic
1146578715 17:34016705-34016727 AACTTTGAAGAAATGGATTGGGG + Intronic
1147992619 17:44344316-44344338 CACCTTGAGGAAAGGGCTTTGGG + Intergenic
1149594107 17:57853661-57853683 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1149775183 17:59351638-59351660 CACTTGAAGGAAATGGAAGTGGG - Intronic
1150052904 17:61982360-61982382 CACTTTTAGGAAAAGGATCTTGG + Exonic
1150243291 17:63653337-63653359 TACCTCGAGGAAATTGAGTTAGG + Intronic
1152170311 17:78741917-78741939 CACTGTCAGGAAAAGGAATTTGG + Intronic
1154141970 18:11832077-11832099 GACTTAGAGGAAATGCATTTTGG - Intronic
1154316268 18:13306213-13306235 CATTTTGTGCAAATGCAGTTGGG + Intronic
1154443540 18:14414265-14414287 CATTTTGAGGAAAGGGAGTCAGG + Intergenic
1155700512 18:28737372-28737394 CACCTTGAGGTCATAGAGTTAGG + Intergenic
1157035479 18:43968097-43968119 CATTTAGAGGATATCGAGTTTGG - Intergenic
1157645460 18:49264848-49264870 GACTTTGAGGATATTAAGTTTGG - Intronic
1157785596 18:50479293-50479315 AACTCTGACAAAATGGAGTTAGG - Intergenic
1158008869 18:52705364-52705386 CACTTTCAGAATATGGTGTTCGG + Intronic
1158295961 18:55997164-55997186 GACATTGAGGAAATGGAGCTTGG + Intergenic
1158474419 18:57767304-57767326 CTTTCTGAGGAAATGGAGCTTGG - Intronic
1159471481 18:68862373-68862395 CACTTTAATGCAATTGAGTTAGG + Intronic
1160375541 18:78409277-78409299 CATTCTGAGGAAGAGGAGTTAGG - Intergenic
1163136460 19:15314888-15314910 AAGATGGAGGAAATGGAGTTTGG + Intronic
1164470059 19:28522711-28522733 GACTTGGAGGAAATGGACTGCGG + Intergenic
1164705928 19:30320122-30320144 AACCTTGATGAAATGTAGTTTGG + Intronic
1164820971 19:31251060-31251082 GGCTGGGAGGAAATGGAGTTAGG + Intergenic
1165124488 19:33583993-33584015 CACCTTGAGGCAATGGAGCTGGG - Intergenic
1166722809 19:45006997-45007019 GACTTTGAGGGACTGGAGTGGGG + Intronic
1167190265 19:47983388-47983410 AACTATTAGGAAATGGATTTTGG + Intronic
1167804169 19:51768187-51768209 CAGTTTGAGGGACAGGAGTTGGG + Intronic
925542668 2:4982846-4982868 CACTTGAAGGATATGGAATTTGG + Intergenic
928498010 2:31854641-31854663 CAATTTGAGGAAATTGGATTTGG - Intergenic
929131518 2:38578880-38578902 GACTTTGGGGAAATGGGGTCGGG - Intronic
931105953 2:59055987-59056009 GACTTTGAGGAGATGAAATTCGG - Intergenic
931913519 2:66928105-66928127 TACCTTGGGGAGATGGAGTTGGG - Intergenic
932599086 2:73111973-73111995 CCCTTTGAGGAAAGGGAGGCAGG + Intronic
933100097 2:78244565-78244587 CATTTTGAGGTACTGGGGTTAGG - Intergenic
933312002 2:80672425-80672447 CACTTTGAGTAACAGGGGTTTGG - Intergenic
934892101 2:98079686-98079708 TTCTTTCAGGAAATGCAGTTGGG + Intergenic
935092580 2:99909945-99909967 CATTGTGAGGAACTGGGGTTAGG - Intronic
937899090 2:127003452-127003474 CACTCTGAGGTACTGGGGTTAGG - Intergenic
939035850 2:137130287-137130309 CCCTTTGAGCAAATGGGGTAGGG - Intronic
939100591 2:137890805-137890827 CATTTTGAGGAAAGGGAGTTAGG - Intergenic
940014116 2:149085514-149085536 GCCTTTGAGGAAGTTGAGTTAGG + Intronic
940557547 2:155250223-155250245 CACTTTCAGGACATACAGTTAGG + Intergenic
940842608 2:158601375-158601397 CCTTTTGAGGAAACAGAGTTGGG + Intronic
941994107 2:171585323-171585345 GACTTTTAGGAAATTGAATTTGG + Intergenic
942879899 2:180846471-180846493 CAATTAGAGTATATGGAGTTTGG - Intergenic
944858548 2:203792049-203792071 CTCTTGAAGGAGATGGAGTTGGG + Intergenic
945297140 2:208181866-208181888 CACCCTGAGGAAATGGAGTCAGG + Intronic
945414135 2:209549791-209549813 CACTTTGCGGTAATGGATATTGG + Intronic
945565969 2:211399920-211399942 CACAGTGTGGAAATGCAGTTAGG - Intronic
945644493 2:212473397-212473419 CACTTTGTCAAAATGCAGTTAGG - Intronic
945734621 2:213584296-213584318 AACTTTTGGGAAATGCAGTTGGG + Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946811862 2:223534192-223534214 CATTTTGAGATACTGGAGTTAGG - Intergenic
947314321 2:228839042-228839064 GACTTTGAGGATATTGAATTTGG + Intergenic
948679352 2:239622107-239622129 CACTCTGAGGTACTGGAGTTAGG - Intergenic
1170260470 20:14400567-14400589 AAAGTTGAGGAAATGGAGTATGG - Intronic
1171015301 20:21535787-21535809 CACTTTGACAAAATAGAGTAAGG - Intergenic
1172649486 20:36492775-36492797 CATTTTGAGCAAATTGAGGTTGG + Intronic
1173353544 20:42266211-42266233 CAGTTTTAAGGAATGGAGTTTGG + Intronic
1175155884 20:56971307-56971329 CACCTCCAGGAAATGTAGTTAGG - Intergenic
1175271280 20:57735775-57735797 CTCTTTGAGGAAAAGGACTTTGG - Intergenic
1176452549 21:6876973-6876995 CATTTTGAGGAAAGGGAGTCAGG - Intergenic
1176830722 21:13742022-13742044 CATTTTGAGGAAAGGGAGTCAGG - Intergenic
1177381664 21:20352375-20352397 CACATGAAGTAAATGGAGTTAGG + Intergenic
1178525576 21:33325477-33325499 CAGATTGAGGAAATGCATTTCGG - Intronic
1179354782 21:40649230-40649252 AACCTTGAGGAATTGGGGTTGGG - Intronic
1179837079 21:44043055-44043077 CACTATTATGAAATGGTGTTAGG - Intronic
1182782645 22:32880470-32880492 CACTTTGAGGAAAGAGCGCTGGG + Intronic
1184519417 22:44983933-44983955 TACTCTGAGGAACTGGAGCTGGG + Intronic
951839936 3:27023541-27023563 CATCTTGAGGAAATGGGATTGGG + Intergenic
952580242 3:34824486-34824508 CAGCAAGAGGAAATGGAGTTTGG + Intergenic
952660992 3:35846484-35846506 CATTTTGAGGAACTGGGGCTTGG + Intergenic
953610332 3:44442636-44442658 CCCTTGGAGGAACTGAAGTTGGG - Exonic
953830584 3:46294437-46294459 CAGTTTCAGGAATTGGAGCTAGG - Intergenic
955535749 3:59921908-59921930 CACTTTGAATAAATGCTGTTGGG + Intronic
958908470 3:99967405-99967427 CACTTTTTGGAAATGAACTTAGG + Intronic
960056313 3:113278909-113278931 CACAATGAGGAAATGTAGTTTGG + Intronic
960199216 3:114811667-114811689 CACTTTAATGAGATGAAGTTTGG - Intronic
962139763 3:132776878-132776900 CACTTTGGGGAAGTGGAGGAGGG - Intergenic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963723916 3:148897614-148897636 CACATTGAGGTATTGGTGTTGGG - Intergenic
963806482 3:149728123-149728145 CAATTGGAGGAAAAGGAGTCTGG + Intronic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
964525883 3:157614943-157614965 ATCTTAGAGGAAATGGACTTGGG + Intronic
966286180 3:178298002-178298024 CAATTTAAGGAAATGGTGTGGGG + Intergenic
966590306 3:181674875-181674897 CACTTTGAGGAAACCAAGGTGGG - Intergenic
966636119 3:182135594-182135616 AACTTTAAGAAAATGGATTTTGG + Intergenic
967440692 3:189505070-189505092 CACTTGGAGTAAATTGATTTGGG + Intergenic
968865870 4:3210876-3210898 CAATTTTAGTAAATGGATTTTGG - Intronic
969053967 4:4390287-4390309 CACTGGGTGGAAAAGGAGTTGGG + Intronic
970104973 4:12571825-12571847 AAGTTTGTGGAAATAGAGTTAGG - Intergenic
970790115 4:19848013-19848035 TACTATGAGGAATTGGAGTAGGG + Intergenic
971548348 4:27916098-27916120 CTTTTTGAGGAATTAGAGTTTGG - Intergenic
972849656 4:43033515-43033537 CAATTTGAGGCAATGGAGAAGGG + Intergenic
974979983 4:68943700-68943722 CACATTGAGGAAATGGAAGGAGG - Intronic
975110745 4:70623667-70623689 TATTTTGAGGAAATTGAGATGGG + Intergenic
977275405 4:94971382-94971404 CACTTTAAGGAAAAATAGTTCGG + Intronic
977746326 4:100551901-100551923 CAGGTTGAGGAAATGTATTTTGG + Intronic
978462808 4:108976318-108976340 CATTTTCAAGAAATGGTGTTTGG - Intronic
978565390 4:110076098-110076120 GACTGTGTGAAAATGGAGTTCGG - Intronic
978720902 4:111907941-111907963 CATTTTGTGGAACTGGAGCTTGG - Intergenic
979098533 4:116583868-116583890 AGATTTGAGGAAATGGATTTAGG + Intergenic
980656193 4:135790040-135790062 CATTTTGAGGAAGTTGAGGTGGG - Intergenic
981992892 4:150944517-150944539 GACTTTGAGGAATTGGTGTTGGG - Intronic
982260552 4:153490527-153490549 CACTTTCAGGTAATATAGTTAGG + Intronic
982712781 4:158774444-158774466 CACTGTGAGGGAATAGAGTAAGG + Intronic
983809216 4:172037599-172037621 GACTTTGAGGAAGTGGAATGAGG - Intronic
985350459 4:189055867-189055889 GCCTTTGAGGGCATGGAGTTTGG - Intergenic
985785668 5:1892662-1892684 CATTCTGATGAAATGGGGTTAGG + Intergenic
988024138 5:25662872-25662894 CACCTTGATGAAATGGATTTGGG - Intergenic
988637903 5:33007210-33007232 CAGTTTAAGGAAATGGTTTTTGG + Intergenic
989232161 5:39099138-39099160 CACCTTGAGGCAAGGGAGCTGGG - Intergenic
989589249 5:43098283-43098305 CACTTTGAGGAAGTGGAGGGTGG - Intronic
991011420 5:61886852-61886874 CACATTGAGGAAAGAGAGTGAGG + Intergenic
991384164 5:66066253-66066275 CACTTTGAATCAATGAAGTTTGG - Intronic
992015408 5:72570223-72570245 CACTTTCATGAAATATAGTTTGG - Intergenic
992511463 5:77440163-77440185 CCCTTCGAGGAGAAGGAGTTGGG - Intronic
993348501 5:86817061-86817083 TACTTTGAGGTAATGAAGTTTGG - Intergenic
995277914 5:110298557-110298579 AACTTTAAGGAAAAGGAATTTGG - Intronic
995637901 5:114216372-114216394 CACTTTGGGAAAATGTAGGTTGG + Intergenic
995987499 5:118196659-118196681 CTCTTTGAGAAGATGGATTTAGG - Intergenic
996149652 5:120020032-120020054 CACTCTCAACAAATGGAGTTGGG + Intergenic
996371481 5:122757796-122757818 CATTGTGAGGAACTGGGGTTAGG - Intergenic
996434477 5:123419698-123419720 AACATTGATGAAATGGGGTTTGG - Intronic
998212853 5:140214379-140214401 CACTCAGAGGTAATGGAGTGAGG + Intronic
998467651 5:142358318-142358340 CACTTTCTGGGAATAGAGTTAGG + Intergenic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
1000478115 5:161737663-161737685 CACTTTGAGTAAATGGATCTTGG + Intergenic
1000545044 5:162588920-162588942 CACTTTGATTAAAGGGATTTTGG + Intergenic
1003857392 6:10290301-10290323 CACTTTGAGGAACAGGATGTAGG - Intergenic
1004299835 6:14447188-14447210 CATTTTGAGGCACTGGGGTTAGG + Intergenic
1004301062 6:14457614-14457636 TACTTAGAGGAAATGAATTTAGG + Intergenic
1005105043 6:22214833-22214855 CATGTTGAGGAAACGTAGTTAGG - Intergenic
1005716295 6:28552371-28552393 CAGTTTGAGGAAATGGTAGTGGG + Intergenic
1006186936 6:32186756-32186778 AAAGTAGAGGAAATGGAGTTGGG + Intronic
1007320600 6:41026361-41026383 CATTTTGAGAAATTGGAGTTGGG + Intergenic
1010124960 6:72420866-72420888 CAGTTAGAGGAAATGAAGGTGGG + Intergenic
1010152487 6:72750187-72750209 CTCTTTTAGGAAATGCACTTGGG - Intronic
1010442164 6:75907117-75907139 CACTGTGTGTGAATGGAGTTTGG + Intronic
1012337085 6:98073571-98073593 CAAAATGAGGAAATGGAGTTGGG + Intergenic
1012735083 6:102928615-102928637 CATTTTGCTGAAATGGTGTTAGG - Intergenic
1012773214 6:103468134-103468156 CAATGTGAAGAAATGGAGTATGG + Intergenic
1012942917 6:105435247-105435269 TACTTTGGGGATGTGGAGTTAGG + Intergenic
1013010068 6:106112338-106112360 CACTTTGAGCAAATGAACTTGGG - Intergenic
1013335980 6:109161974-109161996 GACTTTGAAGAAATTGATTTTGG + Intronic
1013384682 6:109614429-109614451 CAATATGAAAAAATGGAGTTTGG - Exonic
1014382738 6:120763855-120763877 CAGTTACAGGAAATGGAGGTTGG + Intergenic
1016488100 6:144565616-144565638 CTCTTAGAGGAAATGGAGAGAGG + Intronic
1016525668 6:144999122-144999144 AACTCTGAGTAAGTGGAGTTGGG - Intergenic
1016566295 6:145458605-145458627 CATTGTGAGAAAGTGGAGTTTGG + Intergenic
1017207258 6:151816796-151816818 CACTTTGAGGAACTGAAGGGAGG + Intronic
1017573757 6:155778562-155778584 CTCTGTGAGGAAATGGATTTGGG - Intergenic
1018115434 6:160579209-160579231 CACTATGAGTAAATAGAGTAAGG - Intronic
1020660135 7:10972606-10972628 CACCTTGAGAAAATGAAGTATGG + Intergenic
1021644758 7:22778175-22778197 CATTTTGAGAAAATAGATTTAGG + Intergenic
1021794023 7:24235290-24235312 AACTTTGAGGAAATAGAATGTGG + Intergenic
1021914965 7:25422223-25422245 CAGTTTGAGGAAAGTGAGTTGGG + Intergenic
1022654160 7:32303721-32303743 CCCTTTGTGGAAATAGAATTTGG - Intergenic
1022908933 7:34881545-34881567 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1023109965 7:36800020-36800042 TTCTTTGAGGGAATGGAGATAGG + Intergenic
1024149682 7:46558329-46558351 CACATTGAGTAAAGGAAGTTTGG - Intergenic
1025247923 7:57331496-57331518 CACTCTGAGGACAGGGACTTGGG + Intergenic
1026013046 7:66651888-66651910 CATTCTGAGGTATTGGAGTTAGG - Intronic
1026845738 7:73698244-73698266 CACCAGGAGGAACTGGAGTTTGG - Intronic
1027302370 7:76853416-76853438 CACTTTGACGAAACGAAGCTAGG + Intergenic
1028514124 7:91657529-91657551 CACTTTGAGGAATGTGAGTTGGG + Intergenic
1029234395 7:99101572-99101594 CACTTTTCGTAAATGGAGGTGGG + Intronic
1029941161 7:104482109-104482131 CACCTTGAGGAAAAGGAGTGGGG - Intronic
1029966409 7:104745313-104745335 GACTGTGAGGAAATGGAGAAGGG + Intronic
1033260543 7:139840377-139840399 CACTTTTAGGAACCGAAGTTGGG - Intronic
1033633361 7:143183846-143183868 CAGTTTGAGGAAAAGGGGGTAGG - Exonic
1037267057 8:17075169-17075191 TTCTTTGAGAACATGGAGTTGGG + Intronic
1037404660 8:18528798-18528820 CATTTTCAGGAATTGAAGTTAGG + Exonic
1039763254 8:40600694-40600716 CTCATGGAGGAACTGGAGTTTGG - Intronic
1039948739 8:42152163-42152185 CACTTTGGTGAAATGGAGCGTGG - Intergenic
1041003891 8:53480935-53480957 CATTTTGAGGCACTGGGGTTTGG - Intergenic
1042008577 8:64211692-64211714 TACTTTGAGTAGATGGAGTGGGG + Intergenic
1042295832 8:67216601-67216623 CACTTACAGGAGATGGAGGTGGG + Exonic
1042420040 8:68577035-68577057 CACTTTGAGGAGGAGTAGTTAGG - Intronic
1043405235 8:79925380-79925402 CAGTTTGAGGAAATGTGTTTTGG - Intronic
1043629309 8:82308584-82308606 CACTTTGATTTAATGGAGTCAGG - Intergenic
1045695142 8:104800951-104800973 CTCTTTGAGGAGTTGAAGTTTGG + Intronic
1045832235 8:106476488-106476510 CATTTTGTGGAAATGCAGTCAGG - Intronic
1046971731 8:120230565-120230587 CACATTTAGGGAAAGGAGTTCGG - Intronic
1048946164 8:139449499-139449521 CATTTTGAGATAATGGAGATGGG + Intergenic
1049985536 9:947529-947551 CACTTAAAAGAAATGGAGATTGG + Intronic
1051364778 9:16313893-16313915 CACTTTAAGGAAATGGAAGCTGG - Intergenic
1051891011 9:21942959-21942981 CATTTTGAGGTATTGCAGTTAGG + Intronic
1052112229 9:24600723-24600745 CTCTTTGAGAAAATTGAGCTGGG - Intergenic
1052269469 9:26612912-26612934 CATTCTGAGGAACTGGGGTTAGG - Intergenic
1052323184 9:27190335-27190357 CACTTTGAGGATAATGGGTTGGG + Intronic
1052639678 9:31150780-31150802 TTCTTTCAGGAAATGGAGATGGG + Intergenic
1054702814 9:68431178-68431200 GACAGTGAGGAAGTGGAGTTGGG - Intronic
1054750635 9:68902058-68902080 CACAATGAGGAAATTGACTTTGG + Intronic
1055492933 9:76825016-76825038 AAGTTTGAGGAAATGGGGTGGGG - Intronic
1056973032 9:91224644-91224666 CCCTTTCAGGAAATAGTGTTAGG - Intronic
1057157971 9:92860745-92860767 CTCTTTGAGCTAATGCAGTTGGG - Intronic
1058840720 9:108906254-108906276 CATGTTAAGCAAATGGAGTTAGG - Intronic
1060720608 9:125974481-125974503 CAGTTGGAAGAAATGGAGTCAGG + Intergenic
1061247781 9:129409908-129409930 CATTCTGAGGGACTGGAGTTAGG - Intergenic
1062438317 9:136556910-136556932 CCCTTTGAGGAGATGGACCTGGG - Intergenic
1062551411 9:137089007-137089029 TACTTTGAGCAAATGGTGTGGGG + Intronic
1203516632 Un_GL000213v1:7542-7564 CATTTTGAGGAAAGGGAGTCAGG + Intergenic
1186764622 X:12758368-12758390 CACTTTGAGGGAAAAGAGCTGGG + Intergenic
1188277421 X:28217525-28217547 CGAGTTGAGGAAATGGAGCTAGG + Intergenic
1189046855 X:37602127-37602149 CACTGGGAGGGAGTGGAGTTTGG - Intronic
1191212183 X:57897353-57897375 CACTTTCAGCAAATGGTGCTGGG + Intergenic
1193670802 X:84383707-84383729 CACTTTGAGCAACTAGAGTGGGG - Intronic
1194699892 X:97101335-97101357 CACACTGAGGAAATGAAGTTTGG + Intronic
1195000438 X:100638248-100638270 CACTTTGAGGTAAAGTCGTTAGG + Intronic
1195226881 X:102805087-102805109 CACTGTGATGAAATGGAGTAGGG - Intergenic
1195239051 X:102932978-102933000 CACTATGGGGAAGTGGATTTGGG + Intergenic
1197133697 X:123035824-123035846 AACTCTTAGGAAGTGGAGTTGGG - Intergenic
1197318918 X:125003939-125003961 CAGGTTGAGTAGATGGAGTTAGG - Intergenic
1197406934 X:126065157-126065179 CACTTTGAGGCTGTGGAGGTAGG - Intergenic
1198433286 X:136589371-136589393 CACTCTGAGGGAAAGGAGTGAGG + Intergenic
1198932286 X:141874156-141874178 CACATGGAGAAAATGAAGTTAGG + Intronic
1199990027 X:152982356-152982378 CATTCTGAGGTACTGGAGTTAGG + Intergenic