ID: 1112719766

View in Genome Browser
Species Human (GRCh38)
Location 13:102230149-102230171
Sequence CTGTGTTCTCACATGGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3542
Summary {0: 1, 1: 43, 2: 416, 3: 1048, 4: 2034}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112719766_1112719768 -1 Left 1112719766 13:102230149-102230171 CCTTGCACCATGTGAGAACACAG 0: 1
1: 43
2: 416
3: 1048
4: 2034
Right 1112719768 13:102230171-102230193 GCTAGAAGTCACTGTCTATGAGG 0: 1
1: 2
2: 4
3: 36
4: 180
1112719766_1112719769 4 Left 1112719766 13:102230149-102230171 CCTTGCACCATGTGAGAACACAG 0: 1
1: 43
2: 416
3: 1048
4: 2034
Right 1112719769 13:102230176-102230198 AAGTCACTGTCTATGAGGAGTGG 0: 1
1: 0
2: 5
3: 27
4: 202
1112719766_1112719770 5 Left 1112719766 13:102230149-102230171 CCTTGCACCATGTGAGAACACAG 0: 1
1: 43
2: 416
3: 1048
4: 2034
Right 1112719770 13:102230177-102230199 AGTCACTGTCTATGAGGAGTGGG 0: 1
1: 0
2: 8
3: 26
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112719766 Original CRISPR CTGTGTTCTCACATGGTGCA AGG (reversed) Intronic
Too many off-targets to display for this crispr