ID: 1112719766 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:102230149-102230171 |
| Sequence | CTGTGTTCTCACATGGTGCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3542 | |||
| Summary | {0: 1, 1: 43, 2: 416, 3: 1048, 4: 2034} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1112719766_1112719768 | -1 | Left | 1112719766 | 13:102230149-102230171 | CCTTGCACCATGTGAGAACACAG | 0: 1 1: 43 2: 416 3: 1048 4: 2034 |
||
| Right | 1112719768 | 13:102230171-102230193 | GCTAGAAGTCACTGTCTATGAGG | 0: 1 1: 2 2: 4 3: 36 4: 180 |
||||
| 1112719766_1112719769 | 4 | Left | 1112719766 | 13:102230149-102230171 | CCTTGCACCATGTGAGAACACAG | 0: 1 1: 43 2: 416 3: 1048 4: 2034 |
||
| Right | 1112719769 | 13:102230176-102230198 | AAGTCACTGTCTATGAGGAGTGG | 0: 1 1: 0 2: 5 3: 27 4: 202 |
||||
| 1112719766_1112719770 | 5 | Left | 1112719766 | 13:102230149-102230171 | CCTTGCACCATGTGAGAACACAG | 0: 1 1: 43 2: 416 3: 1048 4: 2034 |
||
| Right | 1112719770 | 13:102230177-102230199 | AGTCACTGTCTATGAGGAGTGGG | 0: 1 1: 0 2: 8 3: 26 4: 220 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1112719766 | Original CRISPR | CTGTGTTCTCACATGGTGCA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||