ID: 1112721894

View in Genome Browser
Species Human (GRCh38)
Location 13:102254822-102254844
Sequence CACTGACATAGCTGAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112721888_1112721894 9 Left 1112721888 13:102254790-102254812 CCTGAGGAGCAAAATGGCTCCCA 0: 1
1: 0
2: 2
3: 23
4: 246
Right 1112721894 13:102254822-102254844 CACTGACATAGCTGAAGTCCTGG 0: 1
1: 0
2: 2
3: 19
4: 144
1112721884_1112721894 19 Left 1112721884 13:102254780-102254802 CCAAATGTCCCCTGAGGAGCAAA 0: 5
1: 27
2: 114
3: 391
4: 896
Right 1112721894 13:102254822-102254844 CACTGACATAGCTGAAGTCCTGG 0: 1
1: 0
2: 2
3: 19
4: 144
1112721891_1112721894 -10 Left 1112721891 13:102254809-102254831 CCCAGTTGGGAACCACTGACATA 0: 2
1: 2
2: 26
3: 161
4: 662
Right 1112721894 13:102254822-102254844 CACTGACATAGCTGAAGTCCTGG 0: 1
1: 0
2: 2
3: 19
4: 144
1112721886_1112721894 11 Left 1112721886 13:102254788-102254810 CCCCTGAGGAGCAAAATGGCTCC 0: 1
1: 0
2: 8
3: 42
4: 241
Right 1112721894 13:102254822-102254844 CACTGACATAGCTGAAGTCCTGG 0: 1
1: 0
2: 2
3: 19
4: 144
1112721887_1112721894 10 Left 1112721887 13:102254789-102254811 CCCTGAGGAGCAAAATGGCTCCC 0: 1
1: 0
2: 5
3: 27
4: 216
Right 1112721894 13:102254822-102254844 CACTGACATAGCTGAAGTCCTGG 0: 1
1: 0
2: 2
3: 19
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112721894 Original CRISPR CACTGACATAGCTGAAGTCC TGG Intronic
900187193 1:1338004-1338026 CGCTGCCATAGCTAAAGCCCGGG + Exonic
900368867 1:2322727-2322749 CACTGGTATAGCTGGATTCCTGG - Intronic
901234571 1:7661101-7661123 CACTGAGCTACCTGATGTCCAGG + Intronic
902166445 1:14575643-14575665 CACTGACCTAGTTCAAGTGCTGG - Intergenic
903755802 1:25659654-25659676 CACTGGCAAAGCTGGAGTCCAGG - Intronic
906199093 1:43947711-43947733 CAGTGACAGAGCAGAAGTTCTGG + Intronic
907543767 1:55240910-55240932 TACTGACATATCTGTAATCCAGG + Intergenic
907874765 1:58474815-58474837 CACAGACCTAGCTAAACTCCTGG + Intronic
908167423 1:61472119-61472141 CACTGACATGGTTAAATTCCTGG - Intergenic
909623373 1:77689370-77689392 CACTGACATTGTTGAGGTCAAGG + Intergenic
909893274 1:81034967-81034989 CATGGACACAGCTGAAGTCAAGG + Intergenic
910168625 1:84354366-84354388 CTCTGACTTAACTGAAGTGCAGG - Intronic
910725554 1:90334403-90334425 GACAGACAAAGCTGAAGACCAGG - Intergenic
912823848 1:112887861-112887883 CACTGGCATGGCTGTGGTCCAGG - Intergenic
913319722 1:117579702-117579724 CAGTGACAGAGGTGAAGTGCTGG + Intergenic
914717762 1:150266241-150266263 CACTGACACAGGGGGAGTCCTGG + Intronic
915974393 1:160375410-160375432 CAGTGACAGAGCAGAAGTCAAGG + Intergenic
918023726 1:180721263-180721285 CACTGACATTGGTGAAATCCAGG + Intronic
919447047 1:197719950-197719972 AAATCACATAGCTGAAGTCTGGG + Intronic
920455800 1:206100160-206100182 CACTGACATAGCAGCAGCCACGG - Intronic
922450267 1:225731763-225731785 CAATGGCATAGCTGAATTCCAGG + Intergenic
922571452 1:226636738-226636760 CACACACAGAGCTGCAGTCCTGG - Intronic
1066960376 10:42217158-42217180 CACTGGCCGAGGTGAAGTCCGGG + Intergenic
1067565282 10:47331712-47331734 CACTGTCACAGCTGGAGGCCAGG - Intergenic
1068752642 10:60612761-60612783 CACTCACCTAACTGAATTCCTGG + Intronic
1068935575 10:62632615-62632637 CACTGAGCTGGCTGAAGCCCAGG - Intronic
1072607311 10:96995428-96995450 CACTAACATAGTAGAAATCCAGG - Intergenic
1076885783 10:133261816-133261838 CACCGCCATAGCTGAGGTCCCGG + Intergenic
1078869086 11:15327418-15327440 AAATGACGAAGCTGAAGTCCAGG + Intergenic
1079171992 11:18105565-18105587 CACTGTCATTTCTGAAGCCCAGG - Intronic
1079172845 11:18112745-18112767 CTCTGGCATCGCTGTAGTCCAGG + Intronic
1079186792 11:18245505-18245527 CTCTGGCATTGCTGTAGTCCAGG + Exonic
1080090195 11:28338783-28338805 CATTACCAAAGCTGAAGTCCTGG - Intergenic
1081966857 11:47175504-47175526 CTCTGATATGACTGAAGTCCAGG + Intronic
1088054631 11:105560039-105560061 CACAGCCAAAGCAGAAGTCCTGG - Intergenic
1088418110 11:109612217-109612239 CACATACATAGCTGTAGTACAGG + Intergenic
1088720457 11:112587784-112587806 CTCTGACAGAGGTGAAGTTCCGG + Intergenic
1089297231 11:117477133-117477155 CACTGGCAAAGCTGAAGACTTGG - Intronic
1094293947 12:28882398-28882420 CATTGGCTTAGCTGAAGTCATGG + Intergenic
1096683080 12:53269807-53269829 AGCTGACATAGCTGAAGGCTAGG - Exonic
1100588309 12:95999767-95999789 CACTGACGGTGCTGCAGTCCTGG + Intergenic
1101213586 12:102559384-102559406 CACTGATGTAGCTGATGTCTTGG + Intergenic
1101294420 12:103406360-103406382 AAAAGACATAGCTGAAGCCCTGG + Intronic
1104974116 12:132544477-132544499 CCCTGGCGTAGGTGAAGTCCTGG - Intronic
1105296163 13:19089521-19089543 CTATGATATAGCTGAAGTCCAGG + Intergenic
1107103782 13:36622388-36622410 CCCTGACAAACTTGAAGTCCAGG - Intergenic
1109094022 13:58088160-58088182 CACTGTCATATCAGAAGTTCAGG - Intergenic
1112209625 13:97362810-97362832 TACTGCCACATCTGAAGTCCTGG - Intronic
1112721894 13:102254822-102254844 CACTGACATAGCTGAAGTCCTGG + Intronic
1113449435 13:110396470-110396492 CCCTGCCTCAGCTGAAGTCCAGG - Intronic
1118310986 14:64692907-64692929 CACACACATAACTGAAATCCTGG + Intergenic
1119884935 14:78132231-78132253 CTCAGACATGGCTGAAGTTCAGG - Intergenic
1121249635 14:92489928-92489950 CACTGACAGACCAGAAGTCCAGG + Intronic
1121615931 14:95313816-95313838 CACTGAAATAGCTGAGGCTCTGG - Intronic
1122160844 14:99782663-99782685 CTCTGGTATAGCTGGAGTCCTGG + Intronic
1122381082 14:101307696-101307718 CATTAACACAGCTGAAGTGCAGG - Intergenic
1202931918 14_KI270725v1_random:45547-45569 CACTGGCCTAGGTGAAGTCCAGG - Intergenic
1132840690 16:1977263-1977285 CCTTGAGACAGCTGAAGTCCTGG - Exonic
1134153646 16:11824662-11824684 CACCAACATAACTCAAGTCCCGG + Intergenic
1134556394 16:15169243-15169265 CATTGACATATCTGTAGTCAAGG - Intergenic
1134916975 16:18080949-18080971 CATTGACATATCTGTAGTCAAGG - Intergenic
1142498234 17:317708-317730 AAATGAGGTAGCTGAAGTCCTGG + Intronic
1143886432 17:10068324-10068346 CACTGACCCAGATGAAGCCCTGG + Intronic
1149360097 17:55886103-55886125 CTCTGAGATAACTGAACTCCTGG - Intergenic
1149614030 17:57982950-57982972 CACTGGCATAGCTGTGGTGCTGG + Exonic
1149894114 17:60415700-60415722 CCCTGTCATAGCTGGAGTGCTGG - Intronic
1152645588 17:81467170-81467192 CACTGAGATCACTGAAGTCAGGG - Intergenic
1156239510 18:35239449-35239471 CACTCAAATTGCTGAAGTCTTGG - Intergenic
1157828522 18:50834903-50834925 CAATTACATAGCTCAAGTCGGGG - Intergenic
1161726379 19:5931587-5931609 CACTCACATAGCTGAGGGGCTGG + Intronic
1165470783 19:36003354-36003376 CATTGACATAGCTGAGCACCAGG + Exonic
1166351137 19:42198932-42198954 CACTGATGTGGCTGAAGCCCAGG + Exonic
1166366879 19:42282286-42282308 CACTGACAGAGCTGAAGGAATGG - Intronic
925787766 2:7449448-7449470 CACTGACACAGGAGAAGTCCTGG - Intergenic
927464657 2:23328142-23328164 CACAGACATAGCTGTGGACCTGG - Intergenic
932403100 2:71495765-71495787 CACTGACATAGGGGAAGGCCCGG + Intronic
932802041 2:74749582-74749604 CACAGACTGAGCTGAAATCCTGG - Intergenic
934462897 2:94230640-94230662 CACTGGCCGAGCTGAAGTCTGGG - Intergenic
936374021 2:111925660-111925682 AAGTGACATCACTGAAGTCCGGG - Intronic
938668962 2:133568718-133568740 CACTGGAATAGCTGGAGACCTGG + Intergenic
938704255 2:133907211-133907233 CACAGGTATTGCTGAAGTCCAGG + Intergenic
941441734 2:165546103-165546125 GACAGACCTAGCTGCAGTCCAGG - Intronic
947846713 2:233250704-233250726 CTCTTACATACCTGAAGTCAGGG - Intronic
948227661 2:236324055-236324077 AGCTGAGATAGCTGGAGTCCAGG - Intergenic
948324408 2:237101477-237101499 CGCTGACATAGCAAAACTCCAGG - Intergenic
1169022179 20:2338650-2338672 CAGTGACAGAGCTGAGGTTCAGG - Intronic
1171418316 20:24998810-24998832 CACTGACCTAGCTGATGTGTGGG - Intergenic
1172601148 20:36183872-36183894 CACAGTCAGAACTGAAGTCCTGG - Intronic
1172938943 20:38641446-38641468 CACAGACCTAGATGCAGTCCAGG - Intronic
1176593947 21:8673692-8673714 CACTGGCCTAGGTGAAGTCCAGG - Intergenic
1178104488 21:29302390-29302412 CACTAACATAACTGAAGTCTGGG + Intronic
1178216185 21:30601171-30601193 CACAGCCATAGCTGCAGCCCAGG - Exonic
1179153898 21:38832883-38832905 CACAGACATAGTTGAAGTGCTGG - Intergenic
1180116526 21:45709445-45709467 CACTGACATTGCAGAGGTCACGG - Intronic
1180276801 22:10650819-10650841 CACTGGCCTAGGTGAAGTCCAGG - Intergenic
1180694654 22:17744039-17744061 CTCTGGCCTGGCTGAAGTCCCGG - Intronic
1182239421 22:28903199-28903221 GACTGACAGAGCTTAAGGCCTGG - Intronic
1182923952 22:34105323-34105345 CACTGACCTAGCTGAGGTCCAGG + Intergenic
949422079 3:3876661-3876683 CACTGAAATAGTTGAAATCTTGG + Intronic
950422760 3:12908406-12908428 CGCTGGCATAGCTGTCGTCCAGG + Exonic
951829142 3:26904739-26904761 TACTGTCTTAGCTGAAATCCAGG - Intergenic
954638476 3:52084495-52084517 CACTGACACAGCTGCAGCACCGG + Intronic
960567298 3:119147131-119147153 CACTGAACTAGCTGAACACCAGG + Exonic
961663035 3:128480502-128480524 CTCTGAAATAGCCGAACTCCAGG - Exonic
967314040 3:188133982-188134004 CACTGACATAACTGACGGCCTGG - Intergenic
968883859 4:3317022-3317044 CACTGACAAGGCTGGAGTCGTGG + Exonic
973204591 4:47546176-47546198 CACTGACATTGCTGTTGTCAAGG - Intronic
974233684 4:59152164-59152186 CACATACATAGCTGAAGGCTTGG - Intergenic
974414277 4:61584458-61584480 CATTGACATAGCTGTAATCTGGG - Intronic
975248159 4:72144268-72144290 AACTGACATATAAGAAGTCCAGG - Intronic
976388418 4:84484712-84484734 CAGTCACACAGCTGAACTCCGGG - Intergenic
982817894 4:159908747-159908769 CACTGACATGGATGAAGTCATGG - Intergenic
983699297 4:170571917-170571939 CACTGAAATATTTGAAGTACAGG - Intergenic
984832134 4:183985775-183985797 AACAGACATATCTGTAGTCCTGG - Intronic
985166529 4:187100925-187100947 CATTGACATAGCTGATCTCCTGG + Intergenic
987733504 5:21807479-21807501 TTCTTACATTGCTGAAGTCCAGG + Intronic
988740922 5:34069911-34069933 CACTGATAGAGCTGAAGCCTGGG - Intronic
990000383 5:50885149-50885171 CAGTCACAATGCTGAAGTCCTGG + Intergenic
990619087 5:57540516-57540538 CACTGACATCACTGGACTCCTGG - Intergenic
992859077 5:80893378-80893400 GTCTGCCATACCTGAAGTCCTGG - Intergenic
993811225 5:92478918-92478940 GACTTACTTAGCTGAAGTCAGGG - Intergenic
997124545 5:131212634-131212656 CACTGACACTGATGTAGTCCTGG - Intergenic
997459305 5:134041529-134041551 CACTCACAGCGCTGATGTCCAGG - Intergenic
1001707408 5:173751394-173751416 CACTGACATCACTGCGGTCCAGG + Intergenic
1002655174 5:180740292-180740314 GACTGACCTGGGTGAAGTCCTGG - Intergenic
1002671906 5:180874236-180874258 CACTGACCTGCCTGAACTCCTGG + Intergenic
1006406822 6:33850277-33850299 CACTGCCACGGCTCAAGTCCTGG - Intergenic
1009195789 6:60683064-60683086 CACTGAAGTAGGGGAAGTCCTGG - Intergenic
1011263393 6:85491098-85491120 CACAGACATACCTGAACACCTGG + Intronic
1016926090 6:149349715-149349737 CACTGACATATCTGAGGTTAAGG + Intronic
1021397367 7:20166825-20166847 CACTGGCAGAACTGAAGTTCAGG + Intronic
1023256045 7:38313304-38313326 CACAGCCAGAGCTGATGTCCAGG + Intergenic
1024663441 7:51521283-51521305 CAGTGACCTAGCTGAAGGTCAGG - Intergenic
1026792552 7:73344048-73344070 CACTGAAAGACCTGAAGGCCAGG - Intronic
1027700571 7:81465081-81465103 CTCTGACAGTTCTGAAGTCCGGG - Intergenic
1029551283 7:101238340-101238362 CACTGACAGAGCAGAAGCTCAGG - Exonic
1030319448 7:108148683-108148705 CACTTACATAGGTAAAGTCTTGG + Exonic
1035959333 8:4119606-4119628 CACAGACAGAGCAGAAGTCCTGG - Intronic
1037420105 8:18693036-18693058 CGCTGACATATGTGAAGGCCGGG + Intronic
1039543885 8:38393700-38393722 CTCTAACATAGATGAAGTCTAGG + Intronic
1040378351 8:46848233-46848255 CACGGCCATTGGTGAAGTCCTGG + Intergenic
1041128218 8:54666975-54666997 CAGTGCCATATCTGAGGTCCAGG - Intergenic
1042657538 8:71116312-71116334 CAATGAAATAGATGAAGTCTAGG + Intergenic
1043382832 8:79721712-79721734 AACTGAAATAGCTGGAGTCACGG + Intergenic
1045962048 8:107979810-107979832 CACTGCCTTAGCTGAAGTCCCGG + Intronic
1049361442 8:142214126-142214148 CTCTGACATAGCCAAGGTCCAGG + Intronic
1052387253 9:27836357-27836379 GACTGAAATAGCTGAAGGCCAGG + Intergenic
1053940091 9:43239309-43239331 CACTGGCCGAGGTGAAGTCCGGG - Intergenic
1055964146 9:81849092-81849114 CACAGAGGCAGCTGAAGTCCAGG + Intergenic
1056060493 9:82880807-82880829 CAGTGAGATAGCTGCAGTCTAGG - Intergenic
1056602298 9:88055599-88055621 TACAGACACATCTGAAGTCCTGG + Intergenic
1057187304 9:93063985-93064007 CACTGACCTACAAGAAGTCCGGG - Intronic
1058832956 9:108835758-108835780 CACTAACAATGCTGAGGTCCAGG + Intergenic
1060054786 9:120404016-120404038 CAGGTACAAAGCTGAAGTCCAGG - Exonic
1060238513 9:121883888-121883910 CAGTGTCAGAGCTGAAGCCCAGG - Intronic
1060528386 9:124333334-124333356 CACAGCCCTAGCTGCAGTCCAGG + Intronic
1061570662 9:131475805-131475827 CACTGGCAGAGCAAAAGTCCAGG + Exonic
1061608313 9:131728630-131728652 CTCTAAGAAAGCTGAAGTCCAGG - Intronic
1062190324 9:135244721-135244743 CCCTGACGGAGCTGAATTCCAGG + Intergenic
1203624082 Un_KI270749v1:153922-153944 CACTGGCCTAGGTGAAGTCCAGG - Intergenic
1186066680 X:5773965-5773987 CACTGACATTGCCAAGGTCCGGG + Intergenic
1190707613 X:53043707-53043729 AACTGAGATAGCAGGAGTCCAGG + Intergenic
1191008602 X:55737877-55737899 CACTGCTATAGCTCAGGTCCAGG + Intronic
1193971542 X:88061436-88061458 CACAAAAATAGCTGAAATCCAGG - Intergenic
1195675338 X:107503360-107503382 CACTGACTTAGCTAATTTCCAGG - Intergenic
1200869083 Y:8077701-8077723 CACTGCCATGGGTAAAGTCCTGG - Intergenic