ID: 1112721986 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:102255930-102255952 |
| Sequence | GGCATGCTTGATGGTGGGAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 144 | |||
| Summary | {0: 1, 1: 1, 2: 1, 3: 10, 4: 131} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1112721980_1112721986 | 9 | Left | 1112721980 | 13:102255898-102255920 | CCTCTAAACTTAATGTCAGGAAA | 0: 1 1: 0 2: 0 3: 8 4: 223 |
||
| Right | 1112721986 | 13:102255930-102255952 | GGCATGCTTGATGGTGGGACTGG | 0: 1 1: 1 2: 1 3: 10 4: 131 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1112721986 | Original CRISPR | GGCATGCTTGATGGTGGGAC TGG | Intronic | ||