ID: 1112721986

View in Genome Browser
Species Human (GRCh38)
Location 13:102255930-102255952
Sequence GGCATGCTTGATGGTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112721980_1112721986 9 Left 1112721980 13:102255898-102255920 CCTCTAAACTTAATGTCAGGAAA 0: 1
1: 0
2: 0
3: 8
4: 223
Right 1112721986 13:102255930-102255952 GGCATGCTTGATGGTGGGACTGG 0: 1
1: 1
2: 1
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112721986 Original CRISPR GGCATGCTTGATGGTGGGAC TGG Intronic