ID: 1112722881

View in Genome Browser
Species Human (GRCh38)
Location 13:102265141-102265163
Sequence ATGGAGGATGAGAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1132
Summary {0: 1, 1: 1, 2: 9, 3: 89, 4: 1032}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112722881_1112722884 0 Left 1112722881 13:102265141-102265163 CCTTTCTCATTCTCATCCTCCAT 0: 1
1: 1
2: 9
3: 89
4: 1032
Right 1112722884 13:102265164-102265186 CAAAACTTCCCTCCAAAACAAGG 0: 1
1: 0
2: 1
3: 20
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112722881 Original CRISPR ATGGAGGATGAGAATGAGAA AGG (reversed) Intronic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901829326 1:11882500-11882522 AAGGAGGAGGTGAATGAGAGGGG - Intergenic
902476104 1:16688709-16688731 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
903061568 1:20672320-20672342 ATGGATGGTGGGGATGAGAATGG - Intronic
903198538 1:21713047-21713069 AGGGAGGGAGGGAATGAGAAAGG - Intronic
903350659 1:22714526-22714548 GTGGGGGTTGAGACTGAGAATGG + Intronic
903379030 1:22884196-22884218 ATGGAGCCTGTGAATGAAAAAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904599269 1:31664842-31664864 ATGGAGGAGTAGAATGTGATAGG - Intronic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
905513325 1:38541823-38541845 AGGGAGAGTGAGAGTGAGAATGG + Intergenic
905688549 1:39926317-39926339 TTGGAGGATGAGTGTGAGAGAGG - Intergenic
905869560 1:41395277-41395299 ATGGAGTGAGAGAAAGAGAAAGG + Intergenic
905934682 1:41813989-41814011 GAGGAGGCTGAGATTGAGAAAGG - Intronic
905980561 1:42222001-42222023 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
907044133 1:51289365-51289387 AAGGAGGGATAGAATGAGAAGGG - Intronic
907319073 1:53591527-53591549 ATAGAGGCTAAGAATGATAATGG - Intronic
907350163 1:53822886-53822908 ATAGAGGGTCAGAATGGGAATGG + Intronic
907953358 1:59205264-59205286 ATGGAAGCTGAGAATCAGGAAGG + Intergenic
908351339 1:63288311-63288333 AAGGAGGAAGAGAGAGAGAATGG + Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908548563 1:65186678-65186700 TTGGTGGATGAGACTAAGAATGG + Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908897809 1:68920331-68920353 ATGAAGAATGAGAAAGGGAATGG - Intergenic
909584467 1:77274153-77274175 ATGGAGTACTAGAATAAGAATGG - Intergenic
909745851 1:79096284-79096306 AGAGAGGATGAGAGAGAGAAGGG - Intergenic
910333042 1:86097660-86097682 AAGGAGGAGGAGGAGGAGAAGGG - Intronic
910521552 1:88127532-88127554 AAGGAGGATAAGAATGGTAATGG - Intergenic
911094259 1:94042935-94042957 GTGGAGGGTGAGGAAGAGAAAGG + Intronic
911228695 1:95336602-95336624 AAAGGGGATGAGAATGAAAATGG - Intergenic
911600599 1:99844351-99844373 ATGGAAGAAGAGAAGAAGAAGGG - Intergenic
911784670 1:101931486-101931508 AGGGAGGAAGACAATGACAAAGG - Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
912097172 1:106159917-106159939 AAGGAGGATGAGAAGAACAAAGG - Intergenic
912226906 1:107744180-107744202 TGGGACGAAGAGAATGAGAATGG - Intronic
912410808 1:109479614-109479636 TTGGAGGAGGAGGAAGAGAAAGG - Exonic
912489307 1:110052991-110053013 ACAGAGGAGGAGAATGAAAAAGG - Intronic
913085164 1:115430107-115430129 ATGGAGAAAGAGAATGGGAGGGG - Intergenic
913612355 1:120520568-120520590 ATCGAGGAAGACAAGGAGAAGGG - Intergenic
913708854 1:121458738-121458760 ATAAAGGAAGAGAAAGAGAAAGG - Intergenic
914578834 1:149001670-149001692 ATCGAGGAAGACAAGGAGAAGGG + Exonic
914698355 1:150107019-150107041 AGGTAGGAGGAGAATCAGAAGGG - Intronic
914962899 1:152222120-152222142 AAGTAGGAAGAGAAAGAGAAGGG + Intronic
915008866 1:152665984-152666006 ATGGAGGGTTAGATAGAGAAAGG - Intergenic
915012049 1:152696709-152696731 ATGAAGGAAGAGAATGGGATGGG - Intergenic
915035667 1:152921997-152922019 GTGGAGTATGAGAATGATTAGGG - Intergenic
915090471 1:153420733-153420755 AGGTGGAATGAGAATGAGAAAGG - Exonic
915095019 1:153456370-153456392 AGGTGGAATGAGAATGAGAAAGG + Intergenic
915100886 1:153499133-153499155 ATGTAGGGTGGAAATGAGAAGGG - Intergenic
915129861 1:153688663-153688685 AAGGAGGTGGAGAATGACAAGGG - Intronic
915162397 1:153929736-153929758 ATGGAGAGTGAGAAAGGGAAGGG - Exonic
915389282 1:155526818-155526840 ATGGATGATGTGAGAGAGAAAGG - Intronic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
916349440 1:163832329-163832351 ATGGAGAACTAGAAAGAGAAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
917163669 1:172087011-172087033 AAGGAAGATGAAAAAGAGAATGG - Intronic
917344445 1:174014458-174014480 ATGTGGGAAGAAAATGAGAATGG + Intronic
917685163 1:177408402-177408424 CTGAAGGATGAGAGTGAGCAGGG - Intergenic
917710855 1:177682682-177682704 AAGCAAAATGAGAATGAGAAAGG - Intergenic
917779032 1:178371563-178371585 ATGGAGGAGGAGGAGAAGAAAGG + Intronic
918582203 1:186144638-186144660 ATGGAGGAAGGAAATGCGAAGGG + Exonic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919669595 1:200326974-200326996 AGGAAGGAAGAGAAAGAGAAAGG - Intergenic
919691476 1:200532015-200532037 ATGGGGGAAGAGACTGGGAAGGG + Intergenic
920022075 1:202963845-202963867 TTAGAGGATGAGAATGCTAAAGG - Intronic
920169881 1:204065363-204065385 AGGGAGGAGGAGGAAGAGAAGGG - Intergenic
920612771 1:207457709-207457731 TTGGAAGATGAGAATGATAATGG - Intronic
920682464 1:208083476-208083498 AGGCAGGATGAGAAAGAAAAGGG - Intronic
920997085 1:211003647-211003669 AAGGAGGAAGAGGAGGAGAAAGG + Intronic
921185819 1:212668584-212668606 AGGGAGAATGAGAGAGAGAATGG + Intergenic
921353801 1:214265254-214265276 ATGGAGGAGGAGGAAGAGAGTGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921922823 1:220687939-220687961 AAGGAAGATGAGAGAGAGAAGGG + Intergenic
922359689 1:224810214-224810236 ATGGAGGAAGAGAATTGCAAAGG + Intergenic
922647198 1:227300652-227300674 ATGGAGGTGGAGACTCAGAAGGG + Intronic
923373869 1:233340492-233340514 ATTTAGAATGAGATTGAGAAGGG + Intronic
923484988 1:234420946-234420968 TAGGAGGATGAGAAAAAGAATGG + Intronic
924029111 1:239868785-239868807 ATGAATTCTGAGAATGAGAACGG + Intronic
1062985540 10:1765270-1765292 CAGGAGCATGAGACTGAGAATGG - Intergenic
1063235359 10:4109141-4109163 AGAGAGGATGAGAAAAAGAAGGG + Intergenic
1063235598 10:4112322-4112344 ATGGAAAATGAGGATAAGAAGGG + Intergenic
1063290268 10:4738628-4738650 AAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1063647449 10:7899228-7899250 ATGGAGGGACCGAATGAGAACGG - Intronic
1063972190 10:11389007-11389029 GGGGAGGAAGAGACTGAGAATGG - Intergenic
1064121741 10:12624958-12624980 AAGGAGGAAGAGAAGGAGAAGGG - Intronic
1064561143 10:16596368-16596390 TTGGAGGATGAGGAATAGAATGG - Intronic
1064754033 10:18558753-18558775 ATGGAGGTTGTTAAGGAGAATGG + Intronic
1064754074 10:18559049-18559071 ATGGAGGATGGTATGGAGAATGG + Intronic
1064754297 10:18560571-18560593 ATGGAGGATGGTATGGAGAATGG + Intronic
1064754345 10:18560890-18560912 ATGGAGGATGGTATGGAGAATGG + Intronic
1064754389 10:18561216-18561238 ATGGAGGATGGAATGGAGAATGG + Intronic
1064754439 10:18561578-18561600 ATGGAGGATGGAATGGAGAATGG + Intronic
1064755228 10:18567139-18567161 ATGGAGGATGTAATGGAGAATGG - Intronic
1064755273 10:18567463-18567485 ATGGAGGATGGTATGGAGAATGG - Intronic
1064755329 10:18567865-18567887 ATGGAGGATGGTATGGAGAATGG - Intronic
1064755533 10:18569273-18569295 ATGGAGGATGGTATGGAGAATGG - Intronic
1064755559 10:18569438-18569460 ATGGAGGTTGGTAAGGAGAATGG - Intronic
1064755588 10:18569601-18569623 ATGGAGGTTGGTAAGGAGAATGG - Intronic
1064755723 10:18570514-18570536 ATGGAGGATGGAATGGAGAATGG - Intronic
1064755768 10:18570786-18570808 ATGGAGGATGGTATGGAGAATGG - Intronic
1064755915 10:18571779-18571801 ATGGAGGATGGTATGGAGAATGG - Intronic
1064857999 10:19793240-19793262 AGGAAGAATGAGAAAGAGAAGGG + Intergenic
1064886042 10:20113752-20113774 ATGGAGGAAAAAATTGAGAAGGG - Intronic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065259721 10:23912027-23912049 ATGGAAGAGGAGGAAGAGAAGGG - Intronic
1065311144 10:24416919-24416941 ATGGAGGAGGAGTCTGGGAAGGG - Intronic
1065845388 10:29738773-29738795 ATGGGGGATGACAATGACATGGG - Intergenic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067207467 10:44232096-44232118 TTGGAGTATGAGAAGGAGACGGG - Intergenic
1067268777 10:44771839-44771861 GTGGGAGATTAGAATGAGAACGG + Intergenic
1067807543 10:49403743-49403765 AGGGAGGGGGAGAAAGAGAAAGG - Intergenic
1067807555 10:49403807-49403829 AGGGAGGGAGAGAAAGAGAAAGG - Intergenic
1067807565 10:49403871-49403893 AGGGAGGGAGAGAAAGAGAAAGG - Intergenic
1068451933 10:57201775-57201797 AAAGAGGATGAGAAAGAAAAGGG - Intergenic
1068838385 10:61581622-61581644 AAGGAGGAAGGGAAGGAGAAAGG + Intergenic
1068911212 10:62380290-62380312 AAGGAGGAGGAGAAACAGAAGGG - Intronic
1069262174 10:66412563-66412585 TGGGAGGCTGAGAAGGAGAATGG - Intronic
1069340048 10:67399087-67399109 GAGGAGGAGGAGAAAGAGAAAGG + Intronic
1069834432 10:71299645-71299667 ACGGAGGAAGAAAACGAGAACGG - Exonic
1070114667 10:73516912-73516934 AAGGAGGCTTAGAATCAGAAGGG + Exonic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070574837 10:77670239-77670261 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574844 10:77670273-77670295 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574851 10:77670303-77670325 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574867 10:77670359-77670381 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574876 10:77670394-77670416 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574911 10:77670528-77670550 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574918 10:77670563-77670585 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070574926 10:77670597-77670619 AGGGAGGGAGAGAATGAGAGAGG + Intergenic
1070651518 10:78240245-78240267 ATGGAGGGAGAGAAAGAGAGGGG - Intergenic
1071042485 10:81330316-81330338 ATGGAGGAAAAGAGGGAGAAGGG + Intergenic
1071129732 10:82376785-82376807 AGTGAGGATGAGAAGGAAAAGGG - Intronic
1071178518 10:82955832-82955854 ATGGAACATGAGATTGAGAAAGG - Intronic
1071213604 10:83372935-83372957 GTAGAGGCTGAGACTGAGAAAGG + Intergenic
1071786854 10:88910537-88910559 ATGTAGCATCAGAATTAGAAGGG - Intronic
1071860634 10:89669107-89669129 AAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1072236873 10:93461141-93461163 CTTCAGGATGAGAATGAGACAGG - Intronic
1072749786 10:97969437-97969459 AGAGAGGAGGAGAAAGAGAAAGG - Intronic
1073422007 10:103432003-103432025 TTGGAGGGTGAGTATGAGTAGGG + Intronic
1073788750 10:106918593-106918615 ATAGAGGAGGAGAGGGAGAAAGG + Intronic
1074294907 10:112176573-112176595 AGGGAGGAAGAAAAAGAGAATGG - Intronic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1075348671 10:121704287-121704309 GTGGAGGGAGAGAAAGAGAAGGG + Intergenic
1075602181 10:123777789-123777811 ATGGGGGATGGGAGAGAGAAGGG - Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1076116489 10:127905374-127905396 ATGGAGGATGTGGAAGAGAGTGG + Intergenic
1076146733 10:128127736-128127758 TGGGAGCATGAGAATGAGAAGGG - Intergenic
1076173272 10:128341270-128341292 AAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076870886 10:133193598-133193620 AAGGAGGAAGAGAAGAAGAAAGG + Intronic
1076889262 10:133275948-133275970 ATGGAGGAGGAGAATGGAAACGG - Intronic
1077348775 11:2079450-2079472 AGGGAGGAAGAGAAGGAGAGAGG - Intergenic
1077383236 11:2257235-2257257 AGGGAGGCTGAGACAGAGAAGGG + Intergenic
1077563570 11:3281736-3281758 AGGGAGGAGGAGAATCAGAGAGG - Intergenic
1077569460 11:3327551-3327573 AGGGAGGAGGAGAATCAGAGAGG - Intergenic
1077573443 11:3357815-3357837 AAGGAGGGAGAGAAAGAGAAAGG + Intronic
1078391528 11:10939187-10939209 ATGAAGGATGAGAGTGAGCAGGG - Intergenic
1078515656 11:12019941-12019963 ATGGAGCATGACAATGATAGAGG - Intergenic
1078545486 11:12244007-12244029 ATGGAGGATGAGTATGAGACAGG - Exonic
1078836663 11:15036693-15036715 AAGGAGGAGGAGAGAGAGAAAGG - Intronic
1079186537 11:18243320-18243342 AGGGAGGATGAGAGAAAGAATGG - Intronic
1079517295 11:21284315-21284337 CTGGAGCATGAGAGTGTGAAAGG + Intronic
1079567855 11:21904618-21904640 ATGGAGAAAGGGAAGGAGAATGG + Intergenic
1079784056 11:24648664-24648686 GTGGAGGCTGTGAATCAGAATGG + Intronic
1079802148 11:24882817-24882839 AGGGAGGGAGGGAATGAGAAGGG + Intronic
1079915999 11:26369408-26369430 AAGGATGAGGAGAATGAGTAGGG - Intronic
1079948585 11:26773428-26773450 ATGTAGGCTGAAAATGAAAAAGG - Intergenic
1079993025 11:27266551-27266573 ATTGGGGATGAGAATGAATAAGG - Intergenic
1080769824 11:35330307-35330329 CTGGAGGTTGAAAGTGAGAAAGG - Intronic
1081192271 11:40118716-40118738 CCTGAGGACGAGAATGAGAAAGG + Intronic
1081937630 11:46916532-46916554 ATAGAGGATGGGGGTGAGAATGG - Intronic
1082192569 11:49265242-49265264 AAGGAGGAAGAGAGGGAGAAGGG + Intergenic
1082655386 11:55849685-55849707 ATAGTGGATGAGAAATAGAAGGG - Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082963423 11:58940975-58940997 ATAGAGGCAGAGAATGACAATGG + Intronic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1083592229 11:63902569-63902591 AGGGAGGATGGGAATGGGTAAGG - Intronic
1084190154 11:67495035-67495057 ATGGGAGATGAGAATGGGACGGG - Intronic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084726750 11:70946835-70946857 AGGGAGGATGAGCCTGGGAAGGG - Intronic
1084804010 11:71566298-71566320 ATGGATGATGAGCTGGAGAAGGG - Exonic
1084963652 11:72732185-72732207 ATAGAGCCTGAGAATGAGAAAGG + Intronic
1085442017 11:76573899-76573921 AAGAAGGAGGAGAAAGAGAATGG - Intergenic
1085810888 11:79680071-79680093 AAGGAGGAGAAGAAAGAGAAAGG - Intergenic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086074244 11:82833362-82833384 ATGGAAAAAGAGGATGAGAAAGG + Intronic
1086208388 11:84287702-84287724 ATGGAGGGAGAGAAGGAGAGAGG - Intronic
1086213896 11:84353944-84353966 ATGGAGGAGAGGAATGAGAGTGG - Intronic
1086376218 11:86203509-86203531 ATGGAGGGTGAAAAATAGAAAGG - Intergenic
1087058980 11:93960166-93960188 ATCGATGAAGAGAGTGAGAAAGG - Intergenic
1087462141 11:98458863-98458885 ATGGAGGAAAAGAGAGAGAAAGG - Intergenic
1087694184 11:101356836-101356858 AAGGAGGAATAGGATGAGAAGGG - Intergenic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088592688 11:111416880-111416902 CTGGAGGATAACAATGATAATGG - Intronic
1088674187 11:112175704-112175726 GAGGAGGATGAGGAAGAGAAAGG - Intronic
1088765261 11:112969295-112969317 ATGGAAACTGAGACTGAGAAAGG + Intronic
1088883693 11:113991007-113991029 GTGGAGGATGAGACTAAGGAGGG + Intergenic
1089410176 11:118234475-118234497 TTAGAGGATGAGAATGAGTTAGG + Intronic
1089478889 11:118790148-118790170 ATGGGGGCTGAGGAAGAGAAAGG + Intronic
1089625644 11:119749132-119749154 ATGGAAGAGGTGAAGGAGAAGGG - Intergenic
1089640273 11:119843314-119843336 AGGGGAGATGAGAATGAGCAGGG - Intergenic
1090531007 11:127591736-127591758 AGGGAGGGAGAGAAGGAGAAAGG + Intergenic
1090561522 11:127937977-127937999 ATAGAGGATGAGGATGTGACTGG - Intergenic
1090573485 11:128073263-128073285 ATGGAGGATGAGAAGATAAAAGG - Intergenic
1090869438 11:130730051-130730073 ATAGAGAATGAGAAAGAAAAAGG - Intergenic
1091280360 11:134378274-134378296 ATGGAGGATGAGGGTGAGTCGGG - Intronic
1091615164 12:2045382-2045404 AGGGAGGTTGAGGATCAGAATGG + Intronic
1091625949 12:2121166-2121188 ATGGAGGGGGAGAAAGAGACGGG - Intronic
1091896482 12:4109284-4109306 AAGGAGGAAGAGGAGGAGAATGG + Intergenic
1092266648 12:6986231-6986253 AAGGAGGAGGAGAAAGAGAAAGG - Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093028687 12:14268199-14268221 ATGAAGGTTGAAAATGTGAAAGG + Intergenic
1094583065 12:31752146-31752168 AGATAGGATGAGAATGAGACAGG + Intergenic
1095900769 12:47325724-47325746 AAAGAGAATGAGAATGAGATAGG + Intergenic
1095960162 12:47829214-47829236 AAGGAGAATGAGACAGAGAAGGG + Intronic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1098095353 12:66948739-66948761 ATGGAAGAAGAGAAAGAAAAAGG + Intergenic
1098280034 12:68853561-68853583 ATGGAGAGTGAGAACGACAAAGG - Exonic
1098877274 12:75879091-75879113 ATGGAAGGTGAGAATTGGAAAGG - Intergenic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099300155 12:80883131-80883153 GTGAAGGATGAGAAGGAGAGAGG - Intronic
1099344044 12:81475815-81475837 CTGGAGGCTGAGAAGGAGAATGG - Intronic
1099621158 12:85004424-85004446 ATAGAGCATGAGAATGAGCAGGG - Intergenic
1099716726 12:86303921-86303943 ATAGAGGTTGAGAGAGAGAAAGG - Intronic
1100098755 12:91076627-91076649 AAGGAAGAGGAGAATGAGAGAGG + Intergenic
1100325396 12:93535296-93535318 AAGGAGGAGGAGATAGAGAAAGG + Intergenic
1100731105 12:97470447-97470469 GAGGAGGAAGAGAATGACAATGG + Intergenic
1100784723 12:98066795-98066817 AAGGAGGATAAGGATAAGAAGGG - Intergenic
1101541627 12:105670780-105670802 ATGGAGTATGAGAAGGAGGTAGG - Intergenic
1102374471 12:112410358-112410380 CCGGAGGACGGGAATGAGAAAGG - Intronic
1102705667 12:114878298-114878320 ATGGAGGAAGAAAAGAAGAAAGG - Intergenic
1103223443 12:119266247-119266269 AAGGAGGAAGAGGAGGAGAAAGG - Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103578984 12:121900152-121900174 CTGAATGATGAAAATGAGAATGG + Intronic
1104163145 12:126200257-126200279 GGGGAGGCTGAGAAGGAGAATGG - Intergenic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104616394 12:130273472-130273494 AAGGGGGAGGAGAAAGAGAAGGG - Intergenic
1104806686 12:131593913-131593935 CTGGAAGATGAGAATGTCAAAGG + Intergenic
1105544612 13:21342412-21342434 AGGGAGCAAGAAAATGAGAAGGG - Intergenic
1105869271 13:24489682-24489704 ATGGATTTTGAGAATGATAAAGG + Intronic
1106161896 13:27208661-27208683 AAAGAGGAGGAGAAAGAGAAAGG + Intergenic
1106380771 13:29236720-29236742 GTGGAGGAAGAGAGAGAGAAAGG + Intronic
1106463424 13:29992281-29992303 CAGGAGCAAGAGAATGAGAAGGG - Intergenic
1106490873 13:30220483-30220505 ATGGATGAAGAGAAAAAGAATGG + Intronic
1106591945 13:31105577-31105599 GAGGGGGTTGAGAATGAGAATGG - Intergenic
1106630254 13:31464552-31464574 ACTGAGGATGAGCATGAGAATGG - Intergenic
1106713272 13:32360877-32360899 AGAGAGGAGGAGAATAAGAATGG + Intronic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1106880168 13:34120518-34120540 ATGTAAGATGATAATGAAAAAGG - Intergenic
1106947082 13:34840395-34840417 AAGGAGGAAGAGAAGGATAAAGG + Intergenic
1107568412 13:41630370-41630392 ATGGAGGGTGAGACTGAGTTGGG - Intronic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107830446 13:44370462-44370484 CTGGAGGCTGAGTATAAGAAGGG + Intergenic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1107936748 13:45351787-45351809 GAGGAAGATGAGAACGAGAAGGG + Intergenic
1108029473 13:46214142-46214164 ATGGAAGAGGAAACTGAGAAGGG - Intronic
1108462690 13:50682918-50682940 GTAGAGGATGAGAAAGAGAGAGG - Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1108579821 13:51818916-51818938 AGTGAGTAAGAGAATGAGAAGGG + Intergenic
1108622974 13:52202008-52202030 AGGGAGGCTGATGATGAGAAAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108928808 13:55788907-55788929 AAGGAAGAAGAGAAGGAGAAAGG - Intergenic
1109253004 13:60043453-60043475 AGGGAGGCAAAGAATGAGAAAGG + Intronic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109408353 13:61931353-61931375 AGGGAGGGAGAGAATGAGAGAGG - Intergenic
1109654144 13:65367511-65367533 TTGGAGGATAAGAATGACAGAGG + Intergenic
1109729147 13:66387578-66387600 AGGAAGGATGAGACGGAGAAAGG - Intronic
1109841057 13:67916657-67916679 ATGGAGAGTGATAATGAGCATGG - Intergenic
1110361193 13:74627424-74627446 GTGGAGGATTAGAAAAAGAAAGG - Intergenic
1111674855 13:91374797-91374819 ATGGAGGAAGAAAGGGAGAATGG + Intergenic
1111873065 13:93858688-93858710 AAAGAGTATGAGAATGAGAATGG + Intronic
1111893004 13:94106532-94106554 AGGGAGGATGGGAAGGAGAGAGG + Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112191075 13:97178214-97178236 ATGGAGGATGACACTGAGAATGG + Intergenic
1112694075 13:101927878-101927900 AGGGAGGATGAGACTCAGACAGG + Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1112722881 13:102265141-102265163 ATGGAGGATGAGAATGAGAAAGG - Intronic
1112932136 13:104753972-104753994 ATGGAAGATGAGGATGAAAAGGG - Intergenic
1113236268 13:108278610-108278632 AGGGAGGAGGAGGAAGAGAAGGG - Intronic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113516467 13:110906284-110906306 ATGGAGGATGAGAACGAACCAGG + Intronic
1113585121 13:111459637-111459659 AGGGAGAAAGAGAAAGAGAAGGG + Intergenic
1113616820 13:111686074-111686096 ATGATGGATAAAAATGAGAAAGG - Intergenic
1113622350 13:111771345-111771367 ATGATGGATAAAAATGAGAAAGG - Intergenic
1114186220 14:20404423-20404445 ATGGAGAATGTGATTGAGAAGGG - Intronic
1114414041 14:22527494-22527516 ATTGAGGGAGAGAATAAGAAAGG + Intergenic
1115906881 14:38210618-38210640 AAAGAGGGGGAGAATGAGAAGGG + Exonic
1116171047 14:41402887-41402909 ATGGAAGAAGTAAATGAGAAAGG + Intergenic
1117036911 14:51739576-51739598 ATGAATGATGAGAATAAAAATGG - Intergenic
1117226551 14:53666624-53666646 ATTGAAGATGAGACTGGGAAGGG - Intergenic
1117334126 14:54742321-54742343 ATAGAGGAGGAGAAATAGAATGG + Intronic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1118821204 14:69347255-69347277 ACAGAGGAGGAGAATGAGTAGGG - Intronic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1119141261 14:72269384-72269406 ATGGAGGGAGAAAGTGAGAAAGG - Intronic
1119368285 14:74114412-74114434 ATGGATGATGGCAGTGAGAATGG + Intronic
1119552274 14:75523629-75523651 ATGTCGGATGAGAAAGAGGAGGG - Intronic
1119555140 14:75547246-75547268 AAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1119687420 14:76643769-76643791 ATGCAGGATGTGAATTATAATGG - Intergenic
1120272518 14:82331673-82331695 AAGGAGGATGGGAATGTAAAGGG - Intergenic
1120274504 14:82354486-82354508 TTGGAGGATGAGCTTGAGGATGG - Intergenic
1121009503 14:90511773-90511795 CGGGATGATGACAATGAGAATGG - Intergenic
1121167954 14:91825551-91825573 GTGGAAGATGAGCAAGAGAAGGG - Intronic
1121178391 14:91908323-91908345 ATGAAGACTGGGAATGAGAAAGG - Intronic
1121557320 14:94848260-94848282 TTGGAGGATGAGAATGAGAACGG + Intergenic
1121714742 14:96065578-96065600 TTGGAGGAAGAGAGAGAGAAGGG - Intronic
1122437226 14:101708418-101708440 AGAGAGGGTGAGAAAGAGAAAGG + Intergenic
1122448191 14:101783003-101783025 AGGGAGGAAGAGAAAGAGAGAGG - Intronic
1123772997 15:23547961-23547983 ATGGCTGGTGAGAATGAGGAAGG - Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124036164 15:26055077-26055099 TTGGGGGATGAGTATGAGCATGG + Intergenic
1125050742 15:35295520-35295542 ATGGAGGAAGACAATGAAAGTGG - Intronic
1125375252 15:39021912-39021934 AAGGAAACTGAGAATGAGAAAGG + Intergenic
1125470091 15:39993924-39993946 ATGTTGGATGAGAATTAGGAAGG + Intronic
1125470099 15:39993975-39993997 ATGTTGGATGAGAATGAGGAAGG + Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125751851 15:42034572-42034594 TAAGAGGATGAGAATGAGACTGG - Intronic
1126480057 15:49109336-49109358 ATGGATGATGAGGAGGAAAAAGG + Intronic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1127035154 15:54907809-54907831 CGGGAGGATGAGCAGGAGAATGG + Intergenic
1127046439 15:55030889-55030911 ATAGAGGTTGAGAAAGAGACTGG + Intergenic
1127076392 15:55330586-55330608 ATGGAAGAAGAGAAGAAGAAGGG + Intronic
1127112046 15:55684801-55684823 ATGAAGGAACAGGATGAGAAAGG + Intronic
1127762851 15:62156353-62156375 ATTGAGCATGAAGATGAGAAGGG - Intergenic
1127807866 15:62537692-62537714 ATGATGGATGAGAATGTTAAAGG + Intronic
1128044032 15:64601223-64601245 ATGGACGATGAGGCTGAGGAAGG + Intronic
1128361915 15:66968138-66968160 ATGGAGGTTTAGAGTGAGGATGG + Intergenic
1128413684 15:67423885-67423907 AAGGAGAGTGAGAAAGAGAAAGG + Intronic
1128862490 15:71085643-71085665 AGGTAGGTTGAGACTGAGAACGG - Intergenic
1129752294 15:78074601-78074623 AGGGAGGATGTGATTGGGAATGG - Intronic
1129990612 15:79959313-79959335 TTGGAGGAAGAGAAGGAAAAAGG + Intergenic
1130159648 15:81385740-81385762 AAGGGGGATGAGAATGTGATTGG + Intergenic
1130533223 15:84763760-84763782 ATGCAGGATTAGAGTGAGAATGG + Intronic
1130873925 15:87995655-87995677 ATGAAAGATGAGACAGAGAAAGG + Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131037394 15:89232079-89232101 ATGTAGGATGAGAATGATCTAGG + Intergenic
1131057735 15:89385643-89385665 GTGGAGGATAAGAATGACAGAGG + Intergenic
1131060003 15:89398776-89398798 ATGGAGGTTGAGAAGGAGCGTGG - Intergenic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133094620 16:3434207-3434229 ATGGGGGATGAAATTGGGAAAGG - Exonic
1133815152 16:9191555-9191577 AGTGATGATGAGAATGATAATGG + Intergenic
1133897618 16:9944431-9944453 ATGGAGGATGATGATGACAGAGG - Intronic
1133968774 16:10551823-10551845 AATGGGGATGAGAATGAGCATGG - Intronic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134388168 16:13793772-13793794 ATGAAAGAAGAGAATGGGAAGGG + Intergenic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1135904706 16:26500960-26500982 AAGGGAGAAGAGAATGAGAAGGG + Intergenic
1136168233 16:28470711-28470733 GTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136309489 16:29397839-29397861 CTGGAGGAGGAGAAGAAGAAAGG + Intronic
1136429220 16:30187260-30187282 ATGGTGGATAAGAAGGATAAAGG - Intronic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137396644 16:48120321-48120343 ATGGAGGATGAGAGGGCGCACGG + Intronic
1137693279 16:50444702-50444724 ATGGAGGTTGAGCAAGTGAAGGG - Intergenic
1137707381 16:50545054-50545076 TTGGGGGAGGAGAATGGGAAAGG - Intergenic
1137725736 16:50655425-50655447 AGTGAGGATCAGAATGAGCAGGG - Intergenic
1137899668 16:52253261-52253283 AAGGAAGATGAGAATCAGAGTGG - Intergenic
1138153941 16:54685787-54685809 AAGGAGGAGGAGAAAGGGAAGGG - Intergenic
1138207007 16:55132649-55132671 GTGGAGGATGGGAAGGAGAGAGG + Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138459233 16:57138210-57138232 ATGGAGGTGGAAGATGAGAAAGG - Intronic
1138900684 16:61265475-61265497 AGGGAGGAAGAGAATAAGAGGGG - Intergenic
1139195078 16:64908766-64908788 ATGGAGGGTGACAGTCAGAAGGG + Intergenic
1140028686 16:71316076-71316098 CTGGAAAATGAGGATGAGAATGG + Intergenic
1140049062 16:71463403-71463425 ATGGAGGGTAGGAATGGGAAGGG - Intronic
1140176923 16:72670780-72670802 ATGCATGTTGAGAAAGAGAACGG - Intergenic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140648495 16:77061401-77061423 ATATTGGATGTGAATGAGAATGG + Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141348482 16:83270927-83270949 AGGGAGGAAGGGAAAGAGAAAGG - Intronic
1141458397 16:84160830-84160852 GTGGAGGCTGAGGAGGAGAATGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1141883470 16:86875236-86875258 AGGGAGGAAGAGAAACAGAAAGG - Intergenic
1142108696 16:88319626-88319648 ATGGTGGATGGGGAGGAGAAGGG - Intergenic
1142615988 17:1135503-1135525 ATTGAGGATGGGAATGAGAGAGG + Intronic
1143114733 17:4576123-4576145 ATGGATGATGAAGAGGAGAAGGG - Intergenic
1143256036 17:5558765-5558787 TTGGAGGATGAGAAGGGGAGAGG - Exonic
1143391289 17:6560774-6560796 GAGAAGGAGGAGAATGAGAAAGG - Intergenic
1143628343 17:8123341-8123363 AGGGAGGACGAGACTGAGAGAGG - Intronic
1143642638 17:8207834-8207856 ATGGAGCCTGAGAAGGAGCAGGG + Exonic
1144114870 17:12078177-12078199 AGGGAGGATGAAGAGGAGAATGG + Intronic
1144152879 17:12467513-12467535 GAGAATGATGAGAATGAGAAGGG + Intergenic
1144214466 17:13043154-13043176 ATGGAGCAAGAGAAAGAGGAGGG + Intergenic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144647488 17:16985284-16985306 ATGGTGGAAGAGCAGGAGAATGG - Intergenic
1144899707 17:18573506-18573528 TTAGAGGCTGAGACTGAGAAAGG + Intergenic
1145104935 17:20107052-20107074 TGGGAGGATGAGAATCAGGAAGG + Intronic
1145957896 17:28867536-28867558 ATGGAGGGTAAGGATTAGAATGG - Intergenic
1146079695 17:29767504-29767526 TAAGATGATGAGAATGAGAATGG - Intronic
1146290544 17:31603476-31603498 CTGGAGGATGAGAAGGGGCAGGG - Intergenic
1146297194 17:31659270-31659292 AGGGAGGAGGAGAGGGAGAAAGG + Intergenic
1146714047 17:35068789-35068811 ATGGAGGAGGAGGAGGAGAAAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146821674 17:35987808-35987830 ATGGAAGCTGGGAATCAGAAAGG + Intronic
1146826057 17:36024059-36024081 ATGGAGGGTGAGCAGGAGCAGGG - Intergenic
1146924772 17:36736552-36736574 CTGCAGGGTGAGAATGAGAAAGG + Intergenic
1146973184 17:37089249-37089271 ATAAAGGAAGAGAAGGAGAAGGG - Intronic
1146987349 17:37232897-37232919 ATGGAGGAGGAGGAGGACAAGGG - Intronic
1147120557 17:38332959-38332981 GTGGAGGATGCGAAGGAGTAGGG + Intronic
1147870548 17:43584142-43584164 GTGCAGGGTGAGGATGAGAAAGG - Intergenic
1148558315 17:48591691-48591713 GAGGAGGAGGAGAATGAAAAGGG + Exonic
1148638269 17:49165675-49165697 AGGGAGGAAGAAAATGAGAGAGG - Intronic
1148769712 17:50059902-50059924 AGGGAGAGAGAGAATGAGAAAGG - Intronic
1148870940 17:50658540-50658562 ATGGAAGGTGAGATGGAGAAAGG + Intronic
1149319808 17:55471429-55471451 ATGGAGGATTATACTGAGATAGG - Intergenic
1149368698 17:55971166-55971188 AATGAGAATGAGAATGAGAATGG + Intergenic
1149695753 17:58614929-58614951 TTGTAGCATGAGAATCAGAAGGG + Intronic
1151447711 17:74178016-74178038 ATTGAGGGTAAGAAAGAGAACGG + Intergenic
1152589418 17:81204076-81204098 CTGGAGGATTAGAAACAGAAGGG + Intronic
1153144729 18:2018548-2018570 ATAGAGGATAAGAATAATAATGG - Intergenic
1153274344 18:3353153-3353175 AGGGAGGGAGAGAAGGAGAAAGG - Intergenic
1153604450 18:6817738-6817760 AGGGAGAATGGGAAAGAGAAAGG + Intronic
1154031501 18:10757329-10757351 ATGGAGGATGAGAAGAGGAATGG + Intronic
1154124143 18:11674633-11674655 GTGGAGCAAGAGAAAGAGAAAGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156565323 18:38182440-38182462 ATGCAGGATTAGAATTAAAAGGG - Intergenic
1156680187 18:39578822-39578844 AATCAGGATGAGAATAAGAATGG - Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1157373255 18:47138058-47138080 AGGGAGGCTGAGAATGAGGCAGG + Intronic
1157408080 18:47440546-47440568 AGGGAGGATGAGAGAGAGAGAGG + Intergenic
1157418791 18:47527533-47527555 ATGGAGGAGGAGACTGAGCTGGG + Intergenic
1157728412 18:49983277-49983299 ATGGAGGACCAGAACCAGAAAGG - Intronic
1157775827 18:50395326-50395348 AAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1158001793 18:52628074-52628096 ATAGAGAATGAGAATTGGAAAGG - Intronic
1158046353 18:53160010-53160032 AAGGAGGATGAGGAAGAGAAAGG + Intronic
1158052137 18:53234889-53234911 AAGGAGGAAGAGAAGAAGAAAGG - Intronic
1159033672 18:63256769-63256791 ATGGAAGATGTGCAGGAGAAGGG - Intronic
1159096047 18:63903132-63903154 ATGGTGGATGTGAATGAGGAGGG + Exonic
1159222744 18:65486281-65486303 ATGGAGAATGAACAGGAGAAGGG + Intergenic
1159333190 18:67029014-67029036 CTGGAGGCTGAGGAGGAGAATGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159491498 18:69140743-69140765 ATGGAGCAAGAGAAGAAGAAGGG + Intergenic
1160050049 18:75424860-75424882 ATGGAAGATGAGAAGTACAAGGG + Intronic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1162028512 19:7907501-7907523 GGTGAGGATGAGAAAGAGAACGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1163779723 19:19239972-19239994 AGGGAGGATGGGGAAGAGAAAGG - Intronic
1164367725 19:27604365-27604387 ATTGAGGATGATGATGAAAAAGG + Intergenic
1165300016 19:34962941-34962963 GTGGAGGGTGAGAAAGAGGAGGG - Intronic
1165863322 19:38920463-38920485 AGGGAGGAGGAGAATCAGAGAGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166146309 19:40838741-40838763 AAGGAGGAAGAGATGGAGAAAGG - Intronic
1166644148 19:44518797-44518819 GTGGAGGATGAGACTGGGATGGG - Intronic
1166929046 19:46290172-46290194 AGGGAGGCTGAGAGAGAGAAGGG - Intergenic
1167104573 19:47422389-47422411 AAGGAGGATGAGGAGGAGGACGG - Intergenic
1167197643 19:48041710-48041732 ATGGAGGAGGAGAGAGAGAATGG - Intronic
1167290502 19:48622487-48622509 AGGGAGGAGGAAAAGGAGAAAGG - Intronic
1167631291 19:50627805-50627827 ATGGAGAGAGAAAATGAGAAGGG + Intronic
1167633052 19:50637757-50637779 AAGGAGGAAGAGATGGAGAAGGG + Exonic
1167691871 19:50990209-50990231 ATTGGGGATGGAAATGAGAATGG - Intergenic
1167725931 19:51212480-51212502 ATGGGGGCTGAGGATGGGAATGG - Intergenic
1167779928 19:51592688-51592710 GGGGAGGAGGAGAAGGAGAAGGG + Intergenic
1202710123 1_KI270714v1_random:14562-14584 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
925096367 2:1207573-1207595 GAGGTGGAGGAGAATGAGAAGGG + Intronic
925217525 2:2110398-2110420 TTGGAGGATGAATATGAGGAGGG - Intronic
925217559 2:2110571-2110593 AGGGAGGAAGAGAAGGAGAGAGG - Intronic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925566076 2:5256022-5256044 ATGGAGGATGGAAAGGAGCAAGG - Intergenic
926591007 2:14740285-14740307 ATGGAGGAGGAAAAGGAAAAAGG + Intergenic
926862571 2:17324442-17324464 ATGGATGAGGAGAATGGGGATGG - Intergenic
927452051 2:23217184-23217206 GTGGAGGATACCAATGAGAAAGG - Intergenic
927649376 2:24902647-24902669 GAGGAGGAGGAGAAAGAGAAGGG - Intronic
928269293 2:29841974-29841996 ATGGAGGAAGGAAAGGAGAAGGG - Intronic
928786459 2:34892546-34892568 GTGGTGGATGAGAATGGGATGGG - Intergenic
929013602 2:37472337-37472359 GAGGAGGAAGAGAAGGAGAAAGG + Intergenic
929175364 2:38970188-38970210 ATGGAGGGTGATGATGAGAAGGG - Intronic
929301106 2:40304581-40304603 AAGGAGGCTGACAATGGGAAAGG - Intronic
929413948 2:41728449-41728471 TTGGAGGATGAGATTGAGGTAGG + Intergenic
929817069 2:45241360-45241382 AGGGAAGATGACAATGAGATGGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930254301 2:49071799-49071821 ATGAAGGATGAGGAAGGGAAGGG + Intronic
930387733 2:50718839-50718861 ATGGAGGATGAGAGGGAGAGAGG - Intronic
930937417 2:56970554-56970576 ATGGTGGAAGACAATGAGATTGG + Intergenic
931078007 2:58737929-58737951 AGAGAGGAAGAGAAAGAGAAAGG + Intergenic
931121151 2:59221497-59221519 GTGGAAAATGAGAATGGGAATGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931162610 2:59709840-59709862 GAGGAGGAGGAGAAAGAGAAAGG - Intergenic
931421331 2:62130474-62130496 ATGGAGGGTGAGAGTGGGAAAGG - Intronic
931528016 2:63179482-63179504 CTGGAGAAGGAGAAAGAGAAGGG - Intronic
931686254 2:64796652-64796674 AGGTAGGAGGAAAATGAGAAGGG + Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932706651 2:74031227-74031249 ACGGAGGAGGAAAAGGAGAATGG + Intronic
932843907 2:75115284-75115306 ATGGGGGAAAATAATGAGAATGG - Intronic
933043588 2:77503318-77503340 ATGGAGTATGAGGGTGAGGATGG + Intronic
933234550 2:79850402-79850424 AGGGAGGGAGAGAAGGAGAAAGG - Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG + Intergenic
933649280 2:84836739-84836761 ATTCAGTATGAGAAAGAGAAAGG - Intronic
935345926 2:102108404-102108426 ATGGATGATGAGAATGCAATAGG - Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936379409 2:111970751-111970773 AGGGAGGAGGAGGAGGAGAAGGG - Intronic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936523040 2:113224030-113224052 ATGGAGGAATAGATTGAAAAGGG + Intronic
936639733 2:114298534-114298556 AAGGAGGAAGAGAAGGAGAGTGG + Intergenic
936654271 2:114466692-114466714 ATGGATGATAATAATAAGAATGG - Intronic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937341444 2:121093612-121093634 AAGGAGGAGGAGGAGGAGAAGGG + Intergenic
937345955 2:121125431-121125453 AAGGAGGACGAGGAGGAGAAGGG + Intergenic
937533216 2:122854917-122854939 ATGTAGAATGATAGTGAGAAAGG - Intergenic
937686812 2:124706847-124706869 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
937837335 2:126485088-126485110 AAGGAAGATAAGAATGAAAAGGG - Intergenic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938161931 2:128993665-128993687 AAGGTGGATGAGGATGAGGAAGG + Intergenic
938262964 2:129908440-129908462 ATTGAGGATGAGAGAGAGGAAGG - Intergenic
938952400 2:136267038-136267060 ATGGAGGGTGAGCAGGAGCAGGG - Intergenic
939301993 2:140354797-140354819 ATGGTGGAAGAAAATTAGAAGGG - Intronic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
940669194 2:156646901-156646923 ATGGAGGCTGAGGATGATAGTGG + Intergenic
940867221 2:158829480-158829502 ATGGAGGATGAATACGGGAAGGG + Intronic
941228859 2:162883805-162883827 ATGGAGGAGGAGAGAAAGAAAGG - Intergenic
941312454 2:163951078-163951100 AGGAAAGATGAGAGTGAGAATGG - Intergenic
941502727 2:166300078-166300100 ATGGTAGATGGGAATAAGAAAGG - Intronic
941588224 2:167385843-167385865 TTGGAGGATGAGGATTAAAAGGG + Intergenic
941644469 2:168025170-168025192 ATCAAGGGAGAGAATGAGAAGGG - Intronic
942165731 2:173238998-173239020 ATGGAGGATGCAAATGTGGATGG - Intronic
942303507 2:174584992-174585014 AAGGAGGATGTGAATGTGTATGG + Intronic
942471499 2:176265420-176265442 CAGGAGGAAGAGAAAGAGAAGGG - Intergenic
942529149 2:176889632-176889654 ATGCAGGCTGAGAATGGCAATGG + Intergenic
943353313 2:186821132-186821154 ATGCAAGTTGATAATGAGAAAGG + Intergenic
943427719 2:187757768-187757790 AAGGAGGTAGAGAAAGAGAAAGG - Intergenic
943679103 2:190749080-190749102 CTGGAGGATGAGAGTGAGGCTGG + Intergenic
943683193 2:190789360-190789382 ATGGAGGAAGAAAAGGAAAAGGG + Intergenic
943784596 2:191863226-191863248 TTGAAGGATGAAAAAGAGAATGG - Intergenic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
945976268 2:216273604-216273626 GTGGAAGAAGAGAATGTGAATGG - Intronic
946105233 2:217363409-217363431 AGTGGGGATAAGAATGAGAAGGG - Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946167407 2:217873434-217873456 ATGGAGGATGTGAAAGACAGGGG + Intronic
946263816 2:218521058-218521080 AAGGAGGAAGAGAGTGAGAAGGG - Intronic
946349214 2:219137713-219137735 ATGGAAAATAAGAATAAGAATGG - Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946807504 2:223485880-223485902 ATGGTGGAAGGGAAGGAGAAAGG - Intergenic
946891600 2:224282654-224282676 ATCCAGGAGGAGAATGAAAAGGG + Intergenic
947158441 2:227187285-227187307 AGGGAGGATGAGGGTGAGGATGG + Intronic
947319896 2:228905408-228905430 TTGGATGATGTGAAAGAGAAGGG + Intronic
947543884 2:230996978-230997000 ATGGAGGATGAGAAGGATCAGGG + Intronic
947841413 2:233210151-233210173 ATGGAGGAAGAGCATGAGCTGGG - Intronic
948477007 2:238226811-238226833 TTGGAGGATGAGACAGAGGAGGG - Intronic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948646804 2:239410368-239410390 ATGGAGGAGGAGCAAGATAATGG + Intergenic
948778072 2:240300278-240300300 GGGGAGCATGAGAATGACAAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168814314 20:726348-726370 ATGAGGGATAAGAATGTGAATGG + Intergenic
1169273498 20:4217967-4217989 AGGGAGTTTGTGAATGAGAAAGG - Intergenic
1170059513 20:12244684-12244706 GTGGAGAATGAGGAGGAGAAAGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170634803 20:18094890-18094912 AAGGAGGAGGAGGAAGAGAAGGG - Intergenic
1171036286 20:21714956-21714978 AGGGAGGAAGGGAAAGAGAAAGG - Exonic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172387865 20:34546754-34546776 ATGGAGGATGGGGATGGCAAAGG + Intergenic
1173826593 20:46051690-46051712 ATGGAGGCAGAGAAGGTGAAGGG + Exonic
1173905579 20:46626285-46626307 AGGGAGGAGGAGAGAGAGAAAGG - Intronic
1174118536 20:48244841-48244863 ATGGTGGATGAGAAGGGGGATGG - Intergenic
1174308727 20:49633877-49633899 AGGGGAGAGGAGAATGAGAAGGG + Exonic
1174692084 20:52516098-52516120 AAGGAGGAAGGGAAGGAGAAAGG + Intergenic
1174866175 20:54137824-54137846 AGGAAGGAAGAGAATGAAAATGG - Intergenic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1175342506 20:58242807-58242829 ATGGAGGATTAAAATGAGGGAGG - Intergenic
1175382672 20:58574629-58574651 ATGGAGGAAGGGAATGAGGGAGG - Intergenic
1175479915 20:59303385-59303407 ATGCAGGATAAGAATCAGAAAGG - Intronic
1177249368 21:18572253-18572275 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1177855143 21:26392343-26392365 ATGTAGGTTGATAATGAGTAAGG - Intergenic
1178243104 21:30925323-30925345 AAGAAGGATGAGGAAGAGAAAGG - Intergenic
1178402919 21:32302716-32302738 ATGGAGTAAGGGAATAAGAACGG + Intronic
1178510077 21:33197655-33197677 AAGGAAGTTGAGAATGAGAGAGG + Intergenic
1178800555 21:35790967-35790989 GAGAAGGATGACAATGAGAAGGG - Intronic
1178848150 21:36190869-36190891 ATGGAGGATGGAGATGAGAAAGG + Intronic
1179270025 21:39843689-39843711 AGGGAGGAGGAGAAGGAGAGAGG + Intergenic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179951880 21:44712831-44712853 ATGGAGGGAGGGAAGGAGAAAGG + Intergenic
1180872092 22:19151899-19151921 ATTGAGGGTGAGAATGGGAAAGG - Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181759969 22:25051580-25051602 GAGGAGGATGAGAAAGGGAAGGG - Intronic
1181759972 22:25051586-25051608 GGGGAGGAGGAGGATGAGAAAGG - Intronic
1181887580 22:26033804-26033826 AGGGAGGAAGAGAAAAAGAAAGG - Intergenic
1181887585 22:26033844-26033866 AGGGAGGAAGAGAAAAAGAAAGG - Intergenic
1181887590 22:26033884-26033906 AGGGAGGAAGAGAAAAAGAAAGG - Intergenic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182008190 22:26978963-26978985 ATGGAGGATGGGATTGAGGTAGG - Intergenic
1182122094 22:27794884-27794906 GGGGAGGATGAGAAGGGGAAGGG + Intronic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182277696 22:29200966-29200988 AAGCAGGAGGAGAATGAGAGTGG - Intergenic
1182741484 22:32571214-32571236 AAGGAGGATGAGAAGGGGAGGGG - Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182931365 22:34177307-34177329 TTTGAGGATGGGAAGGAGAAAGG - Intergenic
1183068103 22:35377586-35377608 ATGGAGGATGAGGCTGGGCACGG - Intergenic
1183375861 22:37464664-37464686 AGGGAGGAATGGAATGAGAATGG - Intergenic
1183821933 22:40353284-40353306 AAGGAGGAAGAGAAGAAGAAAGG - Intronic
1184013628 22:41768674-41768696 AAGGAGGAAGAGAGTGAAAAGGG + Intronic
1184103018 22:42351481-42351503 CTGGAGGATGAGCAGGACAAAGG - Intergenic
1184186962 22:42871430-42871452 ATGGAGGACGAGGATGAGCAGGG - Exonic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184449683 22:44575628-44575650 GAGGAGGATGACAAGGAGAAGGG + Intergenic
1184600212 22:45539056-45539078 GAGGAGGAGGAGAAGGAGAAAGG - Intronic
949113780 3:295032-295054 AAGGAAGAGGAGAAGGAGAAAGG - Intronic
949230168 3:1741505-1741527 CTACAGGTTGAGAATGAGAAAGG + Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
949704038 3:6795011-6795033 GTGGAAAATGAAAATGAGAAAGG - Intronic
949901832 3:8821522-8821544 ATGGAGGATGAGAAGGAAGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950488470 3:13286640-13286662 ATGGAGGAGGAAACAGAGAAAGG + Intergenic
950593273 3:13954843-13954865 ATGAAGGAAGAGAATCATAAGGG - Intronic
950962399 3:17119803-17119825 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
951051554 3:18099401-18099423 AGTGAGGAAGAGTATGAGAAAGG - Intronic
951676522 3:25247619-25247641 ATGGAGGATGAGCAGAAGCAGGG - Intronic
951923498 3:27881139-27881161 ATAGAGGAGGAGACTGAGACTGG - Intergenic
952240826 3:31530268-31530290 ACGGACGAGGAGAAGGAGAATGG - Intergenic
952461956 3:33536828-33536850 ATGGAGGATGAGAAAAACAGAGG + Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
952871832 3:37907533-37907555 GTGGAGGAGGTGAAGGAGAAAGG + Intronic
953012212 3:39037790-39037812 ATGGGGGATAGAAATGAGAATGG + Intergenic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
954498087 3:50983678-50983700 GTGGAGGATGAGCAAGACAAAGG - Intronic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
955300221 3:57771191-57771213 GAGGAGGAGGAGAAAGAGAAGGG - Intronic
955834606 3:63041068-63041090 ATGTAGGAAGAGAATCAGAGGGG + Intergenic
956356343 3:68397071-68397093 ATGGAGGAAAAAAAGGAGAAAGG + Intronic
956552873 3:70481278-70481300 TTGGAGGAAGAGAAGGAGTAGGG + Intergenic
956769217 3:72510264-72510286 ATGGAGGATGGGAGGGAGGAAGG + Intergenic
956874632 3:73449990-73450012 CTGGAGGACGATGATGAGAAGGG + Intronic
957218446 3:77351456-77351478 ATTGATCATGAGAATGAGAAAGG + Intronic
957578755 3:82043505-82043527 AGAGAGAGTGAGAATGAGAATGG + Intergenic
957690264 3:83556955-83556977 ATGGAGAATGAGGAAAAGAAGGG - Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
957969874 3:87368982-87369004 ATGGAAGATCAGAATCAGGAGGG - Intergenic
959589311 3:108060070-108060092 TTGGAGGATGGGAATGTGAGTGG - Intronic
959986750 3:112581703-112581725 ATGGTGGAAAAGAAAGAGAAAGG - Intronic
960057560 3:113286084-113286106 ATGGAGGAAGACAATGGGATGGG - Intronic
960255969 3:115512025-115512047 AAGAAGAATGAGGATGAGAAGGG + Intergenic
960603286 3:119479262-119479284 ATGGATGAGCAAAATGAGAAGGG - Intronic
960633339 3:119755509-119755531 ATGGAGGAAGAGAGGGAGAAAGG - Intronic
961488250 3:127232546-127232568 ATGCAGGATGAGATTGAGGAGGG - Intergenic
961633058 3:128315441-128315463 ATGGAGGCTGAGAGAGAGTAAGG + Intronic
961916477 3:130380418-130380440 AGGGAGGAAGAGAAAGAGAGAGG - Intronic
962156591 3:132954843-132954865 AGGGATGATGAGAATAACAAAGG - Intergenic
962388254 3:134950606-134950628 ATGGAGCAAGAGAGAGAGAAGGG + Intronic
962603158 3:137010674-137010696 ATGTATGATGAGAATGATCAAGG + Exonic
962770423 3:138606252-138606274 AAGGAGGAGGAGCAGGAGAAAGG + Intergenic
963047076 3:141110369-141110391 ATAGAGGCTGAGAATGGGAGAGG + Intronic
963060563 3:141221533-141221555 AAGGGGAATGAGACTGAGAAGGG + Intergenic
963512405 3:146264112-146264134 ATGGAGGGTCAGAGTGAGACAGG + Intergenic
963727568 3:148939339-148939361 AAGGAGGAAGAAAAAGAGAAGGG + Intergenic
963765389 3:149329645-149329667 GAAGAGGATGAGAAGGAGAATGG + Intronic
963928198 3:150974050-150974072 AAGGAGGAGGAGGAGGAGAAAGG + Intergenic
963974762 3:151468322-151468344 ATTTAAAATGAGAATGAGAAAGG - Intergenic
964534490 3:157704763-157704785 AGAGAGGATGAGAATAAGGATGG + Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
966053572 3:175653136-175653158 AAGGAGGAGGAGGAAGAGAAGGG + Intronic
966330007 3:178801042-178801064 ATGGAGGGAGAAAATGAGAATGG + Intronic
966428500 3:179807112-179807134 ACGAAGGACGAGAATGAGAAAGG + Intronic
966548145 3:181174358-181174380 ACAGAGTATGAGAATGAGAGAGG - Intergenic
966592358 3:181696572-181696594 ATTGAGGAAGAAAAAGAGAAAGG - Intergenic
966697200 3:182802443-182802465 ATGGAGGATGAGAAATGGATTGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
967054192 3:185813888-185813910 AAGGAGAAGGAGAATGAGAGAGG + Intronic
967313699 3:188130716-188130738 AAGAAGGAGGAGAAGGAGAAGGG + Intergenic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967524853 3:190479749-190479771 CTGGAAGATAAGAATGTGAATGG + Intergenic
967660635 3:192104653-192104675 AGGGAGGATGAGATAGAAAAAGG - Intergenic
967714436 3:192746496-192746518 AGAGAGGATAAGAATGGGAAAGG - Intronic
967855235 3:194112430-194112452 ATGGAGGATGTGAATGGGGAAGG - Intergenic
967977971 3:195045968-195045990 ATGGAGGTGGAGGAGGAGAACGG - Intergenic
968426215 4:525126-525148 AGGGAGGATGGGGAGGAGAAAGG - Intronic
969013419 4:4086025-4086047 CGGGAGGCTGAGAAGGAGAATGG + Intergenic
969135818 4:5027896-5027918 ATGGAGGAAGAGGATCTGAAGGG + Intergenic
970202098 4:13620416-13620438 AAGGAAGCTGGGAATGAGAATGG + Intronic
970224556 4:13844119-13844141 ATGGAGGAAGGGAGGGAGAAAGG - Intergenic
970808578 4:20064472-20064494 AGGGAGGATGGAAAAGAGAAAGG + Intergenic
970878994 4:20906036-20906058 AGGGAGGAAGAGAAGGGGAAGGG - Intronic
971160419 4:24128059-24128081 ATGGAGGATGCTAAGGGGAATGG - Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971484891 4:27149021-27149043 ATTGAGGCTAAGAATGAGAAAGG - Intergenic
971732066 4:30397162-30397184 AAGGAGGAGGAGAAAGAAAAAGG - Intergenic
971737609 4:30476022-30476044 AAGAAGGTGGAGAATGAGAATGG - Intergenic
972274676 4:37546038-37546060 ATAGATGATGAGAAGGAGGATGG + Intronic
972447349 4:39157805-39157827 AGGGATGCTGAGAAAGAGAAGGG - Intergenic
972591557 4:40492923-40492945 ATGGAGGAGGGGAAGCAGAAGGG - Intronic
972740198 4:41880994-41881016 ATGGAGGATAAGGTAGAGAAGGG - Intergenic
973172189 4:47159453-47159475 GTAGAGGATGCAAATGAGAATGG + Intronic
973339590 4:48990210-48990232 ATGGAGGAAGAAAGTGAAAAGGG - Intronic
973555809 4:52081560-52081582 ATGGAGAATAAGAATAAAAAGGG - Intronic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973721006 4:53723718-53723740 CTGCAAGATGAGAATGAGAAGGG - Intronic
973849305 4:54945539-54945561 AGGGAGGGAGAGAAAGAGAAGGG + Intergenic
973881339 4:55274195-55274217 AGGGAGGATGAGACAGGGAAGGG - Intergenic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
974598209 4:64040405-64040427 ATGGATGTTAATAATGAGAATGG - Intergenic
974916255 4:68182401-68182423 ATGGAGGATGAGAGAGAGGTAGG - Intergenic
975035251 4:69671363-69671385 GTGGAGGTAGAGAAAGAGAAAGG + Intergenic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
976598663 4:86917617-86917639 AGGGAAGAAGAGAAAGAGAAAGG + Intronic
976777188 4:88719602-88719624 AAGGAGGAGGAGAAAGAGAAGGG - Intergenic
977470284 4:97434841-97434863 AGGGAGGCTGAGAGAGAGAAAGG + Intronic
977496817 4:97785873-97785895 GTGGAGTATGAGAATCAGCAGGG + Intronic
977857589 4:101912707-101912729 ATGGAATATGAGAATGATTAGGG - Intronic
978312920 4:107405641-107405663 ATGGAGGAGGAAAATGAAATAGG + Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
978569573 4:110121725-110121747 ATGGGGTGTGAGAGTGAGAAGGG - Intronic
978734628 4:112071713-112071735 GAGGAGGAGGAGAAAGAGAAGGG - Intergenic
978865271 4:113500462-113500484 ATTGAGGATGAAGATGTGAAAGG - Exonic
978943509 4:114466182-114466204 AGGGAGAATGAGAATGATAGGGG + Intergenic
979555922 4:122047505-122047527 AAGGAGCAAGAGAATGAGACAGG + Intergenic
979779936 4:124637939-124637961 AGCGAGGAAGAGAATGAGGATGG + Intergenic
980161483 4:129168677-129168699 ATGGAAGATGAAAACAAGAATGG + Intergenic
980474646 4:133297175-133297197 ATGGAGGATGAAGGTGAGAGGGG - Intergenic
980739885 4:136936265-136936287 AGGCAGGATGAGGAGGAGAAAGG + Intergenic
981036571 4:140175897-140175919 CCAGAGAATGAGAATGAGAATGG - Intergenic
981342310 4:143635523-143635545 ATTGAGGATGAGGAGGAGCAGGG - Intronic
981384328 4:144110115-144110137 ATAGAGAATGAGACTAAGAAGGG - Exonic
981609897 4:146582093-146582115 ATGGTGGAAGAGAAGGACAAGGG + Intergenic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
981648237 4:147024540-147024562 ATGGTGAATGAGAATAATAAGGG - Intergenic
981666635 4:147234455-147234477 ATGGGGCAAGAGAATGAGAGAGG + Intergenic
981676839 4:147352259-147352281 ATTCAGAATGAGAAAGAGAAGGG - Intergenic
981874453 4:149523740-149523762 ATGGAAAATGAGAAAGAGACTGG + Intergenic
982325128 4:154122158-154122180 ATGAAGGAGGAGAATGAGATGGG - Intergenic
982325362 4:154124135-154124157 ATGGGGTCTGAGATTGAGAAGGG - Intergenic
982325553 4:154125477-154125499 ATGGGGGCTGGGATTGAGAAGGG + Intergenic
982373979 4:154667304-154667326 AAGGAGGAGGAGGAGGAGAATGG + Intronic
982416581 4:155140405-155140427 AAGGAGGATGAGGAGGAGGAGGG - Intergenic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
983696778 4:170542023-170542045 GTGGAGAATGAGAAGGAGAGTGG + Intergenic
983849175 4:172559035-172559057 AAGGATGATGATAATGATAATGG + Intronic
983912167 4:173252227-173252249 ATGAGGGATGAGGATGAGGAAGG - Intronic
984044084 4:174776005-174776027 AAGGAGGTGGAGAGTGAGAAGGG + Intronic
984595689 4:181664700-181664722 AAGGAGGCTGTGAATGAGAGGGG - Intergenic
984613409 4:181867370-181867392 ATGGAGACTGAGGATGAGTATGG - Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984881386 4:184412737-184412759 AGGGAGGAAGAGAATGACGATGG - Intronic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985350657 4:189058096-189058118 TTGGAGGTTAAGAATCAGAATGG + Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985615651 5:919145-919167 ATGGAGGATGAGTATGGGTGAGG + Intronic
986216756 5:5726655-5726677 GTGGAGGATCTGAAGGAGAAAGG + Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
987034812 5:14008693-14008715 ATGGAGGAAGAAAAGAAGAAAGG + Intergenic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988867127 5:35347816-35347838 ATGGAAGGTGTGATTGAGAAAGG - Intergenic
989080362 5:37613336-37613358 ATGGATGAAGAGAATTAGAGAGG + Intronic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
989685121 5:44076532-44076554 TTGGAGGATCAGAAAAAGAATGG - Intergenic
990682933 5:58265881-58265903 ATGGAGTATTAGAATTGGAAGGG - Intergenic
991206465 5:64055445-64055467 ATGGAGTATGAAAATGGAAAGGG + Intergenic
991224871 5:64258340-64258362 ATGGAGGATGAATGTGGGAAGGG + Intronic
991429577 5:66530368-66530390 AGGAAGGATGAGAGGGAGAAAGG - Intergenic
991722115 5:69503361-69503383 ATGGAGGATGAGTAAGAAAAGGG - Intronic
992669731 5:79047058-79047080 ATGGAAGAAGAGAATGCTAAAGG - Intronic
992795834 5:80254680-80254702 AGAGAGAAAGAGAATGAGAATGG - Intronic
993133562 5:83928918-83928940 AAGGAAGATGAGAATGAGAAAGG + Intergenic
993215534 5:85018254-85018276 CAGGAGGAGGAGAAAGAGAAGGG + Intergenic
993407439 5:87529113-87529135 ATGGAAAAAGAGCATGAGAATGG + Intergenic
993514191 5:88809912-88809934 CTGGAGGACTACAATGAGAAAGG - Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993739324 5:91518326-91518348 AAGGAGGAGGAGGAGGAGAAGGG + Intergenic
993890527 5:93466808-93466830 ATGTAGGAGGTGAAAGAGAATGG - Intergenic
994265518 5:97711433-97711455 ATGGAGGAAGGGAGAGAGAAAGG - Intergenic
994278781 5:97874401-97874423 AGGGAGAGTGAGAAGGAGAAAGG + Intergenic
994579857 5:101627938-101627960 AAGGAGGAAGAGAGAGAGAAGGG + Intergenic
995539631 5:113171896-113171918 ATGGATCATGAGGGTGAGAAGGG - Intronic
995788762 5:115860726-115860748 AAGGATGAGGAGAATGGGAAAGG - Intronic
995860843 5:116638954-116638976 AAGGAGGGTGAGTAAGAGAATGG + Intergenic
996426702 5:123320612-123320634 ATAGAGGATGAGCAGAAGAAGGG - Intergenic
996982823 5:129520208-129520230 TTGGAGGATGAGAAGGTTAAAGG - Intronic
997182163 5:131841322-131841344 CTGGCACATGAGAATGAGAATGG - Intronic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
997977544 5:138449256-138449278 ATGGAGGGTGACAAGAAGAACGG + Intergenic
999372840 5:151066556-151066578 ATGAAAGATCAGAGTGAGAAAGG + Intronic
999507951 5:152217986-152218008 ATGGATAATGACAATGAGACCGG - Intergenic
999511883 5:152260756-152260778 ATGGGGAATGTGAGTGAGAATGG + Intergenic
999944806 5:156583385-156583407 ATGGGGCTTGGGAATGAGAAAGG - Intronic
1000051626 5:157568078-157568100 TGGGAGGCTGAGCATGAGAATGG - Intronic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000579437 5:163017136-163017158 CTGGAGCAAGAGAACGAGAAAGG - Intergenic
1000628726 5:163567774-163567796 AGGAAGGAAGAGAATGAGGAAGG - Intergenic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000727189 5:164785871-164785893 AAGCAAGATGAGAAAGAGAAGGG + Intergenic
1000799784 5:165711755-165711777 ATGGAGGATGGAAATAAAAATGG - Intergenic
1001108398 5:168875250-168875272 AGGGAAGAAGAGAGTGAGAAGGG + Intronic
1001121748 5:168986526-168986548 ATGGACGAGGACACTGAGAATGG - Intronic
1002376224 5:178790968-178790990 ATGGAGTGTGATAATGTGAAAGG - Intergenic
1002642839 5:180638654-180638676 CTGGAGGACGTGAATGTGAAGGG - Intronic
1002647603 5:180668518-180668540 CTGGAGGGTGGGAAAGAGAAGGG + Intergenic
1002652548 5:180711271-180711293 ATGAAGAATAATAATGAGAATGG + Intergenic
1002865987 6:1122937-1122959 ATGCAGGATGTGAAAGTGAATGG + Intergenic
1003016050 6:2468321-2468343 ACAGAGGAAGGGAATGAGAAAGG + Intergenic
1003407007 6:5834144-5834166 AGGGAGCAAGAAAATGAGAAGGG + Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003709612 6:8574845-8574867 AGGGAGAAAGAGAAAGAGAAAGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004123779 6:12852269-12852291 AGGGAGGAAGAAAAAGAGAAAGG - Intronic
1004138783 6:12994631-12994653 ATGGAGGAGGAAAAGGGGAATGG + Intronic
1004181801 6:13386958-13386980 ATGGAGGCTGGTAATGAGGATGG - Intronic
1004239593 6:13907984-13908006 AGGGAGGAAGGGAATGAGGAAGG - Intergenic
1004329269 6:14706869-14706891 GTGGGGGATGAGAAAGAGAAAGG + Intergenic
1004751297 6:18565444-18565466 ATGGAGGAAGAAAAGGAGGAAGG - Intergenic
1005011206 6:21337326-21337348 AAGGAGGAGGAGGAAGAGAAAGG - Intergenic
1005088321 6:22029839-22029861 ATGGAGACTGAGAAGGAGAGAGG + Intergenic
1005258496 6:24031103-24031125 ATGGAGAATTTAAATGAGAATGG - Intergenic
1005309101 6:24542312-24542334 TTGAAGTATGAGAATGGGAATGG - Intergenic
1005426116 6:25704393-25704415 GAGGAGGATGAGGATGGGAAGGG + Intergenic
1005525495 6:26643603-26643625 ATGGAGTCTGGGAAAGAGAAGGG + Intronic
1005786349 6:29249342-29249364 ATGGAGGATTATACTGAGATAGG + Intergenic
1005881841 6:30068144-30068166 CTGGAGCTTGAGAATGAGAGAGG + Intronic
1006006131 6:31003185-31003207 ATGGAAGAGAAGAATTAGAAGGG + Intergenic
1006442170 6:34059538-34059560 ATGGTGGATGCGTGTGAGAATGG - Intronic
1006521443 6:34573485-34573507 AAGGAGGATGAGGAAGAGAAAGG + Intergenic
1006628596 6:35415028-35415050 AGGAGGGATGAGAATGGGAATGG - Intronic
1006713573 6:36097888-36097910 ATTGAGTATAAGAATAAGAAAGG + Intronic
1006913979 6:37582982-37583004 ATGGAGGCTGAGAAAGAGCTGGG + Intergenic
1007059066 6:38920370-38920392 ATTGAGAATGAAAATAAGAAAGG + Intronic
1008235969 6:49050521-49050543 ATGCAGGATGAGAATAAGCAGGG - Intergenic
1008288407 6:49682790-49682812 AAGGAGGAAGAGAAGGAGAGAGG - Intergenic
1008413833 6:51216046-51216068 ATAGATGATGAGAATGAGCATGG + Intergenic
1008440329 6:51525440-51525462 ATTCAGAATGAGAAAGAGAAGGG + Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008491115 6:52088248-52088270 TTGGGGGATGTGAATCAGAATGG - Intergenic
1008624104 6:53300917-53300939 AAGGAAGATGGGAATGAAAAGGG - Intronic
1008700822 6:54097323-54097345 ATGGAGGATGAGATAAAGAAGGG + Intronic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009518858 6:64656737-64656759 TGGGAGGATGAGAAGGGGAAGGG + Intronic
1009609974 6:65929254-65929276 ATGGAGGATATGAATAAAAATGG + Intergenic
1009728993 6:67574717-67574739 GAGGAGGAGGAGAAAGAGAAGGG + Intergenic
1009860665 6:69326840-69326862 AGGGAGGATAAGGATGAGGAGGG + Intronic
1010474939 6:76275783-76275805 ATGGAGGAGGGGAAAGGGAAAGG - Intergenic
1010524210 6:76880514-76880536 ATGGAAGTTGAGAGAGAGAAAGG + Intergenic
1010529077 6:76943644-76943666 ATGGAGGTAGAGAAAGAGATAGG + Intergenic
1010890585 6:81305279-81305301 AAGGAGGATGAGAAGGTGAAGGG - Intergenic
1011140546 6:84150875-84150897 CTGTAGGAGGAGAATGAGCATGG - Intronic
1011146407 6:84222445-84222467 ATGTAGAATGAGATTGAAAAAGG - Intronic
1011183422 6:84647737-84647759 CTGATGGTTGAGAATGAGAAGGG - Intergenic
1011245206 6:85314900-85314922 ATGGAGGGTGAGAAGAAGCAGGG - Intergenic
1011718704 6:90133175-90133197 AAGGAGGAGGAGAAGGACAAAGG - Intronic
1011878001 6:91986052-91986074 ATTGACCATCAGAATGAGAATGG + Intergenic
1012407983 6:98922948-98922970 ATGGGGGATGTGCATGTGAATGG - Intronic
1012535916 6:100296697-100296719 AAGGATGTTGATAATGAGAAGGG + Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012628472 6:101432951-101432973 AAGGAGGAGGAGGAAGAGAAGGG + Intronic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013678873 6:112500222-112500244 AGGGAGGATGAGGAAGGGAAGGG + Intergenic
1013994536 6:116292960-116292982 CTGGGGGATGAGGATGGGAAGGG + Intronic
1014311818 6:119813193-119813215 GAGGAGGAGGAGAAAGAGAAGGG + Intergenic
1014474390 6:121854457-121854479 AAAGAGGATGAGAGGGAGAAGGG - Intergenic
1014675700 6:124362522-124362544 ATGGAGACAGAGAATAAGAAAGG - Intronic
1014871550 6:126602639-126602661 ATGCAGGATGAGATTCAGAATGG - Intergenic
1014933245 6:127358543-127358565 ATAGAGGAAGAGAAAGAGAAAGG - Intergenic
1015151647 6:130045801-130045823 AGGGAGGAAGGGAAGGAGAAGGG + Intronic
1015167533 6:130214770-130214792 AGAGAGAATTAGAATGAGAAGGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015996487 6:138999903-138999925 ATGTAGAATGAGAAGCAGAAAGG + Intergenic
1016124015 6:140376602-140376624 AGGGAGGGGGAGAAAGAGAAAGG - Intergenic
1016145265 6:140664005-140664027 AAGGAGGAAGAGAGAGAGAAGGG - Intergenic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1016486330 6:144543610-144543632 AAGGAGGAGGAGAAGGACAAGGG - Intronic
1016700291 6:147046963-147046985 ATGAATGATGAGGATGAAAATGG + Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017041864 6:150314416-150314438 AGGGAGGAGGAGGAGGAGAAAGG + Intergenic
1017190843 6:151651060-151651082 AAGGAGGAGGAGAAAGAGAATGG - Intergenic
1017328802 6:153171724-153171746 ATCGAGGATGAGAAAGAAGAAGG + Intergenic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017339615 6:153305369-153305391 AAGGAGGAGGAGAAGGGGAAGGG - Intergenic
1017530656 6:155289017-155289039 ATGGAGTATGAGAAAAACAAGGG + Intronic
1017763494 6:157589118-157589140 ATGGAGGAAGGAAAAGAGAAAGG + Intronic
1017978523 6:159377987-159378009 AAGGAGGATGGGAAGGGGAAGGG + Intergenic
1018098137 6:160411368-160411390 ATGGAGGAAGAAAAGAAGAAAGG - Intronic
1018264336 6:162005822-162005844 TTGGAAGATGGGAAGGAGAAAGG + Intronic
1018347747 6:162920200-162920222 AGGGAGGAAGGGAATGAGAGAGG + Intronic
1018420556 6:163637328-163637350 ATGGAAGATGTTAAGGAGAAGGG + Intergenic
1018576048 6:165261497-165261519 CTGTAAGATGAGAATGACAATGG + Intergenic
1018643619 6:165928320-165928342 TTGGAGGATGAGAATAAAAGGGG + Intronic
1018779149 6:167046325-167046347 AGGGAGGGAGAGAAGGAGAAAGG + Exonic
1018882887 6:167903141-167903163 ATAGAGAATGAAAATGAGAAAGG - Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020781499 7:12521567-12521589 ATGTAGCATGAAGATGAGAAAGG - Intergenic
1021189533 7:17603558-17603580 ATGGAGGAGGAGAAAGGGAAAGG + Intergenic
1021609664 7:22445023-22445045 TGAGAGGATGAGAAAGAGAAAGG + Intronic
1022537243 7:31105898-31105920 ATGGAGGCTGAGACTCAGCATGG + Intronic
1022599325 7:31742118-31742140 ATGAAGAAAGAGAATGAGACTGG + Intergenic
1022989050 7:35689928-35689950 ATATAGTAAGAGAATGAGAAAGG + Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1023337261 7:39183438-39183460 AAGGAGGAAGAGAGAGAGAAGGG + Intronic
1023503983 7:40881066-40881088 GTGGAGGATGAGATGGTGAAGGG - Intergenic
1023567364 7:41536902-41536924 GTGGAGGATGAGAAAGAAGATGG + Intergenic
1023635369 7:42204199-42204221 ATGGAGGCAGAGAATGTGAATGG - Intronic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1024015148 7:45307044-45307066 ATGGAGCAAGAGAGAGAGAAGGG - Intergenic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024153798 7:46599955-46599977 ATGGAGGAAGAGAGAGAGAGAGG + Intergenic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024928594 7:54645150-54645172 ATGTGGAATGAGAAGGAGAAGGG + Intergenic
1024940875 7:54761773-54761795 ATGGAGGAAGAGAGAAAGAAAGG + Intergenic
1024960925 7:54975243-54975265 GAAGAGGATGAGAAAGAGAAAGG + Intergenic
1025724499 7:64044676-64044698 AGGGATGATGAGACTGAGAGGGG - Intronic
1026205700 7:68255486-68255508 AAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1026218407 7:68369920-68369942 ATAGAGGTTGAGAGTGAGAGGGG + Intergenic
1026263905 7:68779678-68779700 ATGGACTATGACAATGACAATGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026375932 7:69750944-69750966 ATGGAAGAAGAAAAGGAGAAGGG + Intronic
1026574401 7:71560300-71560322 AAGGAGGAGGAGAATGAGATAGG - Intronic
1026800605 7:73397755-73397777 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026800611 7:73397773-73397795 AAGGGGGAGGAGAAGGAGAAGGG + Intergenic
1026801087 7:73400368-73400390 ATGAGGGAAGAGAAAGAGAAGGG + Intergenic
1026869156 7:73840344-73840366 ATGGAGGATCAGCAAGGGAAAGG + Intronic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027522449 7:79226610-79226632 AAGGAGGATAGGAAAGAGAAGGG - Intronic
1027645313 7:80790311-80790333 AAGGAGGAGGAGGAGGAGAAAGG + Intronic
1028097773 7:86783632-86783654 GAGGTGGATGAGAAAGAGAAAGG + Intronic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028246745 7:88488397-88488419 AAAGAAGAGGAGAATGAGAAAGG - Intergenic
1028418846 7:90610120-90610142 ATGGACTATGAGAATGGGATGGG - Intronic
1028563257 7:92198827-92198849 AGGGAGGAAGGAAATGAGAAAGG + Intergenic
1028582602 7:92423071-92423093 CTGGAGGATGAGACCAAGAAAGG + Intergenic
1028776198 7:94680032-94680054 AAGCAGGATGAGACAGAGAATGG + Intergenic
1028844377 7:95462907-95462929 AAGGTGAATGAGAAAGAGAAAGG + Intergenic
1029337769 7:99916929-99916951 ATGGAGCATGGGAAGGAGGATGG - Intronic
1029375083 7:100172222-100172244 AGGGAGGGAGAGAAAGAGAAAGG + Intronic
1029643707 7:101837962-101837984 AAGGGGGCTGAAAATGAGAACGG - Intronic
1029846419 7:103416744-103416766 AAGGAGGAAGAAAATGAGAGAGG - Intronic
1030085749 7:105813995-105814017 ATGGAGGAAGAGAGGAAGAAAGG - Intronic
1030193704 7:106833221-106833243 ATGGAGGATTATACTGAGATAGG - Intergenic
1030490547 7:110227936-110227958 AAGGATGATGAAAATAAGAAGGG - Intergenic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1031080842 7:117255572-117255594 CTGGAGGAGGAGAAAGAGAGGGG - Intergenic
1031257039 7:119466402-119466424 AGGGAGGAAGAGAATATGAAAGG - Intergenic
1031371024 7:120966669-120966691 CTGGAGTATGTGAATGAGCATGG - Exonic
1031796204 7:126176992-126177014 GAGGAGGAGGAGAAGGAGAAGGG - Intergenic
1032103145 7:129000042-129000064 ATGATGGATGAGAATGACAAAGG - Intronic
1032230181 7:130067563-130067585 AAGGAGGAAGAGAGAGAGAAAGG + Intergenic
1032454366 7:132061682-132061704 ATGGAAGATGAGCATGAGGGTGG + Intergenic
1032466824 7:132151371-132151393 AAGGAGGAGGAGGAGGAGAAAGG + Intronic
1032466847 7:132151453-132151475 AAGGAGGAGGAGGAGGAGAAAGG + Intronic
1032466857 7:132151494-132151516 AAGGAGGAGGAGGAGGAGAAAGG + Intronic
1032480415 7:132241665-132241687 AAGGAGGAAGAGAAAGAGAAGGG - Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032685723 7:134231711-134231733 AGGGAGGAAGAGAGGGAGAACGG - Intronic
1032685732 7:134231743-134231765 AGGGAGGAAGAGAGGGAGAACGG - Intronic
1033033990 7:137853892-137853914 ATGGAGAAAGGGAATGTGAATGG - Intergenic
1033636679 7:143218408-143218430 ATGGAAGACAAGAAGGAGAAAGG - Intergenic
1033724453 7:144098935-144098957 AGGAAGGAAGAGAAAGAGAAAGG - Intergenic
1034132692 7:148735113-148735135 TTTGAGAATGAGAATGAGATTGG + Intronic
1034405331 7:150899020-150899042 ATGGAGGAGGGGACAGAGAAGGG + Intergenic
1034427226 7:151020377-151020399 AGGGAGGAGGAGAACGAGACGGG + Intronic
1034506503 7:151496357-151496379 TTAGATGATGAGAATCAGAAAGG - Intronic
1035674915 8:1449737-1449759 ATGCAGGATGCGAATGGGAGAGG + Intergenic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1036403716 8:8434252-8434274 ATGTTTTATGAGAATGAGAAAGG + Intergenic
1036419752 8:8584714-8584736 AAGGAGGAGGAGGAAGAGAAGGG + Intergenic
1036582332 8:10086920-10086942 AATGAGAATGAGAATGAGAATGG + Intronic
1036752560 8:11452577-11452599 GTGGAGGCTGATGATGAGAAGGG - Intronic
1037045712 8:14300373-14300395 AGGGAGGAAGGGAATGAGGAAGG + Intronic
1037229595 8:16640470-16640492 AGGGTGGAGGAGAAAGAGAATGG - Intergenic
1037596280 8:20357098-20357120 AAGGAGGAAGAGAGAGAGAAGGG + Intergenic
1037655440 8:20879695-20879717 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1037928402 8:22863192-22863214 ATGGAGAATGAGATGCAGAAAGG + Intronic
1037937854 8:22927411-22927433 ATGGAGGATGGCACTGAGAAAGG - Intronic
1037958183 8:23074916-23074938 AGAGAGAAGGAGAATGAGAAGGG - Intergenic
1038305210 8:26394722-26394744 TGGGAGAATGAGAATGAAAAAGG + Intronic
1038400018 8:27277571-27277593 CAGGAGGCTGAGTATGAGAAGGG - Intergenic
1038840491 8:31180470-31180492 ATGGAGGCTGACATTCAGAATGG - Intergenic
1038860131 8:31378462-31378484 ATAGAGGATAATAGTGAGAAAGG - Intergenic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1039845966 8:41325607-41325629 TTGGAGGAGGACAGTGAGAAGGG - Intergenic
1039986506 8:42452314-42452336 ATGGAGGAGAAGAAAGAGATAGG + Intronic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041236755 8:55811148-55811170 AAGGAGCATGAGAGTGAGAGAGG + Intronic
1041330492 8:56719146-56719168 AGGGAGGAGGAGGAAGAGAATGG - Intergenic
1041345779 8:56896568-56896590 ATGCAGGAAAGGAATGAGAAAGG + Intergenic
1041353481 8:56973991-56974013 GAGGAGGAGGAGAAAGAGAAAGG - Intronic
1041717417 8:60944694-60944716 ATGGAGGGAGAGACTCAGAAAGG + Intergenic
1042155879 8:65842777-65842799 ATGGGTGAAAAGAATGAGAAAGG + Intergenic
1042934694 8:74046886-74046908 AAAAAGAATGAGAATGAGAATGG - Intergenic
1043185050 8:77138000-77138022 AAGGGGGAAGAGAAAGAGAAAGG - Intergenic
1043283466 8:78499615-78499637 ATGGAGGTAGAGAGTAAGAATGG + Intergenic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043602269 8:81954798-81954820 ATGGAGGATGAATTTGAGAAAGG - Intergenic
1043827307 8:84944699-84944721 ATAAAGGAAGAGAATGAGAATGG - Intergenic
1043859626 8:85300749-85300771 ATGGAGGAGGAGATGGAAAAGGG + Intergenic
1044106112 8:88209261-88209283 GTGGAGGAGGAGGAAGAGAAGGG - Intronic
1044204396 8:89475356-89475378 ATGAAAGATGAGAAAGACAAAGG - Intergenic
1044458897 8:92421705-92421727 ATGGGGGATGGAAAAGAGAAGGG + Intergenic
1044970900 8:97618667-97618689 ATGGATGATCAGAAAGTGAAAGG - Intergenic
1045049150 8:98307030-98307052 AGGGAAGAGGAGAATGAGAGAGG - Intergenic
1045206509 8:100047463-100047485 AAGGATGATGTGATTGAGAAAGG - Exonic
1045281001 8:100749702-100749724 ATGGAGGAAGAGGAGGAGAACGG + Intergenic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1046030455 8:108776825-108776847 AAGGAGGATGAGGAGGAGAAAGG + Intronic
1046068460 8:109222957-109222979 AGAGAGGATGAGGAGGAGAAAGG - Intergenic
1046314068 8:112477609-112477631 ATAGAGAATGAGAGAGAGAATGG - Intronic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1046480707 8:114813828-114813850 CGGGAGGCTGAGAAGGAGAATGG + Intergenic
1046588097 8:116172628-116172650 TGGGAGAATGAGAATGAAAAAGG + Intergenic
1046972630 8:120238905-120238927 ATGGAGGGTGAGCATAAGCAGGG - Intronic
1047250088 8:123175411-123175433 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1047339886 8:123970769-123970791 ATGGAGGACAGGAATGGGAAGGG + Intronic
1047451204 8:124966604-124966626 TTTTAGGATGAGCATGAGAAAGG - Intergenic
1047614948 8:126556376-126556398 AGGGAGGAAGAGAGGGAGAAAGG + Exonic
1047992406 8:130299485-130299507 AAAGGGGATGAGGATGAGAAAGG - Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048220096 8:132533183-132533205 GAGGAGGATGAGAAAGAGGAAGG + Intergenic
1048325682 8:133437146-133437168 ATAGAGGATCAGAATAGGAAAGG + Intergenic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048417573 8:134243687-134243709 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048664017 8:136641034-136641056 ATGGCAGAAGAGAAAGAGAAAGG + Intergenic
1048798394 8:138172714-138172736 AGGGAGGAAGGGAAGGAGAAAGG + Intronic
1049101102 8:140579712-140579734 ATAGAGACTGAGAAGGAGAACGG + Intronic
1050430507 9:5557185-5557207 AGAGAGGATGAGGAGGAGAAGGG + Intronic
1050651218 9:7778976-7778998 ATGGAGGATTGGAAAGACAATGG - Intergenic
1051039634 9:12791622-12791644 AGGGCGGGGGAGAATGAGAAAGG - Intronic
1051208231 9:14712882-14712904 AATGAGGATAAGAAAGAGAAGGG + Intergenic
1051522806 9:18009159-18009181 ATTGGGGAGGAGAAAGAGAAAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052434630 9:28410119-28410141 AAGGAGGAAGGGAAAGAGAAAGG + Intronic
1052588010 9:30453935-30453957 TGGCAGGATGAGGATGAGAATGG - Intergenic
1052712951 9:32079096-32079118 GGGGAGGTTGAGAAGGAGAAGGG - Intergenic
1052738435 9:32369648-32369670 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1053179151 9:35953004-35953026 AGAGAGGGTGAGAAGGAGAAAGG - Intergenic
1053430969 9:38041497-38041519 ATGGGTGATGGGAAGGAGAAGGG + Intronic
1054815686 9:69472833-69472855 TTGGAGGATGGGAATGGCAAAGG + Intronic
1055057767 9:72039453-72039475 AGGCAGGATGAGAACGAGAACGG + Intergenic
1055183183 9:73415511-73415533 CAGGAGGCTGAGAAAGAGAATGG - Intergenic
1055370626 9:75594426-75594448 ATGGAGAATAAGAATAGGAAAGG - Intergenic
1055811583 9:80155099-80155121 ATGGAGGATGCTGATGAGGAAGG - Intergenic
1055815691 9:80202365-80202387 CGGGAGGCTGAGAAGGAGAATGG + Intergenic
1056108541 9:83371856-83371878 AGGGAGGAAGAGAGGGAGAAAGG + Intronic
1056267748 9:84916232-84916254 AGGGAGGATGAGAAATAAAATGG + Intronic
1056546836 9:87620542-87620564 AAGGAGGAAGAGAAGGAGTAGGG + Intronic
1056672547 9:88642827-88642849 AGGGAGGGGGAGAAGGAGAAGGG - Intergenic
1056982127 9:91324178-91324200 AAGGAGGATGAAGATGTGAAAGG + Intronic
1057719091 9:97518001-97518023 ATGGGGGATGAGAATGGGCAAGG - Intronic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058569584 9:106326284-106326306 AGAGAATATGAGAATGAGAATGG + Intergenic
1058599537 9:106654218-106654240 AGGTAGGAAGAGAAAGAGAAGGG - Intergenic
1058721575 9:107769206-107769228 AGGGGGATTGAGAATGAGAAAGG - Intergenic
1058816129 9:108684353-108684375 ATGGAGAATGAGACTCAGAGAGG + Intergenic
1059343921 9:113615646-113615668 ATGGGGGACCAGAATCAGAAAGG + Intergenic
1059391481 9:114002182-114002204 AAGTAGGAGGAGAATGGGAAAGG - Intronic
1059458800 9:114416534-114416556 CTGGAGGAGGAGGAAGAGAAGGG - Intronic
1059730082 9:117048317-117048339 ATGATGGAAGAAAATGAGAAGGG + Intronic
1059731007 9:117057016-117057038 ATAGTGGATGATAATAAGAAAGG + Intronic
1059767093 9:117393865-117393887 ATGGAGGAGGAGGAGGAGATGGG + Intronic
1059867039 9:118526718-118526740 ATTGAAGGTGAGAATGAGAGTGG - Intergenic
1060005542 9:119996502-119996524 GAGGAGGATGAGGAAGAGAAGGG + Intergenic
1060481466 9:124018795-124018817 ATGGAGGGAGAGAAAGAGAGAGG - Intronic
1061449312 9:130660003-130660025 AAGGAGGAAGAGAAGGAGAGGGG + Intergenic
1062445982 9:136595054-136595076 AAGGAGGAGGAGGAGGAGAAAGG + Intergenic
1185688323 X:1948429-1948451 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185688601 X:2133951-2133973 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185948706 X:4406435-4406457 ATGGAGAGAGAGAATGAGAGAGG + Intergenic
1185954613 X:4475726-4475748 AGGGAGGAAGGGAAGGAGAAAGG + Intergenic
1186019181 X:5235050-5235072 AAGGAGGAAGACAAGGAGAAAGG - Intergenic
1186077598 X:5897967-5897989 ATGGAGGAGGAGAGGAAGAAGGG - Intronic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186578731 X:10793969-10793991 AGGGAGCAAGAGAAGGAGAAAGG - Intronic
1186892404 X:13971920-13971942 ATGGATATTGAGATTGAGAATGG - Intergenic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187000600 X:15172907-15172929 CTGGAAAATGAGGATGAGAATGG - Intergenic
1187055801 X:15740575-15740597 AAGGATGCTGAGACTGAGAACGG - Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187516106 X:19972420-19972442 ATTGCTGATGATAATGAGAAAGG + Intergenic
1187660003 X:21534095-21534117 CTGGAGGCTGAGAATGGGAGGGG - Intronic
1187678017 X:21737309-21737331 AAGGATGATCAGAAAGAGAATGG + Intronic
1188057026 X:25553371-25553393 ATGGAGGATGTGAATGTCATCGG + Intergenic
1188193128 X:27196827-27196849 ATGGAGGATGAGCAGAAGCAGGG + Intergenic
1188833015 X:34924073-34924095 ATGGAGGGAGAAAATGAGAGTGG + Intergenic
1189375807 X:40465592-40465614 AGGGAGGAAGAGAAGGAGAGAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190410544 X:50133016-50133038 TTGGAGGCTGAGACTGAGACGGG - Intergenic
1190461980 X:50685690-50685712 ATTGAGGATTAGAATGAGAAAGG - Intronic
1190735766 X:53255243-53255265 AGGAAGAAAGAGAATGAGAAAGG + Intronic
1191928768 X:66344948-66344970 ATGGGGGATGAGCAGAAGAAGGG - Intergenic
1192152547 X:68721151-68721173 AGGGAGGTTGAGAATGGGACAGG - Intronic
1192410433 X:70928749-70928771 ATGGGGGATGGGCCTGAGAAAGG - Intronic
1193047807 X:77070791-77070813 CTGGAGGATGCAAGTGAGAAAGG + Intergenic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1193588198 X:83353661-83353683 AAAAAGGAGGAGAATGAGAATGG + Intergenic
1194027541 X:88771197-88771219 ATGAATGAGGAAAATGAGAAAGG + Intergenic
1194198424 X:90925434-90925456 TTGGGGGATGAGAAAAAGAAAGG + Intergenic
1194484228 X:94467369-94467391 GAGGAGGATGAGATGGAGAACGG + Intergenic
1195030065 X:100918337-100918359 CTTGAGGATGGGACTGAGAATGG - Intronic
1195248186 X:103015725-103015747 CAGGAGGATGAGAAAGAGAAGGG - Intergenic
1195430784 X:104786892-104786914 AATGAGAATGAGAATGAGAGAGG - Intronic
1195930128 X:110066096-110066118 AAGAAGAATGAAAATGAGAAAGG - Intronic
1196016874 X:110948987-110949009 TTGGATGATGAAAATGAGGATGG + Intronic
1196054161 X:111336968-111336990 AAGGAGGAGGAGAAGAAGAATGG + Intronic
1196571415 X:117269506-117269528 ATGGAGAATGAGTTTGACAAAGG + Intergenic
1196760751 X:119198486-119198508 AAGAAGAATGAGAATGAGCAAGG + Intergenic
1197134534 X:123045664-123045686 AAGGAGGAAGAGAAAGAGAAGGG - Intergenic
1197381616 X:125749426-125749448 AACGAGGAAGAGAAGGAGAAAGG - Intergenic
1197793050 X:130274280-130274302 ACGGGGGATGAGGATGAGAAGGG + Intergenic
1198241977 X:134796389-134796411 AAGGAGGATGATGATGAGGAAGG + Intronic
1198673056 X:139102345-139102367 AAGGAGGAAGAGGAAGAGAAGGG + Intronic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic
1199526988 X:148803836-148803858 AGGGAGAGTGGGAATGAGAAGGG - Intronic
1199612788 X:149631932-149631954 ATGGAGGCTGGGAGTGAGCAGGG + Intergenic
1199635756 X:149809988-149810010 CAGGAGGCTGAGAAGGAGAATGG + Intergenic
1199799361 X:151234238-151234260 ATGGAGGCTGGGAAGGGGAAGGG + Intergenic
1200543315 Y:4487394-4487416 TTGGGGGATGAGAAAAAGAAAGG - Intergenic
1200770852 Y:7124047-7124069 AGGGAGAATGGGAAGGAGAATGG + Intergenic
1200915306 Y:8566155-8566177 CTGTAGGATGAGAAGCAGAAAGG + Intergenic
1201303152 Y:12527577-12527599 ATGCAGGAAGGGAAGGAGAAAGG + Intergenic
1201409081 Y:13680666-13680688 ATGGAGGGTGAGAAGAAGTAGGG + Intergenic
1201474385 Y:14364718-14364740 AAGGAGGAAGAGAAGGAGCATGG + Intergenic
1201517713 Y:14835726-14835748 ATGGAGGAGGAGAGGAAGAAAGG + Intronic
1201613167 Y:15865750-15865772 TTGGAGAATGAGAATGAGCTTGG - Intergenic
1201979826 Y:19894388-19894410 CTGGAGTATCTGAATGAGAAGGG + Intergenic