ID: 1112723488

View in Genome Browser
Species Human (GRCh38)
Location 13:102274270-102274292
Sequence CCCACAGTGAATCCCACCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112723488 Original CRISPR CCCACAGTGAATCCCACCTT GGG Intronic
900292063 1:1927845-1927867 CCCACATTCAATCCCAACTGCGG - Intronic
904458902 1:30663846-30663868 CCCACTGGGAATGCCCCCTTTGG - Intergenic
904517086 1:31065101-31065123 CCCACGGTGAATCTCGCCTGTGG + Intronic
908967825 1:69787377-69787399 CCCACACAGAGTCCCTCCTTGGG - Intronic
916063496 1:161118204-161118226 GCCGCGGTGAATCCCACCTGCGG + Intronic
919976214 1:202614762-202614784 ACCACACTGCATCCCACCTCTGG - Intronic
1063203034 10:3803561-3803583 CCCACAGTGACTCCAGCCTCTGG + Intergenic
1063255665 10:4324714-4324736 CCCTCAGTCATTCCCATCTTGGG - Intergenic
1066119123 10:32266895-32266917 CCCACAGTGCTTTCCACCTGTGG + Intergenic
1067711694 10:48655839-48655861 CCCACCGTGATGCCCACCTCGGG - Intronic
1072613036 10:97031637-97031659 CCTGCAGTGCATCCCGCCTTTGG - Exonic
1073105972 10:101032220-101032242 CCCAGAGCCAATCCCACCTCGGG - Intronic
1073267357 10:102235907-102235929 CCCAAAGTGGCTCCCAGCTTGGG - Intronic
1075123295 10:119680149-119680171 CCCACTCTGAGGCCCACCTTGGG + Intergenic
1076240396 10:128900730-128900752 CCCACAGTGCAGCCCGCCTTCGG - Intergenic
1077540279 11:3143315-3143337 CCCACAGTGCAGCCCCCCATGGG - Intronic
1077564121 11:3285603-3285625 CCCCCAGTGATCCCCACCTCTGG + Intergenic
1077570011 11:3331420-3331442 CCCCCAGTGATCCCCACCTCTGG + Intergenic
1078045196 11:7907440-7907462 CCCACAGTGAATCCCTGGCTTGG + Intergenic
1078269684 11:9783733-9783755 CCCACGGTGAATTCCAAGTTTGG + Intronic
1078795902 11:14591489-14591511 CACCCAGTGAATCCCACACTGGG - Intronic
1083824328 11:65189870-65189892 CCCACTGTTACTCTCACCTTCGG + Intronic
1084433436 11:69123925-69123947 CCAACAGTGAATCCAACCCCAGG - Intergenic
1085046152 11:73354909-73354931 CCCACAGTAAAGCCCAGCTCAGG - Intronic
1086490568 11:87354440-87354462 CCTTCTGTGAATCCCACCTAGGG + Intergenic
1089115410 11:116091158-116091180 CCCAGAGTTAGCCCCACCTTGGG + Intergenic
1097964515 12:65564569-65564591 CCCACTGTGAAGCCCACAGTGGG + Intergenic
1098592290 12:72228120-72228142 CCCACACAGAGTCCCAACTTGGG - Intronic
1099630124 12:85132124-85132146 GCCACAGTGAATCAATCCTTTGG + Intronic
1100054348 12:90490884-90490906 CCCACAGAGAATCCCTACTGGGG + Intergenic
1104351128 12:128044836-128044858 CCCAGACTGACTCCCACCTAAGG - Intergenic
1104354949 12:128077178-128077200 ACCACAAAGAATCCCACATTGGG + Intergenic
1104372588 12:128237026-128237048 CCCTCACTGACTCCCACCCTCGG + Intergenic
1106370642 13:29129387-29129409 TGCACAGGGAATCCAACCTTCGG - Intronic
1109906654 13:68851191-68851213 CTCACTCTGCATCCCACCTTGGG + Intergenic
1109962440 13:69648688-69648710 CCCAAAATGCAGCCCACCTTGGG + Intergenic
1112723488 13:102274270-102274292 CCCACAGTGAATCCCACCTTGGG + Intronic
1114498889 14:23153658-23153680 CCCACAGGGATCTCCACCTTGGG + Intronic
1116509329 14:45724402-45724424 GCCACAGTCACTCCAACCTTCGG + Intergenic
1118836823 14:69484109-69484131 AGCACAGTGAAACCCACCTGAGG + Intergenic
1119200579 14:72748982-72749004 CCCACACAGAGTCCCACCTGGGG + Intronic
1123107404 14:105848992-105849014 CCCAGAATGAATCTCACCCTGGG + Intergenic
1124491860 15:30163109-30163131 ACCACACTGCATCCCACCTCTGG - Intergenic
1124751676 15:32375208-32375230 ACCACACTGCATCCCACCTCTGG + Intergenic
1126772341 15:52070790-52070812 GCCACAGTTGCTCCCACCTTAGG + Intergenic
1128602797 15:69011779-69011801 CCCACTCTGAATCCCACGCTGGG + Intronic
1129333884 15:74841155-74841177 CACACAGTGAGTCCCAACTCTGG + Intronic
1129518459 15:76171029-76171051 GCCACAGTGGATGCCACCATCGG - Exonic
1129537460 15:76325733-76325755 CCCCCAGTGAGTCACATCTTTGG + Intergenic
1130673736 15:85934665-85934687 CCCACAGTGAGTTCCTCCTAGGG + Intergenic
1131427059 15:92354350-92354372 CCCACACAGAATCCCTACTTGGG + Intergenic
1131828045 15:96335290-96335312 CCCAAAGTGTATGCCAACTTGGG + Intronic
1137403901 16:48175402-48175424 CCCACAGGGAAGTCCTCCTTGGG - Exonic
1139693792 16:68658158-68658180 CACACAGGAAATCCCAACTTTGG - Intronic
1143258465 17:5581715-5581737 CCCTCAGGAAATCCCACCCTTGG - Intronic
1146297600 17:31661881-31661903 CCCACAGTGCTTCCCAGCTGTGG - Intergenic
1146370647 17:32263998-32264020 CCCACAGCGACCCCCTCCTTTGG + Intergenic
1149256580 17:54834374-54834396 CCCACAGTGCATTTCCCCTTAGG - Intergenic
1149449761 17:56740378-56740400 CGCACAGTGAATTCTAGCTTAGG + Intergenic
1150629008 17:66864063-66864085 GCAAAAGTGAATCCTACCTTGGG - Intronic
1151412830 17:73942530-73942552 CCCACAGGGTATGCCACGTTTGG + Intergenic
1153592443 18:6687710-6687732 CCCACTGTGAAAGGCACCTTTGG + Intergenic
1153608280 18:6855798-6855820 CCCACAGTGGAAGCCACCTGTGG + Intronic
1156077774 18:33301398-33301420 CCCACAGAGAATCCCCACTGGGG + Intronic
1157158362 18:45289279-45289301 CCCTCACTGCCTCCCACCTTGGG - Intronic
1165329077 19:35131472-35131494 CCCACCGTGAATGCCAGCGTGGG - Exonic
1166393449 19:42423087-42423109 CCCTCAGTGTTTCCCACCTGGGG - Intronic
925293129 2:2761650-2761672 CCCACACTGTGTCTCACCTTGGG + Intergenic
927157999 2:20232789-20232811 CTCCCAGTGAATCCCACTGTGGG - Intergenic
929783302 2:44971733-44971755 CCCACCTTCAATCCCACCATGGG + Intergenic
930960367 2:57253337-57253359 CCCACACAGAATCCCCCCTGCGG + Intergenic
935095137 2:99936847-99936869 GCCACAGTTAAATCCACCTTGGG - Intronic
937248326 2:120508487-120508509 CCCACAGCCAAGCCCACTTTGGG + Intergenic
945416877 2:209584726-209584748 CCCACAGTCAATACCCTCTTTGG - Intronic
946603357 2:221374989-221375011 CCCAAAGTGAGTCCCACCAGTGG + Intergenic
947546606 2:231014976-231014998 CCTACAGGGAGTCCCAACTTGGG + Intronic
948768109 2:240233678-240233700 CCCACAGTGTCTCCCCCCTCTGG + Intergenic
1168947262 20:1771724-1771746 CTCACACCGAGTCCCACCTTGGG + Intergenic
1169347377 20:4839306-4839328 CCCCCTGTCAATCCCACCCTAGG - Intergenic
1169428020 20:5511303-5511325 CCCACAGTCAACCCCACCACAGG + Intergenic
1171292503 20:23990311-23990333 TCCACATTGAACCCCACGTTGGG + Intergenic
1173120560 20:40285550-40285572 AACACATTGAAACCCACCTTTGG - Intergenic
1177402416 21:20623285-20623307 CCCACATAGAATCCCCACTTTGG - Intergenic
1177881658 21:26702242-26702264 CCCACAGAGAATCCCCACTGGGG - Intergenic
1178865673 21:36325078-36325100 CCAACAGTGAAGCCCACCAAAGG - Intronic
1178929846 21:36807743-36807765 ACCACAGGGACTCCCACCTCTGG - Intronic
1180823569 22:18848075-18848097 TCCACATTGAACCCCACGTTGGG + Exonic
1181189170 22:21126471-21126493 TCCACATTGAACCCCACGTTGGG - Exonic
1181210029 22:21284024-21284046 TCCACATTGAACCCCACGTTGGG + Intergenic
1181649926 22:24253148-24253170 TCCACATTGAACCCCACGTTGGG + Intergenic
1181707451 22:24657598-24657620 TCCACACTGAACCCCACGTTGGG - Intergenic
1183808509 22:40233829-40233851 CCTACAGTGGATGCCACCCTTGG + Intronic
1203216918 22_KI270731v1_random:11409-11431 TCCACATTGAACCCCACGTTGGG - Intergenic
1203273711 22_KI270734v1_random:73981-74003 TCCACATTGAACCCCACGTTGGG + Intergenic
952374694 3:32756435-32756457 CCCACTGTCAAACCCACTTTGGG - Intronic
953846788 3:46433842-46433864 CCCTCAGGGAACCCAACCTTGGG + Intergenic
953876806 3:46671281-46671303 CCCACAGTGCATCCCAGCCCTGG - Intronic
957054567 3:75434142-75434164 CCCACACTGAATGCTAACTTCGG - Intergenic
958856524 3:99392653-99392675 CCCATAATGAATCACACATTTGG + Intergenic
958955133 3:100458671-100458693 CCCACAGAGAATCCCTACTGGGG - Intergenic
960164126 3:114382625-114382647 CCCACAGTGAATTCCTCCCTAGG + Intronic
961006997 3:123411952-123411974 CCCACACAGAACTCCACCTTTGG + Intronic
961219893 3:125191513-125191535 CACACAGTGACTCCTAGCTTTGG - Intronic
961228705 3:125280319-125280341 ACCACAGAGAAACTCACCTTAGG + Intronic
963631053 3:147730410-147730432 CTCACTGTGACTCCCACCTAAGG - Intergenic
963838368 3:150079742-150079764 CCCAAAGTGAACCCCTCCTCAGG + Intergenic
964707961 3:159640777-159640799 CCCACACTGCATGCCACCATGGG + Intronic
966851485 3:184167722-184167744 CCCACCCTGCATCCCACCATGGG - Intronic
968834628 4:2954586-2954608 CCCACAGTGAAGCCCAGCCCTGG + Intronic
969417557 4:7070828-7070850 CCCAGAGGGGATGCCACCTTGGG + Intergenic
969450754 4:7271686-7271708 CACACACTGAATCCCACCCCAGG - Intronic
969756637 4:9154242-9154264 CCCACACTGAATGCTAACTTGGG + Intergenic
978817534 4:112926003-112926025 CCAACAGTGTGTCCCATCTTGGG + Intronic
985416536 4:189741161-189741183 CCCACGCTGCATCCCACCCTAGG + Intergenic
986533225 5:8760665-8760687 CCCACAGAGAATCCCTACTGGGG + Intergenic
988147687 5:27331206-27331228 CCCACAGAGAATCCCCACTCGGG + Intergenic
990784915 5:59408501-59408523 CCCACAAAGAATCCCCCCTGGGG + Intronic
994612988 5:102069215-102069237 CCCAAACTAATTCCCACCTTGGG + Intergenic
994999225 5:107106034-107106056 TCCAAACTGAATCCCACTTTTGG - Intergenic
995869965 5:116734331-116734353 CCCACACTGGAGCCCACCTGGGG + Intergenic
996235841 5:121128262-121128284 CCCACACAGAGTCCCACCTTGGG + Intergenic
996415994 5:123210882-123210904 TCCACATTCAATCACACCTTTGG - Intergenic
997436715 5:133880937-133880959 CCCCCAGAGAATCCCACTGTAGG + Intergenic
999107776 5:149088904-149088926 CCCACAGAGAATCCCACACCAGG + Intergenic
1001557972 5:172649109-172649131 CCCACAGTTAGTTCCTCCTTTGG - Intronic
1002665247 5:180818522-180818544 GCCACAGTGAATTCCAACGTAGG - Intergenic
1005707200 6:28467563-28467585 CTCAAAGTGAATCACTCCTTTGG + Intergenic
1008805126 6:55417527-55417549 CCCACTGTTGATCCCACCATGGG - Intergenic
1010222291 6:73458351-73458373 CCCTCTGTGAAGCCCACCTGTGG + Intergenic
1012585995 6:100923229-100923251 CCACCAGTGAATTCCACCTCTGG - Intergenic
1014576639 6:123082051-123082073 CCCACAGAGAATCCCTACTGGGG - Intergenic
1018010793 6:159668030-159668052 AACCCAGTGAATCCCATCTTGGG + Intergenic
1018096293 6:160389924-160389946 CCCACACAGAATCCCACCCAAGG - Intronic
1028465728 7:91149253-91149275 CCCAAAGTGAATGGCACGTTCGG - Intronic
1030143941 7:106333351-106333373 CCCCCAGGGAATCCCCCTTTAGG - Intergenic
1032477499 7:132222385-132222407 CCCACTAAGAATCCTACCTTTGG - Intronic
1032512378 7:132482125-132482147 CCCCCAGTGATCCCCACCTCTGG + Intronic
1033505877 7:141999361-141999383 CCCACAGTGTACACCAGCTTGGG - Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1036849689 8:12193103-12193125 CCCACACTGAATGCTAACTTGGG - Intronic
1036871053 8:12435376-12435398 CCCACACTGAATGCTAACTTGGG - Intronic
1038253620 8:25929679-25929701 TCCACAATGACTCCCTCCTTGGG + Intronic
1038297453 8:26308251-26308273 GCCACAGTCACTCCAACCTTCGG - Intronic
1039129955 8:34251901-34251923 CCCACATTGCAACCCTCCTTGGG - Intergenic
1039667003 8:39544379-39544401 CCTACACAGAGTCCCACCTTGGG - Intergenic
1043268844 8:78302957-78302979 TCCACAGTTAATCCCAGTTTTGG - Intergenic
1044398499 8:91742540-91742562 CCCATATTGAATCCTTCCTTTGG + Intergenic
1046373509 8:113344594-113344616 CTTACAGTGAATGCCAACTTAGG - Intronic
1047719181 8:127623108-127623130 ACAAAAGTTAATCCCACCTTAGG + Intergenic
1047821067 8:128521416-128521438 CCCTCAGTGACTCCTACCTCCGG + Intergenic
1048385053 8:133904377-133904399 CCCACACTGACTCCCTCCCTGGG - Intergenic
1048633203 8:136266970-136266992 CCAACAGTGCATCCCACATTGGG - Intergenic
1048783676 8:138028132-138028154 CCCACAGTGAACTCCATCCTTGG - Intergenic
1049403163 8:142439918-142439940 CCCACAGTGGCACCCACCTGAGG + Intergenic
1049891436 9:73666-73688 CCGACAGTGAGTCCCACTTGGGG - Intergenic
1052063356 9:23987347-23987369 TCCATAGTGAACACCACCTTAGG - Intergenic
1053082623 9:35190129-35190151 TCCACAGTATCTCCCACCTTTGG - Intronic
1054162053 9:61680513-61680535 ATCACAGTGAATGCCACCATTGG - Intergenic
1056276576 9:84999782-84999804 GCCACACTGACTCCCACCCTGGG + Intronic
1057206763 9:93178138-93178160 TCCCCAGCGAATCCAACCTTGGG + Intergenic
1057306299 9:93914086-93914108 ACCACAGTGAGCCCCACCTCGGG + Intergenic
1059753586 9:117271999-117272021 CCCACAGAGCATCCCTACTTGGG - Intronic
1060208278 9:121695271-121695293 CCCAGACTGACTCCCACCCTTGG + Intronic
1060219181 9:121755368-121755390 CCCACAAGGACTCCCACCTGGGG - Intronic
1060718405 9:125956009-125956031 CCCACTTTGCATCCCACTTTGGG + Intronic
1060920292 9:127415751-127415773 CTCACAGTGAATGCCAGGTTTGG - Intergenic
1186980745 X:14955128-14955150 CCCACAGAGAATCCCTACTGTGG - Intergenic
1187485523 X:19699549-19699571 CCAAGAGTGAATCTCACCTTTGG + Intronic
1189248878 X:39584650-39584672 CCCTAAGTGAATACCACCTTAGG - Intergenic
1189577896 X:42375102-42375124 CCCAGACTGACTCCCACCCTTGG - Intergenic
1194379970 X:93179466-93179488 CCCCCAGGGAATCCCCCTTTGGG - Intergenic
1195736293 X:108016396-108016418 ACCATACTGAATCCTACCTTGGG - Intergenic
1195887620 X:109656768-109656790 CCCACATGGAATCCCTCGTTGGG + Intronic
1198693326 X:139307807-139307829 CCCACACAGAATCCCCACTTGGG + Intergenic