ID: 1112725492

View in Genome Browser
Species Human (GRCh38)
Location 13:102299541-102299563
Sequence TCAAACAGGAGTAGAACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112725488_1112725492 13 Left 1112725488 13:102299505-102299527 CCCAGCTAGCAAGCAGGCAAGAG 0: 1
1: 0
2: 0
3: 13
4: 254
Right 1112725492 13:102299541-102299563 TCAAACAGGAGTAGAACCACTGG 0: 1
1: 0
2: 0
3: 16
4: 147
1112725489_1112725492 12 Left 1112725489 13:102299506-102299528 CCAGCTAGCAAGCAGGCAAGAGA 0: 1
1: 0
2: 2
3: 20
4: 196
Right 1112725492 13:102299541-102299563 TCAAACAGGAGTAGAACCACTGG 0: 1
1: 0
2: 0
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112725492 Original CRISPR TCAAACAGGAGTAGAACCAC TGG Intronic
906757267 1:48330353-48330375 TCACACAGCAGTGGAGCCACTGG - Intronic
909944453 1:81648254-81648276 ACACAGAGGATTAGAACCACAGG + Intronic
910715159 1:90222624-90222646 TCAAACAGGAGTAGCGGCAATGG - Intergenic
912428946 1:109618945-109618967 ACAAACAGCATTAGAACAACTGG + Intronic
916204674 1:162304241-162304263 ACAAACAGGGCTAGAACAACTGG - Intronic
921284033 1:213593114-213593136 TCAAACAGCAGAAGAAAGACTGG + Intergenic
923146301 1:231200846-231200868 GCAAAAGGGAGCAGAACCACGGG + Intronic
1066100501 10:32113894-32113916 ACAAACAGAAGTAGAAACAATGG - Intergenic
1066397599 10:35041364-35041386 TCAAACAGCTGTAAAACCCCTGG + Intronic
1068055314 10:52005666-52005688 TCAGGCAGAAGTAGAACCACTGG - Intronic
1071754725 10:88524224-88524246 TGTAACAGCAATAGAACCACTGG + Intronic
1071825671 10:89322931-89322953 TCAGACAGAAGTGGAACCACTGG - Intronic
1071838009 10:89439036-89439058 TCAATAAGGAGCTGAACCACAGG + Exonic
1073524963 10:104171945-104171967 CCAGACAGGAGAAGATCCACAGG + Intronic
1075464357 10:122640496-122640518 TCAAACATGAGTAGCCCCAAAGG + Intronic
1077461043 11:2709998-2710020 TCACAGAGGAGTAGAAACGCTGG + Intronic
1083838979 11:65292287-65292309 GCAAACAGGACGAGAACCGCGGG - Intronic
1084695446 11:70751300-70751322 TCATACAGAAGAAAAACCACAGG + Intronic
1092517789 12:9233676-9233698 TCAAAGAGGATTCGATCCACTGG - Intergenic
1092836535 12:12494533-12494555 GAAAACAGGAGTAAAACCAAAGG + Intronic
1095404315 12:41851123-41851145 TCAAACACCAGAGGAACCACTGG + Intergenic
1096079530 12:48824352-48824374 TCAAACAGGAGCAGAAGGCCAGG + Exonic
1096176638 12:49525338-49525360 TCAAACAGGAGAAGAACCTATGG - Intronic
1096439615 12:51629480-51629502 TCACACAGGTATAGAACCTCTGG + Intronic
1097438880 12:59585246-59585268 TCAAGCATGAGTAGCACCAGCGG - Intergenic
1100148399 12:91705873-91705895 TCAAAAAGTAGAAGAATCACAGG - Intergenic
1101063604 12:100996848-100996870 TCAAACAGTGGTAGCACCAATGG + Intronic
1104211348 12:126691738-126691760 TCAGACAGCAGTGGGACCACAGG - Intergenic
1105254544 13:18734059-18734081 TCACACAGCAGTAGTACTACTGG + Intergenic
1105497390 13:20942688-20942710 TCAAAAAGTTCTAGAACCACTGG - Intergenic
1109375348 13:61485688-61485710 CCACCCAGGAGTAGAATCACAGG - Intergenic
1112725492 13:102299541-102299563 TCAAACAGGAGTAGAACCACTGG + Intronic
1113274227 13:108710334-108710356 TCAAACAAAAGTAGAACAAAGGG - Intronic
1117080815 14:52150475-52150497 TCAGACAGAAGCAGAGCCACTGG + Intergenic
1117201538 14:53394785-53394807 TTTAACTGGAGTAGAACCATAGG - Intergenic
1119173282 14:72550701-72550723 TCCATCAGGTGTAAAACCACCGG - Intronic
1119960929 14:78855923-78855945 TGAAACATGACTAGAAACACAGG - Intronic
1120962393 14:90137270-90137292 TAAATCAAGAGTAGAAACACTGG - Intronic
1121000384 14:90447916-90447938 TCAAACAGGGGAAGAAACAGAGG - Intergenic
1122093717 14:99356277-99356299 ACACACAGCAGTAGAGCCACTGG + Intergenic
1126532947 15:49731359-49731381 TCACACAGAAGCAGGACCACTGG - Intergenic
1129694384 15:77732400-77732422 TAAAACGGGAGCAGAACCACGGG - Intronic
1130943717 15:88534426-88534448 TCAAGCAGCAGGAGAACCAGGGG - Intronic
1131031374 15:89188709-89188731 TCTAACAAGAGTAGAAAAACTGG + Intronic
1134879411 16:17731763-17731785 GCAACGAGGAGTAGAACCTCTGG - Intergenic
1135635421 16:24071576-24071598 CCAATCACAAGTAGAACCACTGG - Intronic
1139412685 16:66776993-66777015 GTAAACAGAAGTAGAACTACAGG + Intronic
1140127078 16:72126359-72126381 TCAAACAGCAGGAGTACCAGCGG + Intronic
1140380145 16:74479480-74479502 TCACACAGCAGTATAAACACTGG + Intronic
1140799943 16:78477360-78477382 TAAAAAAAAAGTAGAACCACAGG - Intronic
1144242539 17:13327486-13327508 CCTGGCAGGAGTAGAACCACTGG + Intergenic
1144574442 17:16420069-16420091 TCATGCTGGAGAAGAACCACAGG - Intronic
1149316880 17:55446986-55447008 TCAAACAGAGTTAGATCCACAGG + Intergenic
1150899407 17:69254822-69254844 TCAAAAAGGAGTAAAACATCTGG - Intronic
1151236031 17:72720330-72720352 AGAAACAGGAGTAGAAGCAGTGG + Intronic
1156505408 18:37587444-37587466 TCACACAGGAGTTGTACCAGAGG - Intergenic
1157779029 18:50420951-50420973 TCTAACAGGATAAGACCCACTGG - Intergenic
1158232211 18:55269668-55269690 CCAAACAGAAGTAAAATCACTGG - Intronic
1160970091 19:1764178-1764200 TCAAACAGGAGCAAAGCCAGTGG - Intronic
1161418035 19:4158871-4158893 CCAACCAGGATTAGAACCAAGGG + Intronic
1161527108 19:4763138-4763160 TCAAACAGGAACAAAACAACAGG + Intergenic
1164817877 19:31220088-31220110 ACAAACAGTGGTAGAACAACTGG + Intergenic
1165227138 19:34362898-34362920 TCAGGCAGGGGTAGAAACACGGG + Intronic
1167704576 19:51071962-51071984 TCACACAGGAGTGGGACCAAGGG - Intergenic
926215147 2:10901753-10901775 TCAGACAGGAGTAGACCAGCTGG + Intergenic
927414095 2:22858501-22858523 ACAAACAGGAGTGAAACCACTGG + Intergenic
928337868 2:30413578-30413600 GCATACAGGAGCAGAGCCACAGG + Intergenic
929230170 2:39551025-39551047 TCATACAGGATTAGAACCATAGG - Intergenic
929763437 2:44825119-44825141 TCACACAGCAGCAGAACCAAAGG - Intergenic
931260607 2:60615187-60615209 TCACACAGCACTAGATCCACTGG - Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
933199841 2:79436240-79436262 TCAAACAGGAGGAGGACAAATGG + Intronic
934489507 2:94750936-94750958 TCACACAGGAGTAGTACTACGGG + Intergenic
940670942 2:156667257-156667279 GCAAACAGGAATGGAACAACTGG - Intergenic
941566583 2:167115802-167115824 TCAGACAGAAGCAGAACTACTGG + Intronic
943540236 2:189204703-189204725 TCAATCAGGAGTTAAGCCACAGG - Intergenic
946385439 2:219381560-219381582 ACAAGCATGAGGAGAACCACCGG - Exonic
948168051 2:235878328-235878350 TCAAAGAGAAGGAGAAACACTGG - Intronic
948327900 2:237141269-237141291 TTAAAGAGGAGTAGGATCACCGG - Intergenic
1169521387 20:6377274-6377296 TAAGACAGGAGTAAATCCACTGG + Intergenic
1169792939 20:9430802-9430824 ATAAACAGGAGGAAAACCACTGG + Intronic
1170044882 20:12074424-12074446 GCATATAGGAGTAGAATCACTGG + Intergenic
1171879451 20:30606884-30606906 TCACACAGGAGTAGTACTACTGG + Intergenic
1174149546 20:48476448-48476470 TCAAACAGGAACAGCAGCACCGG + Intergenic
1175938372 20:62525609-62525631 CCAAACAGTAGTAGAAACACTGG - Intergenic
1176972969 21:15288160-15288182 TCAAACAAGGGAAGGACCACTGG + Intergenic
1177117316 21:17102077-17102099 TCAACTAGGAGGAGAAACACTGG + Intergenic
1177320404 21:19513070-19513092 TCACACAGAAGTGGCACCACTGG - Intergenic
1177646208 21:23902636-23902658 TCAGACATGAGCAGAACCATGGG + Intergenic
1178159455 21:29894798-29894820 TCAAACAGAAGTGGATCCAGGGG - Intronic
955517502 3:59742290-59742312 ACAAACAAGATCAGAACCACAGG - Intergenic
956413047 3:68998424-68998446 TCAAAACTGAGTAGAACTACAGG + Intronic
958093918 3:88915535-88915557 TAAAACAGAAATAGAACCGCTGG - Intergenic
962341978 3:134593543-134593565 TCAAACAGGGGCTGAGCCACAGG + Intergenic
962473079 3:135731162-135731184 TCACACAGAAGTGGGACCACTGG + Intergenic
963857948 3:150275499-150275521 TAAAACAGAATCAGAACCACAGG - Intergenic
968879245 4:3290763-3290785 GCCTACAGGAGGAGAACCACAGG + Intergenic
970345062 4:15145151-15145173 TCTAAAAGGAGCAGAAACACTGG + Intergenic
970724810 4:19031284-19031306 TGAATCAGGTGTGGAACCACAGG + Intergenic
972142829 4:35982592-35982614 TCAGGCAGAAGTGGAACCACTGG - Intronic
972177695 4:36427931-36427953 TCACACAGAAGTGGAGCCACTGG - Intergenic
973248532 4:48036979-48037001 TAAAACAGAAGTGAAACCACGGG + Exonic
973920989 4:55684931-55684953 ACAAAGGGAAGTAGAACCACTGG - Intergenic
974715400 4:65662983-65663005 TCAAACAAAAGTAGAACCTAGGG - Intronic
981159680 4:141483090-141483112 TGAAACAGGATTAGAATGACTGG + Intergenic
981240809 4:142474103-142474125 TCAGACAGAAGTGGAACCACTGG - Intronic
984157150 4:176207027-176207049 TCAAACAGGAGAAGATCGAGAGG - Intergenic
985075885 4:186214152-186214174 TCAATCAGCAATAGAACCTCTGG + Intronic
986654690 5:9999598-9999620 TCACACAGAAGTGGGACCACTGG - Intergenic
987781727 5:22445754-22445776 TCAAACAGCAGTATGCCCACAGG - Intronic
988675374 5:33427937-33427959 TCAGGCAGAAGTAGAACCACTGG + Intergenic
988675420 5:33428220-33428242 TCACACAGAAGTGGGACCACTGG + Intergenic
991288915 5:65011807-65011829 TCCAAAAGGAGCAGAACCAAGGG - Intronic
991408151 5:66321632-66321654 TTGAACAGGAGGAGAACCAGTGG + Intergenic
996061539 5:119038709-119038731 GTAAACAGGAATAGACCCACTGG + Intronic
998776516 5:145609726-145609748 TCACACAGAAGTGGAACCACTGG + Intronic
1003541220 6:7019728-7019750 TCAGACTGGAGAAGAACCAAGGG - Intergenic
1003796808 6:9614063-9614085 TTAAAAAGGAGAAGAAGCACTGG - Intronic
1005224154 6:23621839-23621861 TCAAAAATGAGCAGCACCACAGG + Intergenic
1005339835 6:24833114-24833136 ACAGAAAGGAGTAGAACCATTGG - Intronic
1007692944 6:43714659-43714681 TCAACCAGGAGTAACCCCACTGG + Intergenic
1013051985 6:106545297-106545319 TGGAACAGGTGTAGGACCACAGG - Intronic
1014290287 6:119550577-119550599 TCAAACATGAAAAGAAGCACTGG - Intergenic
1014620218 6:123658471-123658493 TTAAACTTGAGTAGATCCACAGG + Intergenic
1015995959 6:138995528-138995550 TCATAGAGTAATAGAACCACTGG - Intergenic
1018857818 6:167688113-167688135 TCAAACGGGAGTAGGACCCCTGG + Intergenic
1018882963 6:167903692-167903714 GCAAACAGGAGTAGAAAAATGGG - Intronic
1019031565 6:169018247-169018269 TCAGACAGAAGTGGGACCACTGG + Intergenic
1023075937 7:36482949-36482971 TCAGACAGAAGTGGGACCACTGG + Intergenic
1024645798 7:51369343-51369365 TCAGACAGAAGTGGTACCACGGG - Intergenic
1025036656 7:55597460-55597482 TCAGACAGAAGTGGTACCACGGG - Intergenic
1026129969 7:67612159-67612181 TCAGACAGGAGGAAAACCAGAGG - Intergenic
1028019184 7:85749638-85749660 TCAGGCAGGAGCTGAACCACTGG - Intergenic
1028900149 7:96089647-96089669 TCAAACAGTTGTCAAACCACTGG + Intronic
1041220644 8:55648125-55648147 TCAAGCAGAAGCAGGACCACTGG + Intergenic
1043676673 8:82965108-82965130 ACAAACAGTAGTACAAGCACAGG + Intergenic
1044616707 8:94149831-94149853 ACAGACAAGACTAGAACCACAGG + Intronic
1045581334 8:103483522-103483544 AGAAACAGAAGTAGAGCCACTGG + Intergenic
1045652365 8:104352974-104352996 TCACACAGGAAGAGAAACACTGG + Intronic
1045983728 8:108222530-108222552 TCAAACATGACCAAAACCACAGG + Intronic
1047224725 8:122946633-122946655 TCAGGCAGGAGTAGACCCAGGGG - Intronic
1047356797 8:124129656-124129678 TCACACAGAAGTGGGACCACTGG - Intergenic
1047990967 8:130286519-130286541 TCAAGCAGGATTAGAAACTCAGG - Intronic
1050199955 9:3133887-3133909 TAAAACAGCACTAGAACCACAGG + Intergenic
1053668281 9:40333333-40333355 CCACACAGGAGTAGTACTACTGG - Intergenic
1053918086 9:42959626-42959648 CCACACAGGAGTAGTACTACTGG - Intergenic
1054379423 9:64473385-64473407 CCACACAGGAGTAGTACTACTGG - Intergenic
1054516331 9:66042960-66042982 CCACACAGGAGTAGTACTACTGG + Intergenic
1056726446 9:89123183-89123205 CAAAACAGAAGTATAACCACAGG - Intronic
1056935059 9:90910229-90910251 TCATACAGGAGTAGGACTGCAGG - Intergenic
1057546587 9:96023340-96023362 TAAAAAAGGAATAAAACCACTGG - Intergenic
1058198502 9:102008833-102008855 TCACACAGAATTAGGACCACAGG - Intergenic
1058469517 9:105263029-105263051 TAAAATAGGACTAGAAACACTGG - Intronic
1059451772 9:114375834-114375856 TGAAACACGAGTACAATCACTGG + Intronic
1062297258 9:135839120-135839142 TCATACAGGAGCAGAACCGAAGG - Intronic
1186884786 X:13902646-13902668 GAAACCAGGAGAAGAACCACAGG + Intronic
1187047115 X:15657766-15657788 TAAAACAGGAGTAGAACTTAGGG + Intronic
1189133044 X:38520116-38520138 TTACACAGGAGTAGAAGCATTGG + Intronic
1189873006 X:45404309-45404331 TCAGACAGAAGCAGGACCACTGG - Intergenic
1192001493 X:67156576-67156598 TCAGAAAGGAGTAGAACCTGTGG - Intergenic
1192849800 X:74942787-74942809 TCAGGCAGAAGTGGAACCACTGG + Intergenic
1194981915 X:100449966-100449988 TCAAACAAAAGTGGGACCACTGG - Intergenic
1198010860 X:132552364-132552386 CCAAACAGCAGTAGATCCACTGG - Intergenic
1198565613 X:137902118-137902140 TCAAACAGGAATAGAATCATAGG - Intergenic