ID: 1112725707

View in Genome Browser
Species Human (GRCh38)
Location 13:102302062-102302084
Sequence TTGAACAAGCAGTGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112725707 Original CRISPR TTGAACAAGCAGTGTGAGGA AGG (reversed) Intronic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
905206673 1:36346595-36346617 TTGAACCAGCTGTGTGATCACGG - Intronic
906647211 1:47483786-47483808 ATGACCAAGCAGGCTGAGGATGG + Intergenic
908219396 1:61989085-61989107 CTGACAAATCAGTGTGAGGATGG - Intronic
910215096 1:84835816-84835838 TTGACCAAGAAGTGTGGGCAGGG - Intronic
910579332 1:88805156-88805178 TTGAGAAAGTAGTGAGAGGATGG - Intronic
910723456 1:90313012-90313034 GAGAACAAGCAGAGTAAGGAAGG + Intergenic
911882191 1:103254073-103254095 TTGCACAGGGAGTGTGGGGAGGG + Intergenic
916285076 1:163097774-163097796 TTGTATAATCAGTGTGTGGAGGG - Intergenic
916875287 1:168962257-168962279 TAGAAGATGCAGTTTGAGGATGG + Intergenic
917626930 1:176855750-176855772 TGCAACAAGCAGTCTGAAGATGG - Intergenic
918585900 1:186188050-186188072 TTGGTCAAGGAGTGGGAGGAAGG - Intronic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
920903146 1:210132363-210132385 ATGTCCAAGCAGGGTGAGGAGGG - Intronic
921725539 1:218519470-218519492 GAGAACACGAAGTGTGAGGAAGG + Intergenic
921725955 1:218523599-218523621 GAGAACATGAAGTGTGAGGAAGG + Intergenic
922465343 1:225842665-225842687 TTGACCATGCACTGTGAGGCTGG - Intronic
924186975 1:241503072-241503094 TTGTCCAAGGAGTGTGAGCAGGG - Intronic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1063301146 10:4849927-4849949 TTGTACAATCACAGTGAGGAAGG + Intergenic
1063877139 10:10492003-10492025 TAGCACAAGAAGTGAGAGGACGG - Intergenic
1067784988 10:49239329-49239351 TTGAGCAAGCAGGGAGAGGATGG + Intergenic
1068826584 10:61447068-61447090 TTGGACACGAAGTGTGAAGAGGG + Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070871695 10:79760019-79760041 TTGAACCAGCATCGTCAGGAAGG + Intergenic
1071311709 10:84349092-84349114 TTTAAAAAGCAGTCTGTGGAAGG - Intronic
1071638618 10:87282182-87282204 TTGAACCAGCATCGTCAGGAAGG + Intergenic
1071656624 10:87455770-87455792 TTGAACCAGCATCGTCAGGAAGG - Intergenic
1072201192 10:93160458-93160480 TTGAAAAAGTAGTGTGATGTAGG + Intergenic
1073111764 10:101066861-101066883 TTGAACCAGCAGGGCGGGGAGGG - Intronic
1075076123 10:119351617-119351639 TTTATCAAGCAGAGTGAGGATGG + Intronic
1075092149 10:119449843-119449865 TTGAGCAGGCAGGGGGAGGATGG + Intronic
1076577517 10:131479556-131479578 AGGAACCAGCACTGTGAGGAAGG + Intergenic
1077382857 11:2253648-2253670 TAGCACAAACAGTGGGAGGAAGG + Intergenic
1077772309 11:5233446-5233468 TTGATTAATCAGTGTGATGATGG + Intronic
1078441841 11:11374561-11374583 TTGAACTGTCAGTTTGAGGAAGG - Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079746204 11:24133776-24133798 TTGAAAAATCAGTGTGAGCAAGG + Intergenic
1080340129 11:31252848-31252870 TGGAACAAGCAGTGACGGGATGG + Intronic
1080412702 11:32040897-32040919 TAGAAAAAGGAGGGTGAGGAGGG - Intronic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1086582786 11:88418473-88418495 TCAAACAAGCATGGTGAGGATGG + Intergenic
1087004593 11:93457038-93457060 TTGAATAAGAAGGGTGAGAATGG - Intergenic
1087014215 11:93540701-93540723 TTGAGCAGGCATTGTGAGGTAGG - Intronic
1087106575 11:94415372-94415394 TTGAACAGGCACTGTGATCAAGG + Intergenic
1087199142 11:95328173-95328195 TTGAGCAAGTAGTGAGAAGAGGG - Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1090562136 11:127943703-127943725 TTGAACAAGCATTTTGTGAAAGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092522927 12:9292166-9292188 TTGCACCAGCTGTATGAGGAAGG + Intergenic
1092818378 12:12330839-12330861 TTGAATAATCTGTGTGATGATGG + Exonic
1093196184 12:16132044-16132066 TTGACCAAGCAGAGAGAGAATGG - Intergenic
1094368090 12:29705551-29705573 CTGGACAAGCAGTGTAAGCAAGG - Intronic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1098859621 12:75693122-75693144 TTCAACAAGCCCTGTGAGTAAGG - Intergenic
1102789405 12:115631939-115631961 TTGAACAAGCAATGTAAATAGGG - Intergenic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1104334731 12:127883412-127883434 TTGAACAAGTAAAGTGGGGAAGG - Intergenic
1109559469 13:64027962-64027984 TGGGACAAGAACTGTGAGGAGGG + Intergenic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110658008 13:78023572-78023594 TTGAATGAGAAGTGTGGGGAAGG + Intergenic
1111899645 13:94185129-94185151 GTGAACTAGCAGAGTGGGGAAGG + Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1114303453 14:21399060-21399082 GTGAACAAACAGTTGGAGGATGG + Intronic
1114355422 14:21902977-21902999 AAGAACAAGAAGTGTGGGGAAGG - Intergenic
1114712548 14:24793300-24793322 TGGGAAAAGCAGTGTGAGAAAGG + Intergenic
1119226304 14:72946995-72947017 TGGAACAAGCATTCTGAGGGTGG - Intronic
1120767743 14:88345632-88345654 TTTAACAAGCAGTGGGTGGTTGG + Intergenic
1121454292 14:94028330-94028352 TTGAACTTGCATTGTGTGGATGG + Intronic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1122419551 14:101566852-101566874 TTGAGCAAGGAGAGAGAGGAGGG + Intergenic
1126458021 15:48885755-48885777 TAGTGCAAACAGTGTGAGGAAGG + Intronic
1126575312 15:50190945-50190967 TTGAACAAGCACTGAGCAGAAGG + Intronic
1127229878 15:56979057-56979079 TAGAACATGCAGTGTTTGGATGG + Intronic
1127708592 15:61572327-61572349 TGGAAAAAGCAGTGTGTAGAGGG - Intergenic
1128107469 15:65055278-65055300 GTGAGGAAGCAGTGTGAGGCAGG + Intronic
1128525778 15:68411347-68411369 TTGAAGAAGGAGTGTGTGGGAGG - Intronic
1129203139 15:74017819-74017841 TTGAGGAATCAGTGTAAGGAAGG - Intronic
1131635001 15:94223325-94223347 TAGAAAAAGCAGGGTGAGGTGGG + Intergenic
1133366613 16:5215374-5215396 TAGAAGACGCAGGGTGAGGAAGG - Intergenic
1134151127 16:11805817-11805839 TTGAATAATCACTGTGAGGCCGG + Intergenic
1134680881 16:16124637-16124659 TTGAAAAAGCAGTGCCAGGAAGG + Intronic
1135223545 16:20636046-20636068 TTGAAACCACAGTGTGAGGATGG + Intronic
1135765053 16:25170358-25170380 TTGAACAAGCATTGTTATAATGG - Intronic
1140127591 16:72131158-72131180 TAGAAAAAGAAGTGGGAGGAAGG + Intronic
1140873824 16:79131752-79131774 TTTATCAAGCAGTGTGAAAATGG - Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1148238720 17:45986087-45986109 TTCACCAAGGAGTGTGATGAAGG + Intronic
1149436666 17:56639280-56639302 TTTTACAAGCTGTGTGATGAAGG - Intergenic
1150578608 17:66452418-66452440 GGGAAGAAGCAGGGTGAGGAGGG + Intronic
1151097450 17:71514814-71514836 TAGAGGAAGCAGTGTGAGAAAGG + Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151340752 17:73469337-73469359 TGGAACCCGCAGTGTGGGGAAGG + Intronic
1152059450 17:78059549-78059571 TTGAAAATACAGTGTGAGGCCGG + Intronic
1155359362 18:24984750-24984772 TGGAACAAATAGTGTGAGGTGGG - Intergenic
1156610797 18:38721805-38721827 GGGAAAAAGCAGTGTCAGGAGGG - Intergenic
1157238013 18:45982174-45982196 TTGAAGAAGTAGTGATAGGATGG + Intergenic
1158109948 18:53929767-53929789 ATGAACAAGCTGTGTGAGTATGG + Intergenic
1158656605 18:59341679-59341701 TGAAAAAAGCAGTGTGAAGAGGG + Intronic
1159249314 18:65853259-65853281 CTGAACTAGAAGTGTGAGGATGG - Intronic
1159448894 18:68575216-68575238 TTGATCAAGTAGTCTGAAGAAGG + Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1161625611 19:5324843-5324865 TTTTGCAAACAGTGTGAGGATGG - Intronic
1162087657 19:8258195-8258217 TGGACCATGCAGTGGGAGGAAGG + Intronic
1163674649 19:18649427-18649449 TTGAACCAGCAGGGTGTGGGCGG + Intronic
1163890902 19:20012083-20012105 TGGCAAAAGCAGTGTTAGGAGGG + Intronic
1165581238 19:36865836-36865858 TTGAACAAGCTATGAGTGGAAGG - Intronic
1166336545 19:42111715-42111737 TTGAGCCAGGAGGGTGAGGATGG - Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167456713 19:49600083-49600105 TTACACAAGCATTTTGAGGAAGG + Intronic
926710327 2:15874480-15874502 TTAAACATGCAGTGTGTGTAGGG - Intergenic
926741091 2:16111530-16111552 TGGAGCATGAAGTGTGAGGAAGG + Intergenic
927550014 2:23990073-23990095 AAGCCCAAGCAGTGTGAGGAAGG - Intronic
928999361 2:37330507-37330529 TTTAACAAGCTGTGTGACCAGGG + Intergenic
931710584 2:64986745-64986767 TTGAACAAGAAGTGATATGAAGG + Intergenic
933830864 2:86207352-86207374 TTGAAAAAGGAATGTGAGGCCGG + Intronic
934863344 2:97782564-97782586 TTGAACAAGCATTTTTATGATGG - Intronic
936091024 2:109501576-109501598 GTGCACAAGAAGCGTGAGGACGG + Exonic
936729190 2:115360420-115360442 TTTCACAGGCAGTGTGTGGAAGG + Intronic
937446257 2:121961064-121961086 ATGAACAAGCAGCGTGGCGAAGG - Intergenic
941733818 2:168949807-168949829 TTGAATCAGCAGTATGGGGAAGG + Intronic
946791008 2:223300391-223300413 TTGAAGAAGACGTGTGTGGATGG + Intergenic
947476479 2:230453014-230453036 TTTTATTAGCAGTGTGAGGATGG - Intronic
947929441 2:233951461-233951483 TTGTACAAGGAGTAAGAGGAAGG - Intronic
948629995 2:239296162-239296184 TTGAACAAGCAGAGTGCTCAAGG - Intronic
949022409 2:241748996-241749018 TGGAACAGGCCCTGTGAGGATGG + Intronic
1168977427 20:1978007-1978029 TAGAAAATGCAGAGTGAGGAAGG - Intergenic
1169952820 20:11064899-11064921 TTGAAAAAGCAGTGTAAAGGGGG + Intergenic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170406156 20:16039721-16039743 TAGAATAGGCAGTGTGAGAAAGG + Intronic
1170578124 20:17680213-17680235 TCAAACAAGGAGTGTGAGGAGGG + Intronic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171371499 20:24665281-24665303 CGGAACAAGCAGTGAGTGGAGGG - Intronic
1173033271 20:39381931-39381953 TTGTACAAACAGAGTAAGGATGG + Intergenic
1173980237 20:47218369-47218391 TGGCACAAGTGGTGTGAGGAAGG - Intronic
1175034290 20:55985122-55985144 GTGCCCAAGCAGGGTGAGGAAGG + Intergenic
1175241820 20:57555303-57555325 GGGAACAAGTAGTGGGAGGATGG - Intergenic
1177807693 21:25890194-25890216 GTGGATGAGCAGTGTGAGGAAGG - Intronic
1182412344 22:30197851-30197873 TTGATGAAGCTGTGTGTGGAAGG - Intergenic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182650233 22:31845585-31845607 TGGAGCAAGAAGAGTGAGGAAGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184302598 22:43570993-43571015 TTAACAAAGCAGTATGAGGAAGG + Intronic
1184765487 22:46569978-46570000 TTGAACTAGCTGTGTGATGCTGG + Intergenic
1185156229 22:49195100-49195122 TAGAACAAGCAAGGTGAGGGAGG - Intergenic
949317797 3:2776082-2776104 TTGAACACAAAGTTTGAGGATGG + Intronic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
954036562 3:47853970-47853992 TGGAACACTCAGTGTGAGGAAGG + Intronic
954761246 3:52875923-52875945 CTGGAGAAGCAGTGTGAGGGTGG + Intronic
954796469 3:53163789-53163811 TTGACCAAGCAGCTTGAGGGAGG + Intronic
955153108 3:56388453-56388475 TTGTACAAGAAGTGTGATGCTGG - Intronic
955286706 3:57648464-57648486 GGGAACAAGCAGTGTAAGGAGGG - Intronic
956587574 3:70880882-70880904 TTGATCACGTAGTATGAGGAAGG + Intergenic
960081637 3:113547594-113547616 TTGAACAAGAAGAGTGAAGTTGG + Intronic
964737252 3:159929583-159929605 TTGAGGAAGAAGTGTGAGGAGGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965481666 3:169226155-169226177 TTAAAAAAGAAGTGTGAGGCAGG - Intronic
966888135 3:184387895-184387917 TTGAGCAAGGAGTGTCAGGCAGG - Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968718506 4:2179983-2180005 TTGAACAGGTAGTGTGTGCAAGG + Intronic
970743537 4:19266745-19266767 TTCCACATGCAGTGAGAGGAGGG + Intergenic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
971435749 4:26621339-26621361 CTCAACCAGCACTGTGAGGAAGG - Intronic
971912440 4:32811147-32811169 TTTATAAAGCAGTGTGAGAATGG - Intergenic
972053048 4:34764647-34764669 TTGAACAAGTCGTCTGCGGATGG + Intergenic
973128182 4:46615048-46615070 ATGATCAAGCATGGTGAGGAAGG + Intergenic
973662944 4:53126610-53126632 TTTAAAAACCGGTGTGAGGATGG - Intronic
973940391 4:55903413-55903435 TTGAACAGGCAAAGTGGGGATGG + Intronic
978624063 4:110664520-110664542 TTGAAAGAGAAGGGTGAGGATGG + Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
987483646 5:18493476-18493498 TTGTACCTGCAATGTGAGGAAGG + Intergenic
988544643 5:32143800-32143822 TTGAATTAGCATTGAGAGGAAGG - Exonic
989328203 5:40224841-40224863 TTTTACTAGCAGCGTGAGGATGG - Intergenic
990843877 5:60114710-60114732 TTTAACAAGCAAAGTGATGATGG - Intronic
991250900 5:64559900-64559922 TTGACCAACTAGTTTGAGGAGGG - Intronic
992956093 5:81909899-81909921 TTGAACAGGCAGTGTGTGTGGGG - Intergenic
993013575 5:82510704-82510726 TTGAACTAATAGTGTGAGGAAGG - Intergenic
993588832 5:89767725-89767747 TTTATTAAGCAGTGTGAGAATGG + Intergenic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
995387203 5:111601188-111601210 TTGAACAGGCAGGGTCAGGCTGG + Intergenic
996872379 5:128206044-128206066 TTGCACATGGATTGTGAGGAAGG + Intergenic
997441472 5:133911645-133911667 TGAAACAAGCAGTGTGGGCAGGG - Intergenic
998607969 5:143655634-143655656 TTGAATAAGCAGTGTGGTCAAGG + Intergenic
999059621 5:148619342-148619364 TTGAACAGGCAGTGTTTGTAAGG - Intronic
999226940 5:150033456-150033478 GTGAACATGAAGTGTGAGTATGG + Intronic
1003169336 6:3708808-3708830 TTGTTCATGCAGTGTGAGGAAGG + Intergenic
1003569803 6:7248348-7248370 TTGAACCAGCAAACTGAGGACGG - Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004255498 6:14059817-14059839 ATGCACAAGGGGTGTGAGGAGGG + Intergenic
1005719524 6:28587368-28587390 TTGCACAACCAGTGAGAAGACGG - Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1009479361 6:64137453-64137475 ATGATCAAGCATCGTGAGGAAGG - Intronic
1009991266 6:70845877-70845899 TTGAACAAGTACAGTGAGGCTGG - Intronic
1010508990 6:76694197-76694219 TTGAACCAGCAGTCTGAGTCAGG - Intergenic
1012534751 6:100281912-100281934 TTCAACCAGTAGTGAGAGGAGGG - Intergenic
1012805275 6:103885479-103885501 TTGAACAAGTCCTGTGAGGATGG + Intergenic
1012862182 6:104573167-104573189 TTGAACGATCAGTGTTAGCAAGG - Intergenic
1013057951 6:106603462-106603484 AAGAACATGCAGTATGAGGATGG - Intronic
1013062941 6:106654828-106654850 TTGAATAACTGGTGTGAGGAAGG - Exonic
1013300314 6:108799038-108799060 TTGGAAAAGTAGTGTGAGCAGGG - Intergenic
1013862353 6:114650953-114650975 TAGGACAAAGAGTGTGAGGATGG + Intergenic
1015970507 6:138738748-138738770 TTGAACCAGGAGAGTGATGAGGG + Intergenic
1016132750 6:140497337-140497359 TTGAACAAAAAGGGTGAGTAAGG - Intergenic
1016356594 6:143225135-143225157 TTGAACAGGCAGAGACAGGAGGG - Intronic
1018678307 6:166242043-166242065 TTGACCAAGAGATGTGAGGAGGG - Intergenic
1019619695 7:1985620-1985642 TTCAAAAAGAAGTGTCAGGATGG - Intronic
1019787150 7:2984280-2984302 TAGAACAAACAGTCAGAGGAAGG + Intronic
1022687455 7:32610081-32610103 TAAAACAAGCAATGTGAGGCTGG + Intergenic
1023545451 7:41313550-41313572 GAGAACAAGCTGTGTGAGTAAGG + Intergenic
1024758877 7:52569765-52569787 TTCAATAAGCATTGTGAGGTTGG + Intergenic
1024983398 7:55176238-55176260 TTATAAATGCAGTGTGAGGAGGG + Intronic
1026095046 7:67340292-67340314 TTGGACATGCAGTGAGAGGGAGG + Intergenic
1026869001 7:73839622-73839644 GTGAGGAAGCAGTGAGAGGAAGG + Intronic
1030960348 7:115912571-115912593 TGGAGCAAGAAGGGTGAGGATGG - Intergenic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1033091120 7:138387094-138387116 TTGAACAAGCAGAATGTGAATGG + Intergenic
1033635623 7:143209211-143209233 TTGAGCAAGCAGGGAAAGGAAGG - Intergenic
1037631070 8:20656873-20656895 TTGGATAAGAAGGGTGAGGAGGG - Intergenic
1037663078 8:20943722-20943744 TTGAACAGGCTCTGGGAGGAGGG + Intergenic
1040431925 8:47351349-47351371 TTTTAAAAGCAGTGTGAAGAAGG + Intronic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1042817780 8:72896718-72896740 TTGAAAAAGCACAGTGAGAAAGG - Intronic
1043033215 8:75165053-75165075 TTGACCAAGAACTGGGAGGATGG - Intergenic
1043175047 8:77014655-77014677 TTGAACAAGCAGTTTCATTATGG - Intergenic
1044737088 8:95290101-95290123 TTGAGGAAGCAGTGGGGGGAAGG - Intergenic
1046622284 8:116541016-116541038 TTGAACAAGCAATGTCATGTTGG - Intergenic
1046957156 8:120073516-120073538 CTGAAGATGCAGTGTGAAGAGGG - Intronic
1049126950 8:140799239-140799261 TTTACAAAGCAGTTTGAGGAAGG - Intronic
1049128104 8:140810564-140810586 AGGAACCTGCAGTGTGAGGAAGG - Intronic
1052469021 9:28869428-28869450 ATGAACAAGGAGTGGGGGGAGGG + Intergenic
1055155248 9:73054991-73055013 TTGGTGAAGCACTGTGAGGAGGG + Intronic
1056057513 9:82842348-82842370 TTGATCAAACAGTTTGAGGCTGG - Intergenic
1057319796 9:94002040-94002062 GTGAACATGGAGTCTGAGGATGG - Intergenic
1186368345 X:8919397-8919419 TTGAAGATGCAGTGAGAGAATGG - Intergenic
1189535285 X:41928626-41928648 TTCAACAGCCAGTGTTAGGACGG - Intergenic
1190260645 X:48794756-48794778 TTGAACAAGAAGTGTGTGTCAGG + Intergenic
1191895845 X:65992540-65992562 TTGAACAGGCAGTTTGCAGAAGG - Intergenic
1192261433 X:69507976-69507998 TTTACCAAGCAGTGTGACGTAGG + Intronic
1192903422 X:75523594-75523616 TTCAAGCAGCAGTGGGAGGATGG - Intergenic
1193482644 X:82046408-82046430 TTCTTCAAGCAGTGTGAGAATGG + Intergenic
1194547052 X:95249603-95249625 TTTAAGAAGAAATGTGAGGAAGG + Intergenic
1195993589 X:110708770-110708792 TTGAAAGAGCAGAGTGTGGATGG - Intronic
1196552125 X:117041251-117041273 TTAAAGAAGTAGTGAGAGGAAGG - Intergenic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198247126 X:134840896-134840918 ATGAACAAGCAGTGAGTAGAGGG - Intronic
1198279752 X:135130071-135130093 TTGAACAGGCCGCATGAGGATGG - Intergenic
1198291205 X:135242443-135242465 TTGAACAGGCCGCATGAGGATGG + Intergenic
1199791288 X:151157513-151157535 TTGGAGAAGCAGTGTGGGGCAGG + Intergenic
1201148157 Y:11077858-11077880 GTGAAAATGCAGTCTGAGGATGG + Intergenic
1201954884 Y:19612967-19612989 TTGAAAAAGCATTTTCAGGAGGG + Intergenic