ID: 1112727311

View in Genome Browser
Species Human (GRCh38)
Location 13:102319352-102319374
Sequence CTGTATCTAAGCAGAGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112727311_1112727317 17 Left 1112727311 13:102319352-102319374 CCCCCTGCTCTGCTTAGATACAG 0: 1
1: 0
2: 1
3: 12
4: 162
Right 1112727317 13:102319392-102319414 TGAAAATTTCCCAGAAAACCTGG 0: 1
1: 0
2: 3
3: 32
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112727311 Original CRISPR CTGTATCTAAGCAGAGCAGG GGG (reversed) Intronic
900975376 1:6013068-6013090 CTGAAGCCAAGCAGAGCAGTGGG - Intronic
902089155 1:13889253-13889275 CTGGATCTAAGAAGAGAAGTAGG - Intergenic
903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG + Intronic
903917559 1:26775179-26775201 CTGTGTTGAAGCAGAGGAGGCGG + Exonic
904497587 1:30895812-30895834 CTCTAGGGAAGCAGAGCAGGGGG + Intronic
908772388 1:67608928-67608950 CTGTCACTAAGCATATCAGGAGG - Intergenic
909942611 1:81627876-81627898 CAGGATCTAAGCACAGCAGTGGG - Intronic
913656420 1:120964731-120964753 CTCAATCTAACCAGAGCATGAGG - Intergenic
914351533 1:146844200-146844222 CTGTGTATCAACAGAGCAGGAGG - Intergenic
914520972 1:148415960-148415982 CTCAATCTAACCAGAGCATGAGG - Intergenic
914646381 1:149656461-149656483 CTCAATCTAACCAGAGCATGAGG - Intergenic
918838421 1:189501072-189501094 CTGTATGTAAGTAGAGATGGTGG + Intergenic
920076946 1:203344152-203344174 CTGTGTACAAGCAGAGCAGTGGG + Intronic
920970028 1:210735173-210735195 CTGCATCTAATCAGATGAGGGGG - Intronic
921491584 1:215783158-215783180 CTGTTTCTGAGCAGAGAAAGAGG + Intronic
923349898 1:233093730-233093752 CTGTATCTTAGCAGAAGGGGTGG + Intronic
924614864 1:245604304-245604326 CTGCATCTGAGTAGAGGAGGTGG + Intronic
1063818558 10:9807356-9807378 GTGAATCTAAGCAGTGCAAGGGG - Intergenic
1065274223 10:24069083-24069105 CTGGCTCAATGCAGAGCAGGTGG - Intronic
1066750710 10:38653691-38653713 CTCTGTCTAAGCAGGGCACGAGG - Intergenic
1066966339 10:42269417-42269439 CTCTGTCTAAGCAGGGCACGAGG + Intergenic
1067561427 10:47307483-47307505 CTGCATGTACGCAGTGCAGGGGG - Intronic
1070815677 10:79321605-79321627 CTGGATCTGAGCAGTGCAAGGGG + Intergenic
1070969162 10:80549416-80549438 CTGTATGGAGGCAGAACAGGAGG - Intronic
1071395848 10:85223434-85223456 CTAAATCTAAGCAGAGCAATAGG + Intergenic
1075442906 10:122493865-122493887 GGGTGTCTGAGCAGAGCAGGTGG - Intronic
1075853351 10:125606574-125606596 CTGTAGCTTATCAGATCAGGGGG + Intronic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1076258107 10:129044878-129044900 CTGGTTCTGAGCAGGGCAGGGGG - Intergenic
1076549804 10:131271098-131271120 CTGCCTCTGAGCAGAGAAGGCGG - Intronic
1083490178 11:63009908-63009930 CTGGATCTGAGCAGAAGAGGAGG + Intronic
1086968374 11:93053890-93053912 CTGTATCTCAGGAAAGCTGGGGG - Intergenic
1089859048 11:121572605-121572627 CTGTTTCTAAGCAGGGCTGCAGG + Intronic
1092204238 12:6606160-6606182 CTGTCTCTGTGCAGAGCCGGAGG - Intronic
1093399722 12:18731001-18731023 CTGAATCCAAGCAGTGCATGTGG - Intronic
1093756499 12:22858929-22858951 CTGTAGCTAACCAGGGAAGGAGG + Intergenic
1095990719 12:48032718-48032740 CTGTACCAGAGCGGAGCAGGAGG + Intergenic
1096199943 12:49674321-49674343 CTCTATCGAGGCAGGGCAGGGGG - Intronic
1096204948 12:49713568-49713590 CTGAACCAAATCAGAGCAGGGGG + Intronic
1096345274 12:50841005-50841027 CTGCCTCTAAGCAGATCATGCGG + Intergenic
1098016764 12:66113279-66113301 CTGTATCAATGCAAGGCAGGTGG - Intergenic
1098324912 12:69291101-69291123 CTGAATCTGAGCACAGCAAGGGG + Intergenic
1098450365 12:70611911-70611933 CAGTATCTGTGGAGAGCAGGAGG - Intronic
1100488447 12:95054558-95054580 CTGTATCCCAGCAGCTCAGGAGG - Intronic
1101006714 12:100407983-100408005 CTGTATTTAAGCAGAAAAAGTGG - Intronic
1103331366 12:120156526-120156548 CTGTGCCTTTGCAGAGCAGGAGG - Exonic
1107023677 13:35777830-35777852 CTTTCTCTAAGCAGAGTGGGCGG - Intronic
1112313991 13:98344730-98344752 CTGGCTCTGAGCAGAGCAGGTGG + Intronic
1112727311 13:102319352-102319374 CTGTATCTAAGCAGAGCAGGGGG - Intronic
1117238025 14:53798808-53798830 CTGTCCCTTAGCAGAGCAAGTGG - Intergenic
1120760075 14:88276825-88276847 CTGTAGCTGAGCAGAGAAAGAGG - Intronic
1123972829 15:25525049-25525071 CTGTATCTCAGCAGGGGTGGTGG + Intergenic
1127216231 15:56825415-56825437 CTGAACCTAAACAGAGAAGGTGG - Intronic
1127238757 15:57087123-57087145 TTGTATCCAAGGTGAGCAGGGGG - Intronic
1130539231 15:84810066-84810088 CTGGATGGAATCAGAGCAGGTGG + Intergenic
1130964104 15:88684520-88684542 CTGAATCTAAGCAGTGGAAGAGG - Intergenic
1132216378 15:100064669-100064691 ATGTTTTTAAGCAGAGTAGGGGG + Intronic
1136080653 16:27850534-27850556 CTGATATTAAGCAGAGCAGGAGG + Intronic
1136360823 16:29778618-29778640 CAGTATCCAAGCAGTGCTGGTGG - Intronic
1136732015 16:32423391-32423413 CTCTGTCTAAGCAGGGCACGAGG + Intergenic
1139732252 16:68956521-68956543 TTGGCACTAAGCAGAGCAGGAGG + Intronic
1139982502 16:70871335-70871357 CTGTGTGTCAACAGAGCAGGAGG + Intronic
1140480334 16:75259009-75259031 AGGTTTCTAAGGAGAGCAGGAGG - Intronic
1141113635 16:81290231-81290253 ATGTATCTAACCAAAACAGGAGG - Intronic
1141825165 16:86473584-86473606 CTGAACCTAAGGAGAGGAGGGGG - Intergenic
1202994378 16_KI270728v1_random:93863-93885 CTCTGTCTAAGCAGGGCACGAGG - Intergenic
1203021065 16_KI270728v1_random:406205-406227 CTCTGTCTAAGCAGGGCACGAGG - Intergenic
1203039400 16_KI270728v1_random:679363-679385 CTCTGTCTAAGCAGGGCACGAGG - Intergenic
1142687721 17:1587368-1587390 CTCTCTCTGAGCACAGCAGGAGG - Intronic
1142879199 17:2871312-2871334 ATGTATCTAACCAGAGCTGTTGG - Intronic
1143732505 17:8889007-8889029 CAGGCTCTAAGCAGAGCAAGGGG - Intronic
1144328048 17:14200490-14200512 CTGTATGTAAGAACAGCTGGAGG - Intronic
1145060116 17:19727913-19727935 CAGCCTCTTAGCAGAGCAGGAGG - Intergenic
1145101503 17:20081274-20081296 CTGTATCTAGGCACTGCAGTAGG - Intronic
1145784977 17:27587829-27587851 CCTTATCTCAGCAGAGAAGGAGG + Intronic
1146069360 17:29665976-29665998 ATATATCTGAGCAGAGCTGGTGG - Intronic
1146301952 17:31696383-31696405 CTGTTTCTAATCAGTGCAGCAGG - Intergenic
1150739441 17:67767574-67767596 CTGTATCTTAGCAGAGTAGGTGG + Intergenic
1153906341 18:9665078-9665100 CAGGATCTCAGCAGAGCTGGAGG + Intergenic
1155415482 18:25594503-25594525 CTGTAACTAAGCAGGTCTGGTGG + Intergenic
1155532255 18:26778933-26778955 CTGTTTCTTAGCTGAGGAGGTGG + Intergenic
1155688173 18:28581299-28581321 CCCTATTTAAGCAGAGAAGGAGG + Intergenic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1159372065 18:67540925-67540947 TTTTATCTAAGGAGAGCAGCTGG - Intergenic
1161400132 19:4063669-4063691 CTGTCTTTAAGCAGGGCCGGAGG - Intronic
1165950279 19:39470397-39470419 CTGTCTCTGAGCAGAGCTGCAGG - Exonic
1166617402 19:44262513-44262535 CTGTTACTGAGCAGAGCAGGAGG + Intronic
1167031967 19:46968363-46968385 CTGTGGGTCAGCAGAGCAGGAGG + Intronic
929262690 2:39883338-39883360 CTGGATCTCAGCCGAGCAGAGGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933391328 2:81671919-81671941 TTATATGTAAGCAGAGTAGGTGG - Intergenic
933978319 2:87529594-87529616 CCCTATCCAAGCAGGGCAGGAGG - Intergenic
934761452 2:96859146-96859168 CTCTTTCTAAGCCGATCAGGCGG - Intergenic
936315513 2:111421207-111421229 CCCTATCCAAGCAGGGCAGGAGG + Intergenic
946255465 2:218438606-218438628 CTGGATCTCAGCAGAGGAGATGG - Intronic
1169046334 20:2537040-2537062 CTGTCTCTGTGCAGGGCAGGGGG + Intronic
1169814952 20:9646759-9646781 CTGTTTCTAAGGACAGCAAGAGG - Intronic
1171302240 20:24073664-24073686 CTGTATCAAAGCACATCAGGAGG + Intergenic
1172584788 20:36075404-36075426 ATGTAGCTAAGCATAGAAGGTGG - Intergenic
1172646238 20:36471835-36471857 CCGTATCTCAGCACAGCAAGAGG - Intronic
1173960369 20:47066715-47066737 CTGTTTCTAAGCTGAGCACATGG - Intronic
1175738969 20:61407054-61407076 CTGTATCCAGGCAGAGCAGATGG - Intronic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1180540456 22:16441748-16441770 CTCTGTCTAAGCAGGGCATGAGG - Intergenic
1180958334 22:19751008-19751030 CTGTATCTATGCAGGGCTGGGGG - Intergenic
1182741456 22:32570998-32571020 ATATATTTAAGCAGAGCAAGAGG + Intronic
1184686643 22:46099308-46099330 CTGCATGTGAGCAGAGCAGCCGG + Intronic
949534805 3:4987250-4987272 CTGGATTTAGGCAGAGCACGGGG + Intergenic
950876450 3:16279166-16279188 CAGTGACAAAGCAGAGCAGGTGG + Intronic
951832223 3:26943233-26943255 CTGTCCCTTAGCAGAGCTGGTGG - Intergenic
952880965 3:37986200-37986222 CTGTAGCCAGTCAGAGCAGGGGG - Intergenic
953559893 3:43979440-43979462 CTGTCCGTAATCAGAGCAGGTGG - Intergenic
955602045 3:60656118-60656140 CTGCATCTTAGCAGAGCTGCTGG + Intronic
955799832 3:62674591-62674613 CTGTGCCTAAGAAGAGGAGGTGG + Intronic
955942411 3:64158897-64158919 CTGGATCAAAGAAGAGGAGGTGG - Intronic
956657515 3:71566793-71566815 CTGAAGATGAGCAGAGCAGGTGG - Intronic
960473180 3:118093142-118093164 TTGAAGCTATGCAGAGCAGGGGG - Intergenic
962335806 3:134528908-134528930 CTTTATCAAAGCAAAGTAGGTGG + Intronic
962605048 3:137026038-137026060 CTGTCTGAAAGCAGAGCAAGTGG - Intergenic
963515382 3:146301732-146301754 CTGAATCTAACCAGAGCCTGGGG + Intergenic
970123637 4:12784888-12784910 TGCTATGTAAGCAGAGCAGGAGG - Intergenic
975724844 4:77281883-77281905 CTGTAACTATGGAGACCAGGTGG + Intronic
976184421 4:82430270-82430292 CTGTATCTATGCAAAGGCGGAGG + Intergenic
977663854 4:99622293-99622315 CTGGATTTAAGCAGAGAATGCGG - Intronic
978541509 4:109821078-109821100 CTGAATCTCAACATAGCAGGGGG - Intronic
979551114 4:121991940-121991962 GAATATCTAAGGAGAGCAGGTGG - Intergenic
982391265 4:154866305-154866327 CTGTATCAAAAAAGAGGAGGAGG + Intergenic
988035666 5:25824066-25824088 CTGTCTCTAAGGAGACCTGGAGG - Intergenic
989396753 5:40965215-40965237 CTCTATCCAAACAGAACAGGAGG - Intronic
993182848 5:84576946-84576968 GTGTATCTGAGCACAGCAGGAGG + Intergenic
996546788 5:124687843-124687865 CTGTATATAACTACAGCAGGAGG - Intronic
1000811372 5:165865890-165865912 TTGTATGTAGGCAGAGGAGGGGG - Intergenic
1001141863 5:169151212-169151234 CTCTCTCTCAGCACAGCAGGTGG + Intronic
1002021786 5:176368268-176368290 CTGTGTATAGGCAGGGCAGGGGG + Intronic
1004331802 6:14728693-14728715 CTGTATGTGGGCAGAGAAGGAGG + Intergenic
1006338843 6:33434801-33434823 ATGTGTCTAAGAAGAGTAGGGGG + Intronic
1006884736 6:37371686-37371708 CAGTCTGTAAACAGAGCAGGTGG + Intronic
1007005473 6:38358409-38358431 CTGCATCTAAGCAGAGCTACGGG + Intronic
1007065777 6:38989099-38989121 CTGGATCTAAAAAGAGCTGGAGG + Intronic
1012184682 6:96197974-96197996 GTGTAACTAAGGAGAACAGGAGG - Intronic
1013429664 6:110044191-110044213 CTGTATCTCAGCAAAGTAGGTGG + Intergenic
1018169198 6:161130861-161130883 CTGTATCTTTGCAGATCATGAGG - Exonic
1021142471 7:17044602-17044624 TTTTATCTAAGGACAGCAGGGGG - Intergenic
1021242210 7:18217420-18217442 CTATATCTAAGGAAAGCAAGAGG - Intronic
1021294354 7:18886248-18886270 CAGTAACTAAACAGTGCAGGTGG - Intronic
1024538370 7:50457396-50457418 CTGTACAGAAGCAGGGCAGGAGG - Intronic
1024862431 7:53861387-53861409 TTTTATCTTAGCAGAGCAGAAGG + Intergenic
1027642891 7:80758818-80758840 CTGTATCTTAGCAAAGCACAAGG + Intronic
1031885168 7:127238815-127238837 CTGTATTCCAGCAGAGGAGGTGG + Intronic
1033601533 7:142892313-142892335 CTGCAGCTGGGCAGAGCAGGTGG - Intergenic
1034329243 7:150268790-150268812 CAGTATCTGGGCAGAGCTGGCGG - Intronic
1034668811 7:152841070-152841092 CAGTATCTGGGCAGAGCTGGCGG + Intronic
1035642461 8:1194401-1194423 CCGTGTCTAGGCAGAGCTGGAGG + Intergenic
1035757728 8:2046596-2046618 CTGTTTTACAGCAGAGCAGGTGG + Intronic
1039019755 8:33191964-33191986 CTGTATATAAGCACAGCATATGG - Intergenic
1041100591 8:54392740-54392762 CTTTGTCTATGCAGAGAAGGAGG + Intergenic
1043728950 8:83650524-83650546 GTTTATCTGGGCAGAGCAGGAGG + Intergenic
1044275578 8:90295945-90295967 CTGTATTTAGGCAGAGGGGGTGG + Intergenic
1045854540 8:106748908-106748930 GTGTTTCTAAGTAGAGAAGGTGG - Intronic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1048438087 8:134436268-134436290 CTGTATCATAGCACAGCAGAAGG + Intergenic
1049192128 8:141294369-141294391 CTGCCTAGAAGCAGAGCAGGAGG + Intronic
1049481066 8:142823130-142823152 ATTTATCTAAGCATGGCAGGAGG + Intergenic
1050179862 9:2909857-2909879 CTGTATAGAGACAGAGCAGGTGG + Intergenic
1055605603 9:77967343-77967365 CTGATTCTAGGCACAGCAGGTGG - Intronic
1057693270 9:97306078-97306100 CCGTATCTAAACACAGGAGGTGG + Intergenic
1057958792 9:99434750-99434772 CTGAATTAAAGCAGTGCAGGTGG + Intergenic
1060299695 9:122368069-122368091 CTGTAGCTAGGGTGAGCAGGAGG + Intergenic
1060517032 9:124272307-124272329 CTGTATCTCAGCAGAGCGCCTGG - Intronic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1185745256 X:2567378-2567400 CCGTCTCTAAAGAGAGCAGGAGG - Intergenic
1194647015 X:96470122-96470144 CTGTATATCAGCAAAGTAGGTGG + Intergenic
1198105201 X:133455192-133455214 CAGTATCCTAGCAGAGCTGGTGG + Intergenic
1198155684 X:133958235-133958257 CTATATCTAAGAAGAGCAAGTGG + Intronic
1201181622 Y:11353341-11353363 CTCTGTCTAAGCAGTGCACGAGG - Intergenic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic