ID: 1112727613

View in Genome Browser
Species Human (GRCh38)
Location 13:102322416-102322438
Sequence TAGGATCCCCAAAAGCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112727613_1112727620 15 Left 1112727613 13:102322416-102322438 CCCTGAGGCTTTTGGGGATCCTA 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1112727620 13:102322454-102322476 TAATGGCTGGTGGTGAGTCATGG 0: 1
1: 0
2: 0
3: 16
4: 155
1112727613_1112727618 5 Left 1112727613 13:102322416-102322438 CCCTGAGGCTTTTGGGGATCCTA 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1112727618 13:102322444-102322466 GCCATGATTTTAATGGCTGGTGG 0: 1
1: 0
2: 1
3: 9
4: 113
1112727613_1112727621 16 Left 1112727613 13:102322416-102322438 CCCTGAGGCTTTTGGGGATCCTA 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1112727621 13:102322455-102322477 AATGGCTGGTGGTGAGTCATGGG 0: 1
1: 0
2: 2
3: 14
4: 179
1112727613_1112727617 2 Left 1112727613 13:102322416-102322438 CCCTGAGGCTTTTGGGGATCCTA 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1112727617 13:102322441-102322463 ACTGCCATGATTTTAATGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 125
1112727613_1112727616 -2 Left 1112727613 13:102322416-102322438 CCCTGAGGCTTTTGGGGATCCTA 0: 1
1: 0
2: 1
3: 13
4: 103
Right 1112727616 13:102322437-102322459 TATAACTGCCATGATTTTAATGG 0: 1
1: 0
2: 4
3: 33
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112727613 Original CRISPR TAGGATCCCCAAAAGCCTCA GGG (reversed) Intronic
902916572 1:19643663-19643685 AAGCATCCCGAAAAGCCCCAGGG - Intronic
903833208 1:26187117-26187139 TTGGAACCCCAATACCCTCAAGG - Intronic
905230985 1:36514872-36514894 CAGGATGCCCTAAACCCTCAGGG + Intergenic
905251915 1:36654742-36654764 CAGGAACCCCCAAAGCTTCAAGG - Intergenic
905832975 1:41089127-41089149 TAGGATCTCCTCTAGCCTCATGG + Intronic
905902265 1:41589423-41589445 TTGGAGCCACAAAAGCCTCAGGG + Intronic
906514804 1:46432593-46432615 TGGGGTCCCCATGAGCCTCAAGG + Intergenic
906746468 1:48225385-48225407 TAAAATCCCCAAAAACCTCAGGG + Intronic
912602712 1:110954091-110954113 TAGGATTCTCAAAAGCATAAAGG + Intronic
914216123 1:145630672-145630694 TAAGATCCCTAAAAACATCAAGG - Exonic
914468693 1:147953330-147953352 TAAGATCCCTAAAAACATCAAGG - Exonic
918252185 1:182712856-182712878 TAAGATCCTCAAAGGACTCATGG + Intergenic
920030263 1:203033415-203033437 TAGGCTCCCAAAGCGCCTCAAGG - Intronic
1064277144 10:13916394-13916416 TGGGATCCCCAAAATCCAGAAGG - Intronic
1067686656 10:48469847-48469869 CAGGATGCCAGAAAGCCTCAGGG - Intronic
1072531991 10:96328261-96328283 TAGGATGGCCAAAAGCCACCAGG - Intronic
1074271937 10:111962594-111962616 TAGGATCCGCAAATGTCTCAAGG - Intergenic
1076743081 10:132497678-132497700 TAGGCTGCCCAAGAGCCACAGGG - Intergenic
1078064005 11:8066117-8066139 TTGGAGCCCCCACAGCCTCAGGG - Intronic
1086894183 11:92293175-92293197 TAGGAAACCAAAAAGGCTCAGGG - Intergenic
1090617187 11:128525904-128525926 TTGGATGCCAAAAAGCCTTAGGG + Intronic
1091058659 11:132441839-132441861 TAGGATGAGCAGAAGCCTCAGGG + Intronic
1093416631 12:18927969-18927991 CAGGATCCCCTAAACCCTCTAGG + Intergenic
1094491764 12:30965164-30965186 ACTGATCCCCATAAGCCTCATGG - Intronic
1094809420 12:34123300-34123322 TAGGTGGCGCAAAAGCCTCAAGG + Intergenic
1096085238 12:48861309-48861331 TGGGGGCCCCAAAGGCCTCATGG - Intronic
1097122687 12:56747887-56747909 CAGAACCCCCAAAAGGCTCAGGG + Intronic
1098134747 12:67390288-67390310 AAGGCTCCCCAGAAGCCTCAGGG - Intergenic
1098441696 12:70525831-70525853 TGGGATCCCCAGAAGCCTGATGG - Intronic
1099608734 12:84838198-84838220 AAGGATCCCAGAAAGCCTCAGGG - Intergenic
1099746053 12:86706697-86706719 TAGAATCCCCAAATGGCACAAGG + Intronic
1104345520 12:127993301-127993323 TAGGATCCCCAAGATCCCTAAGG + Intergenic
1107824888 13:44319868-44319890 AAGGATGCCTAAATGCCTCAAGG + Intergenic
1108607303 13:52052481-52052503 TAGGTTACCCACCAGCCTCAGGG + Intronic
1110195828 13:72787525-72787547 CAGGGTCCCCAAAAGCCTGATGG + Intronic
1111911947 13:94322758-94322780 TAGGCTCCACAAAAGCAGCAGGG + Intronic
1111941617 13:94614382-94614404 CAGGATCCAGAAAAGTCTCATGG - Intronic
1112155230 13:96809863-96809885 TGTGAGCCCCATAAGCCTCAGGG - Intronic
1112565289 13:100547024-100547046 AAGGATTCCCAACAGCCTGAAGG - Intronic
1112727613 13:102322416-102322438 TAGGATCCCCAAAAGCCTCAGGG - Intronic
1114455994 14:22853796-22853818 TGTTATCTCCAAAAGCCTCAGGG - Intergenic
1117305325 14:54468379-54468401 AAGGATCCCAAAGAGCCTCGAGG + Intergenic
1118221217 14:63856061-63856083 TAGGATGCTCAAAGGCCTCCAGG + Intronic
1120765673 14:88324763-88324785 AGGGCTCCCCAGAAGCCTCAAGG - Intronic
1130675833 15:85951183-85951205 TGAGATCCGCAAATGCCTCAAGG - Intergenic
1130829150 15:87582107-87582129 TAGGAAATCCAAAGGCCTCAGGG + Intergenic
1142226931 16:88882063-88882085 GAGGATTCCTAAAACCCTCATGG - Intronic
1144043684 17:11435679-11435701 TCGGATGCCCCAAAGGCTCATGG + Intronic
1146523082 17:33541663-33541685 CTGGCTCCCCAGAAGCCTCATGG + Intronic
1151223885 17:72634276-72634298 AAGCATCCCCAAAAACCTCAAGG + Intergenic
1154974025 18:21439406-21439428 TAGGATTCCAAGAAACCTCACGG - Intronic
1157565516 18:48676666-48676688 GAGGGTCCCCAGAAGGCTCAGGG + Intronic
1157616520 18:48990717-48990739 CAAAAACCCCAAAAGCCTCAAGG - Intergenic
1161025246 19:2033791-2033813 TAGCTTCCCCCACAGCCTCAAGG - Intronic
1161896914 19:7089436-7089458 TAGGACACCCATAAGCCTGAAGG + Intergenic
1162057635 19:8074250-8074272 TGGGATCCCCAAGATCCCCAGGG + Intronic
1165326588 19:35117682-35117704 TAGGATCCCCAAAAGTGTTGGGG - Intronic
1167433280 19:49465192-49465214 TAGGGTCCCCCAGAGGCTCATGG + Intronic
1167433320 19:49465357-49465379 TAGGGTCCCCCAGAGGCTCATGG + Intronic
1167433382 19:49465591-49465613 TAGGGTCCCCCAGAGGCTCATGG + Intronic
925406537 2:3609041-3609063 CAGGCACCCCAAATGCCTCACGG - Intronic
936866938 2:117085551-117085573 TAGGATCCCCATAATCCCCATGG - Intergenic
939091542 2:137786084-137786106 CTGGATCCCTCAAAGCCTCAGGG + Intergenic
941656112 2:168146514-168146536 TAGGAGCCCCCATAGCTTCAGGG + Intronic
1171181814 20:23096492-23096514 TCGGGTCCCCAAAAGCCTCCTGG + Intergenic
1171989664 20:31686080-31686102 TAGGAGCCCAAATAGCCTCTGGG + Intronic
1172041129 20:32046789-32046811 TACAATACACAAAAGCCTCAAGG - Intergenic
1175351841 20:58327827-58327849 TACAATCTCCAAAAGTCTCAAGG + Intronic
1182203360 22:28597006-28597028 TAGGTACCACAGAAGCCTCAAGG + Intronic
1183190678 22:36320236-36320258 TGGGATGCCCATAATCCTCATGG + Exonic
949828479 3:8187683-8187705 CAGCATACCCCAAAGCCTCAGGG + Intergenic
949918890 3:8986019-8986041 CAGGTTCCCCAGAAGCCTCGCGG + Intronic
952390036 3:32872169-32872191 TAGGATCCATAAAAACCTCCTGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
959561928 3:107792005-107792027 TGGGCTACCCATAAGCCTCAGGG - Intronic
960503925 3:118470508-118470530 TTGGATCCCCAAAGGCTCCATGG + Intergenic
962759114 3:138492639-138492661 CAGGGACCCCAAAAGCCTCAGGG + Intergenic
962829442 3:139127222-139127244 AAGAAACCACAAAAGCCTCAGGG + Intronic
962933707 3:140060412-140060434 TACGATCCCCAAAATCCTCTTGG + Intronic
964116708 3:153143330-153143352 TAGGAGCCCCAACTGCTTCAGGG - Intergenic
966877949 3:184334231-184334253 TAGCATCCACAAAAGTGTCAAGG + Intronic
968316268 3:197728313-197728335 CAGCTTCCCCAAAAGCTTCAAGG + Intronic
968730130 4:2265603-2265625 CAGGATCCACAAACTCCTCATGG + Intergenic
971297398 4:25409136-25409158 GTGGATCCCCAAAAGCATCTTGG + Intronic
977201324 4:94120225-94120247 AAGGGGCCCCAAAAGGCTCAGGG + Intergenic
983495075 4:168434535-168434557 TTGGATCCCTAAATGCCACAGGG + Intronic
984947217 4:184979173-184979195 CAGGATTCCCAAAAGCCTCATGG + Intergenic
985185151 4:187306329-187306351 TTGGAAACCAAAAAGCCTCAGGG + Intergenic
986044692 5:4025573-4025595 TGGTATCCCCAAAAGCCATAAGG + Intergenic
986734364 5:10657189-10657211 TCGGATGCCCCAAAGGCTCACGG - Intergenic
987038267 5:14038882-14038904 TTGGATCACCAAAAGCCTGGAGG - Intergenic
994019030 5:95002439-95002461 TAGTATCCTGAAAAGCCACAGGG + Intronic
997831652 5:137155649-137155671 CAGGATCACAAAAAGCCTGATGG - Intronic
1001443845 5:171767474-171767496 TAGATTCCACAAAAGGCTCATGG - Intergenic
1003180268 6:3784957-3784979 TATAATCCCCATAATCCTCAAGG + Intergenic
1008211367 6:48729105-48729127 TTGGAGTCCCAAAAGCCTGAAGG - Intergenic
1011656572 6:89557335-89557357 GAAGATGCCCAAAAACCTCAAGG + Intronic
1012667477 6:101992390-101992412 TAAGATCACCATAAGCCTCTTGG + Intronic
1015593753 6:134846426-134846448 CAGCATGCACAAAAGCCTCATGG + Intergenic
1015682354 6:135822480-135822502 GAAGATGTCCAAAAGCCTCATGG - Intergenic
1017943285 6:159072481-159072503 TAGCAGCAACAAAAGCCTCAGGG + Intergenic
1018036647 6:159887825-159887847 TCGGATCCCCATCAGCCTCAGGG - Intergenic
1022303449 7:29123446-29123468 TAGGTTCCCAAGAAGCCCCAGGG + Intronic
1024344293 7:48297229-48297251 TAGGTTGGCCAAAAGCCTCGAGG + Exonic
1030148918 7:106383252-106383274 TTGGCTCCCCATAAGCCTTAAGG - Intergenic
1032855512 7:135830362-135830384 GAGGATGCACTAAAGCCTCAGGG + Intergenic
1034891618 7:154844596-154844618 TAGGACCACCACAGGCCTCAAGG - Intronic
1042043417 8:64620566-64620588 TGTCATCCCCAAAAGTCTCAAGG - Intronic
1046778872 8:118194043-118194065 TAGGAACAACAAAAGTCTCAAGG - Intronic
1047433120 8:124809776-124809798 TAGCACCCACAGAAGCCTCATGG + Intergenic
1056046019 9:82717043-82717065 TATCATCCCCAAAAGACTCCTGG + Intergenic
1058776735 9:108291564-108291586 TAGGATGCTCAAAACCATCATGG - Intergenic
1062112871 9:134791646-134791668 TAGGTTACCCAGAAGCCTCTGGG + Intronic
1189137994 X:38569602-38569624 AAACATCCCCAAAAGACTCAGGG - Intronic
1195816953 X:108898322-108898344 TATGTTCCACATAAGCCTCATGG + Intergenic
1198442794 X:136680621-136680643 TAGGCTGCCCAAAAGACTAAGGG + Intronic
1201755425 Y:17481590-17481612 TAGGTGGCGCAAAAGCCTCAAGG + Intergenic
1201846127 Y:18424395-18424417 TAGGTGGCGCAAAAGCCTCAAGG - Intergenic