ID: 1112733119

View in Genome Browser
Species Human (GRCh38)
Location 13:102388945-102388967
Sequence GGTACATGATTGGGAGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112733119 Original CRISPR GGTACATGATTGGGAGTTAT GGG (reversed) Intronic
911527810 1:99006173-99006195 GGCAAATGATTGGTAGTTTTGGG + Intergenic
912330467 1:108815727-108815749 GGTACATGATTTGGAATTTGTGG + Intergenic
918248262 1:182679653-182679675 TCTACATGATTGGGAGCTATTGG - Intronic
918605820 1:186424690-186424712 TGCACATGATTGGCAGTTAATGG + Intergenic
921562066 1:216670785-216670807 TGTACAAGATTGGGAGATAGAGG + Intronic
922704758 1:227784004-227784026 GGTACATAATAGGTATTTATGGG + Intergenic
1066279413 10:33900685-33900707 AGTACATGATTGTGAGAAATGGG - Intergenic
1067908530 10:50320162-50320184 GGGACATGTTTGGGAGGCATTGG - Intronic
1072205167 10:93197270-93197292 GGTAGATGAGAGGGAGTTAAAGG + Intergenic
1081899602 11:46616932-46616954 GGTTCACGATTTGGAGTTCTTGG - Intronic
1088973286 11:114792112-114792134 GGTACAGGATTGGGATATAATGG + Intergenic
1098316950 12:69202811-69202833 GGTCCATGGTTGGGATTCATGGG - Intergenic
1099958735 12:89376649-89376671 GTTAAATGGTTGGGATTTATTGG + Intergenic
1111698987 13:91662027-91662049 GATACACAATTGGGAGTCATTGG + Intronic
1112733119 13:102388945-102388967 GGTACATGATTGGGAGTTATGGG - Intronic
1117986095 14:61387483-61387505 GGTAAATGAGTGGAAATTATTGG + Intronic
1119409732 14:74423061-74423083 GGCACATGATTGGGTGATCTTGG - Intronic
1119801543 14:77449643-77449665 GGTACAGTCTGGGGAGTTATGGG - Intronic
1123123749 14:105930112-105930134 TGCACATGATTGGGTGTTAATGG + Intronic
1124342203 15:28896911-28896933 GGAACATGATTGAGAGTTTGGGG - Intronic
1127551300 15:60041226-60041248 GGTATCTGATTGGGGGTTGTGGG - Intronic
1133893147 16:9900629-9900651 TCTACTTTATTGGGAGTTATTGG + Intronic
1137523795 16:49216105-49216127 GGTAGATATTTGGGAGTCATAGG + Intergenic
1148028864 17:44606491-44606513 GGGACATGATTGGGGATTCTCGG + Intergenic
1153154646 18:2134651-2134673 GGTACATGCTTAGAAGTTTTAGG - Intergenic
1159668301 18:71191526-71191548 AGCACATGATATGGAGTTATTGG + Intergenic
926236786 2:11051707-11051729 GGAAGATGAGTGGGAGTTAACGG + Intergenic
932782604 2:74570730-74570752 GGTACATGAAGGGGAATAATGGG + Intronic
937387660 2:121451160-121451182 GGGGCAGGATTGGGAGTTAAAGG - Intronic
940082044 2:149813911-149813933 GGTACATGGATAGAAGTTATAGG + Intergenic
940466208 2:154030638-154030660 GGGACCTGGTTGGCAGTTATTGG + Intronic
945203847 2:207310944-207310966 GGTACAGGCTAGGGAGTTAAGGG + Intergenic
946560209 2:220904336-220904358 GGTCTATGATTTGGAGTGATGGG - Intergenic
946890825 2:224274406-224274428 GCTACATGATGGAGAGATATGGG + Intergenic
948305026 2:236940311-236940333 GGAATATTATTGGGAGTAATGGG - Intergenic
1176045602 20:63091106-63091128 GGGACACGGTGGGGAGTTATTGG + Intergenic
1177647414 21:23917481-23917503 GGTACAGGATACGGAGTCATGGG - Intergenic
1182552328 22:31107061-31107083 GGGACAGGATTGGGAGTCATAGG + Intronic
1183747189 22:39698650-39698672 GGGAGATGATGGGGAGTGATGGG - Intergenic
949777837 3:7652186-7652208 GGTACATGTTTGAGAGTGAAGGG + Intronic
952746010 3:36780257-36780279 TGTACTTGTTTGTGAGTTATGGG + Intergenic
953775191 3:45810773-45810795 GATACAACATTGGGAGTTATCGG - Intergenic
953891390 3:46754093-46754115 GGTACATGATTTTGGTTTATTGG - Intronic
953896872 3:46809761-46809783 GGTACATGATTTTGGTTTATTGG - Intronic
955160097 3:56457009-56457031 TGTACAAGATTGGGAGTTATGGG - Intronic
957191442 3:77015329-77015351 TGTACACGAATGGGATTTATGGG + Intronic
958713142 3:97742373-97742395 GGTACACTACTGGGAATTATGGG + Intronic
959768172 3:110058897-110058919 GGAACTTGATTGGGTGTTAAGGG + Intergenic
962105777 3:132387441-132387463 GGAACAAAATTGGGAGTTTTTGG + Intergenic
963237744 3:142972356-142972378 GGCACATGCTTGGGAGTAAGAGG - Intronic
963738832 3:149053866-149053888 GGTACTTGAATGGCAGTTTTGGG - Intronic
963997861 3:151731644-151731666 AGTACAGGATTGGTACTTATGGG - Intergenic
971212130 4:24629050-24629072 GATACATGTTTGGGAATTGTTGG - Intergenic
972578015 4:40369812-40369834 GGTACATGACTGGTAGTAATTGG + Intergenic
974707876 4:65545363-65545385 GATACCTCATTGGGAGTGATGGG - Intronic
980245570 4:130235666-130235688 TATATATGTTTGGGAGTTATTGG - Intergenic
981546509 4:145899410-145899432 GGTACATGATTTGGTGTTACTGG - Intronic
986998216 5:13631778-13631800 AGTACATGATGGGTAGTTTTTGG - Intergenic
987593967 5:19971522-19971544 GGTACATCAGTGGAGGTTATTGG + Intronic
988456897 5:31394730-31394752 GGTCCATGGTTGGGATTCATGGG + Intergenic
988699186 5:33656249-33656271 GGTAGATGTTTAGTAGTTATTGG - Intronic
993094792 5:83469504-83469526 GGAACATGATTGAAAGTGATGGG - Intergenic
993487726 5:88507022-88507044 GATACAGGATTGGGAGCTATTGG - Intergenic
995471955 5:112511866-112511888 GGTCCATGAATGGGAGTTGAGGG - Intergenic
1011070761 6:83380248-83380270 GGGACATGAGTGGGAGGAATAGG + Intronic
1019503656 7:1379294-1379316 GGTAGATGATTGATAGATATAGG + Intergenic
1020523231 7:9221899-9221921 GGTACAGAAATGGTAGTTATTGG - Intergenic
1021632698 7:22662453-22662475 GAACCATGATTGGGAGTAATGGG - Intergenic
1021679147 7:23112159-23112181 GGTACATGATTGGATGTTGAGGG + Intronic
1023163043 7:37316472-37316494 GCTGCATGATTGGCATTTATTGG - Intronic
1026261551 7:68759874-68759896 GGTACATGATTGTGCCTCATTGG - Intergenic
1028207047 7:88030562-88030584 GGTACATGGTGGGAGGTTATTGG + Intronic
1028666371 7:93348192-93348214 GGTACAGGAATGGGAGTCAGTGG - Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1031800626 7:126239927-126239949 GTTAGGTGATTGGGAGTTTTTGG - Intergenic
1037394660 8:18429247-18429269 GGGAGATGACTGGGAGTTACAGG + Intergenic
1037448697 8:18995190-18995212 AGTACATGCTTTGGAGCTATAGG - Intronic
1042161975 8:65905567-65905589 GGGACCTGATGGGAAGTTATTGG + Intergenic
1046345801 8:112925107-112925129 GGTTCATGTTAGGGAGATATGGG - Intronic
1047017467 8:120738609-120738631 GATGGATGATTGTGAGTTATAGG - Intronic
1048392698 8:133983210-133983232 GGTACATGCATGGAAGGTATGGG + Intergenic
1055545450 9:77367760-77367782 GGTACATGAATGGGATTCACAGG + Intronic
1058996273 9:110301630-110301652 AATACATGCTTAGGAGTTATTGG + Intergenic
1188098892 X:26057662-26057684 GGTTCATGATTAGAATTTATGGG + Intergenic
1195811704 X:108840429-108840451 GGTACATGACTGGCAGTCAGGGG + Intergenic
1196663744 X:118294895-118294917 GGTCCATGATTGGGATCCATGGG + Intergenic
1199091500 X:143698374-143698396 AGTAACTGATTGGGAGTTACTGG + Intergenic
1199850210 X:151720869-151720891 TGTACATGCTAGGGAGTTGTTGG + Intronic
1201622747 Y:15978832-15978854 GGAAGATGATTAGGAGTTAATGG - Intergenic