ID: 1112746776

View in Genome Browser
Species Human (GRCh38)
Location 13:102535753-102535775
Sequence GTTAGAACACGGACATCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112746771_1112746776 10 Left 1112746771 13:102535720-102535742 CCATGTAAGGGAACGTGTCCACA No data
Right 1112746776 13:102535753-102535775 GTTAGAACACGGACATCTTTTGG No data
1112746769_1112746776 18 Left 1112746769 13:102535712-102535734 CCCTTGTGCCATGTAAGGGAACG No data
Right 1112746776 13:102535753-102535775 GTTAGAACACGGACATCTTTTGG No data
1112746773_1112746776 -8 Left 1112746773 13:102535738-102535760 CCACACATTCCAGGAGTTAGAAC No data
Right 1112746776 13:102535753-102535775 GTTAGAACACGGACATCTTTTGG No data
1112746770_1112746776 17 Left 1112746770 13:102535713-102535735 CCTTGTGCCATGTAAGGGAACGT No data
Right 1112746776 13:102535753-102535775 GTTAGAACACGGACATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112746776 Original CRISPR GTTAGAACACGGACATCTTT TGG Intergenic
No off target data available for this crispr