ID: 1112747884

View in Genome Browser
Species Human (GRCh38)
Location 13:102548294-102548316
Sequence CTCTTGAAATGTCTGTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112747879_1112747884 15 Left 1112747879 13:102548256-102548278 CCACTGTTTCCACATCAATCATT No data
Right 1112747884 13:102548294-102548316 CTCTTGAAATGTCTGTTGTAGGG No data
1112747880_1112747884 6 Left 1112747880 13:102548265-102548287 CCACATCAATCATTCTGCTCCTT No data
Right 1112747884 13:102548294-102548316 CTCTTGAAATGTCTGTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112747884 Original CRISPR CTCTTGAAATGTCTGTTGTA GGG Intergenic
No off target data available for this crispr