ID: 1112749304

View in Genome Browser
Species Human (GRCh38)
Location 13:102566028-102566050
Sequence GGGATGGAGATAAGACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112749304_1112749307 -10 Left 1112749304 13:102566028-102566050 CCTTCCTGTCTTATCTCCATCCC No data
Right 1112749307 13:102566041-102566063 TCTCCATCCCATCTCTGCCAGGG No data
1112749304_1112749311 6 Left 1112749304 13:102566028-102566050 CCTTCCTGTCTTATCTCCATCCC No data
Right 1112749311 13:102566057-102566079 GCCAGGGCCTCCCATTTACTAGG No data
1112749304_1112749317 17 Left 1112749304 13:102566028-102566050 CCTTCCTGTCTTATCTCCATCCC No data
Right 1112749317 13:102566068-102566090 CCATTTACTAGGAGCTAGGATGG No data
1112749304_1112749318 21 Left 1112749304 13:102566028-102566050 CCTTCCTGTCTTATCTCCATCCC No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data
1112749304_1112749314 13 Left 1112749304 13:102566028-102566050 CCTTCCTGTCTTATCTCCATCCC No data
Right 1112749314 13:102566064-102566086 CCTCCCATTTACTAGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112749304 Original CRISPR GGGATGGAGATAAGACAGGA AGG (reversed) Intergenic
No off target data available for this crispr