ID: 1112749309

View in Genome Browser
Species Human (GRCh38)
Location 13:102566048-102566070
Sequence TGGGAGGCCCTGGCAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112749309_1112749314 -7 Left 1112749309 13:102566048-102566070 CCCATCTCTGCCAGGGCCTCCCA No data
Right 1112749314 13:102566064-102566086 CCTCCCATTTACTAGGAGCTAGG No data
1112749309_1112749317 -3 Left 1112749309 13:102566048-102566070 CCCATCTCTGCCAGGGCCTCCCA No data
Right 1112749317 13:102566068-102566090 CCATTTACTAGGAGCTAGGATGG No data
1112749309_1112749318 1 Left 1112749309 13:102566048-102566070 CCCATCTCTGCCAGGGCCTCCCA No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112749309 Original CRISPR TGGGAGGCCCTGGCAGAGAT GGG (reversed) Intergenic
No off target data available for this crispr