ID: 1112749310

View in Genome Browser
Species Human (GRCh38)
Location 13:102566049-102566071
Sequence ATGGGAGGCCCTGGCAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112749310_1112749317 -4 Left 1112749310 13:102566049-102566071 CCATCTCTGCCAGGGCCTCCCAT No data
Right 1112749317 13:102566068-102566090 CCATTTACTAGGAGCTAGGATGG No data
1112749310_1112749314 -8 Left 1112749310 13:102566049-102566071 CCATCTCTGCCAGGGCCTCCCAT No data
Right 1112749314 13:102566064-102566086 CCTCCCATTTACTAGGAGCTAGG No data
1112749310_1112749318 0 Left 1112749310 13:102566049-102566071 CCATCTCTGCCAGGGCCTCCCAT No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112749310 Original CRISPR ATGGGAGGCCCTGGCAGAGA TGG (reversed) Intergenic
No off target data available for this crispr