ID: 1112749312

View in Genome Browser
Species Human (GRCh38)
Location 13:102566058-102566080
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112749312_1112749318 -9 Left 1112749312 13:102566058-102566080 CCAGGGCCTCCCATTTACTAGGA No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112749312 Original CRISPR TCCTAGTAAATGGGAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr