ID: 1112749318

View in Genome Browser
Species Human (GRCh38)
Location 13:102566072-102566094
Sequence TTACTAGGAGCTAGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112749309_1112749318 1 Left 1112749309 13:102566048-102566070 CCCATCTCTGCCAGGGCCTCCCA No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data
1112749310_1112749318 0 Left 1112749310 13:102566049-102566071 CCATCTCTGCCAGGGCCTCCCAT No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data
1112749312_1112749318 -9 Left 1112749312 13:102566058-102566080 CCAGGGCCTCCCATTTACTAGGA No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data
1112749308_1112749318 5 Left 1112749308 13:102566044-102566066 CCATCCCATCTCTGCCAGGGCCT No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data
1112749304_1112749318 21 Left 1112749304 13:102566028-102566050 CCTTCCTGTCTTATCTCCATCCC No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data
1112749305_1112749318 17 Left 1112749305 13:102566032-102566054 CCTGTCTTATCTCCATCCCATCT No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data
1112749303_1112749318 26 Left 1112749303 13:102566023-102566045 CCTGGCCTTCCTGTCTTATCTCC No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data
1112749302_1112749318 27 Left 1112749302 13:102566022-102566044 CCCTGGCCTTCCTGTCTTATCTC No data
Right 1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112749318 Original CRISPR TTACTAGGAGCTAGGATGGA AGG Intergenic
No off target data available for this crispr