ID: 1112751485

View in Genome Browser
Species Human (GRCh38)
Location 13:102588329-102588351
Sequence GGGTGGGTTAATGCAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112751478_1112751485 4 Left 1112751478 13:102588302-102588324 CCCACTTACAATTGCATGCAAAT No data
Right 1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG No data
1112751479_1112751485 3 Left 1112751479 13:102588303-102588325 CCACTTACAATTGCATGCAAATT No data
Right 1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112751485 Original CRISPR GGGTGGGTTAATGCAAACTG AGG Intergenic
No off target data available for this crispr