ID: 1112751895

View in Genome Browser
Species Human (GRCh38)
Location 13:102591920-102591942
Sequence GAGAGCAGGACTGAAAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112751895_1112751902 28 Left 1112751895 13:102591920-102591942 CCCACATTTTCAGTCCTGCTCTC No data
Right 1112751902 13:102591971-102591993 GGCTTCCATACAGCCAGGCACGG No data
1112751895_1112751900 7 Left 1112751895 13:102591920-102591942 CCCACATTTTCAGTCCTGCTCTC No data
Right 1112751900 13:102591950-102591972 GAAATCAGAACTACTTGATCAGG No data
1112751895_1112751901 23 Left 1112751895 13:102591920-102591942 CCCACATTTTCAGTCCTGCTCTC No data
Right 1112751901 13:102591966-102591988 GATCAGGCTTCCATACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112751895 Original CRISPR GAGAGCAGGACTGAAAATGT GGG (reversed) Intergenic
No off target data available for this crispr