ID: 1112757193

View in Genome Browser
Species Human (GRCh38)
Location 13:102649778-102649800
Sequence ATGTAAATACAAATCAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 487}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112757189_1112757193 23 Left 1112757189 13:102649732-102649754 CCTGTCTTACCTCCTACGGCTAA 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG 0: 1
1: 0
2: 2
3: 44
4: 487
1112757191_1112757193 11 Left 1112757191 13:102649744-102649766 CCTACGGCTAATACACTTGAACT 0: 1
1: 0
2: 1
3: 1
4: 37
Right 1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG 0: 1
1: 0
2: 2
3: 44
4: 487
1112757190_1112757193 14 Left 1112757190 13:102649741-102649763 CCTCCTACGGCTAATACACTTGA 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG 0: 1
1: 0
2: 2
3: 44
4: 487
1112757187_1112757193 29 Left 1112757187 13:102649726-102649748 CCTGAACCTGTCTTACCTCCTAC 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG 0: 1
1: 0
2: 2
3: 44
4: 487
1112757186_1112757193 30 Left 1112757186 13:102649725-102649747 CCCTGAACCTGTCTTACCTCCTA 0: 1
1: 0
2: 3
3: 20
4: 201
Right 1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG 0: 1
1: 0
2: 2
3: 44
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112757193 Original CRISPR ATGTAAATACAAATCAAACT TGG Intronic
900434032 1:2618773-2618795 ATGTAAATACATATTCAAATTGG - Intronic
900859132 1:5213341-5213363 ATGTCAATACCAAACTAACTTGG - Intergenic
903083628 1:20834555-20834577 ATGAAAATAGAAATCAAAAGAGG + Intronic
903858864 1:26353435-26353457 ATTTCAACACAAATAAAACTAGG + Intronic
907049608 1:51321283-51321305 CTGTAAATACAAATCAATAATGG - Intronic
907766633 1:57419162-57419184 TTGAAAATATAAATAAAACTTGG - Intronic
908201357 1:61799022-61799044 ATTTAAATACAAATCACTATCGG - Intronic
908204901 1:61836637-61836659 AGGTAAACACAACTCAAATTTGG + Intronic
908467359 1:64410671-64410693 ATGTTAATACAAGAAAAACTAGG - Intergenic
908568505 1:65383939-65383961 AAATATATACAAATCAAATTGGG + Intronic
909349982 1:74640302-74640324 ATATATATTCAAATCAAACCTGG + Intronic
909677147 1:78251406-78251428 ATGTAAATCCCAATCAAATGAGG + Intergenic
909839425 1:80300413-80300435 ATGGAAATTCAAAACAAAGTGGG - Intergenic
910146753 1:84088797-84088819 ATGCAAATAAAAATAAGACTTGG + Intronic
910636261 1:89411796-89411818 TAGAAAATACAAATCAAAATAGG + Intergenic
910855085 1:91686915-91686937 TTGTAAATAAATATCAGACTTGG + Intronic
911386638 1:97183674-97183696 ATGTATATACAGATCAATCCAGG + Intronic
911590243 1:99739038-99739060 ATGTAAAGACAGATCATACTAGG + Intronic
911890793 1:103369104-103369126 ATGAAAAGACAAATAAAACATGG - Intergenic
911923500 1:103796743-103796765 AGGTAAATCTAAATAAAACTGGG - Intergenic
912157581 1:106941065-106941087 ATGTAAAAATAAATCAAACTTGG + Intergenic
912669516 1:111611876-111611898 ATCTAAATTCAAATTCAACTGGG + Intronic
912750574 1:112283828-112283850 CTTTAAATAGGAATCAAACTTGG - Intergenic
912854813 1:113158048-113158070 ATTGAAATAAAAATCAAAGTCGG - Intergenic
914891587 1:151628917-151628939 ATGAAAAAACAAAACAGACTAGG - Intronic
916310232 1:163390202-163390224 ACTTTAATGCAAATCAAACTTGG - Intergenic
916458467 1:164995793-164995815 ACGTAGATACAAATCGAACAAGG + Intergenic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
916907485 1:169303385-169303407 ATGTAAATAAAAATTAATGTAGG + Intronic
917103979 1:171473756-171473778 ATGTAAATACAGATCACACATGG + Intergenic
917278895 1:173360490-173360512 TGGTAAATACAAATCAAGCATGG - Intergenic
918932061 1:190866697-190866719 ATATAAATACAGATCTAATTTGG - Intergenic
918998738 1:191800004-191800026 AGGTAAATAAACATCAGACTGGG + Intergenic
919376872 1:196806116-196806138 TTAAAAAGACAAATCAAACTGGG + Intergenic
919386575 1:196930998-196931020 TTAAAAAGACAAATCAAACTGGG + Intronic
919406673 1:197193539-197193561 CTGTTATAACAAATCAAACTAGG + Intronic
919524821 1:198634288-198634310 CTGTCCATACAAATCAAGCTGGG - Intergenic
919565831 1:199186055-199186077 ATGAATATACTAATAAAACTCGG - Intergenic
919613048 1:199770473-199770495 ATGTAAAGCCAATTAAAACTGGG - Intergenic
920723128 1:208407776-208407798 ATGAAAGGACAAATCAGACTGGG + Intergenic
921239441 1:213163246-213163268 AAGAACATCCAAATCAAACTCGG - Intronic
921253267 1:213317133-213317155 ATTAAAATACAAATATAACTTGG + Intergenic
921628925 1:217410335-217410357 ATGAAAATGCAAATCAAAACAGG - Intergenic
923820773 1:237438108-237438130 ATTTAAATACAAAATTAACTGGG - Intronic
923830344 1:237549020-237549042 ATGTATATACATAACAACCTTGG + Intronic
924275106 1:242378102-242378124 ATGTAGAAACAACTCAAATTAGG + Intronic
1062892290 10:1072813-1072835 AAGTAATAACAAATCAAAGTGGG + Intronic
1063618149 10:7620227-7620249 CTATAAACACAAGTCAAACTTGG + Intronic
1064448185 10:15415746-15415768 ATGTATATGAAAATCAAATTTGG - Intergenic
1064741375 10:18438329-18438351 TTGGAAATAAAAATCCAACTGGG - Intronic
1065461460 10:25969709-25969731 ATGTAATTATAAATATAACTGGG - Intronic
1065494044 10:26311157-26311179 AAGCAAATACAAATCTGACTTGG + Intergenic
1068108008 10:52643926-52643948 ATGTCAAAACAAATCAGGCTAGG + Intergenic
1068356398 10:55915261-55915283 ATGTAAATTTCCATCAAACTAGG - Intergenic
1068583373 10:58767693-58767715 GTGTAAATCTAAATAAAACTCGG + Intronic
1068860455 10:61842560-61842582 ATCCAAACACAAATCAGACTCGG - Intergenic
1069236313 10:66079456-66079478 AAGAAAATACATATAAAACTAGG - Intronic
1069848317 10:71388523-71388545 GGGTAAATACAAATGAATCTTGG - Intergenic
1070109571 10:73471426-73471448 CTATAAATAGAAATCAATCTCGG + Intronic
1070180213 10:74006184-74006206 ATACAAATACAAATAAAAATAGG - Intronic
1070199847 10:74193417-74193439 ATGAAAACACTAATCACACTGGG - Intronic
1070316254 10:75315903-75315925 ATGTAAATAGAAACCAAAAGAGG + Intergenic
1071680602 10:87701847-87701869 AAATAAGTACAAATCAACCTGGG + Intronic
1072319470 10:94234543-94234565 ATGTAAGTACAAGTCAAAAAGGG + Intronic
1072712679 10:97727418-97727440 AAATAAATAAAAATAAAACTGGG - Intergenic
1073508702 10:104027348-104027370 ATTTATATAAAAAACAAACTTGG - Exonic
1073580560 10:104661874-104661896 ATGGAAATCCAAATCAATATTGG + Intronic
1073881323 10:107983733-107983755 ATGGAAATAAAGATCCAACTGGG + Intergenic
1073947688 10:108769872-108769894 TTGTTAATACAAATCAAAATGGG - Intergenic
1074627631 10:115210325-115210347 AAACAAATACAAATAAAACTGGG - Intronic
1075953306 10:126500636-126500658 ATGTAAAGACAAAACATACAGGG + Intronic
1077788736 11:5414336-5414358 ATGTAAAGACCATTCAGACTAGG + Intronic
1077794742 11:5479415-5479437 ATGTAAAGACCATTCAGACTAGG + Intronic
1078024643 11:7683215-7683237 ATGAATAGGCAAATCAAACTTGG + Intergenic
1078499504 11:11856339-11856361 ATTTGCATACAAATCAAAGTGGG + Intronic
1078566304 11:12417690-12417712 CTGTAAATACAAACTTAACTTGG - Intronic
1078606384 11:12779878-12779900 ATGTAAATAATCAGCAAACTAGG + Intronic
1079824707 11:25176122-25176144 ATAGAGATACAAATAAAACTGGG - Intergenic
1080096264 11:28411286-28411308 AAATAAATACAAATAAAAGTTGG + Intergenic
1080731277 11:34957052-34957074 ATGTCAATACAAATCCAAACAGG - Intronic
1080856804 11:36118874-36118896 ATAGAAACAGAAATCAAACTGGG - Intronic
1081283451 11:41239612-41239634 ATGTAAATACAATTTTAAATAGG - Intronic
1082201667 11:49378624-49378646 AATCAAATGCAAATCAAACTTGG + Intergenic
1082631062 11:55542784-55542806 ATTTAAATGCATAGCAAACTAGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085231538 11:74975559-74975581 ATGTAACTGCCAATAAAACTGGG + Intronic
1085636949 11:78166339-78166361 ATGTAAATAGAAATGAACCCTGG + Intergenic
1086654002 11:89327601-89327623 AATCAAATACAAATCAAACTTGG - Intronic
1086859172 11:91904697-91904719 ATGGAAATACATATGAAACAAGG - Intergenic
1087289106 11:96300205-96300227 ATGTGAATGCTAATGAAACTGGG + Intronic
1087445893 11:98253063-98253085 ATCTAAATAGGAATGAAACTGGG + Intergenic
1088030529 11:105243138-105243160 ATATAAATATAGATCAAACTTGG + Intergenic
1088421379 11:109651569-109651591 ATGTAAACACAAGTCAATCTTGG + Intergenic
1089557704 11:119323743-119323765 ATGAGAAAACAATTCAAACTAGG - Intergenic
1089716601 11:120366277-120366299 ATCTAAATTTAAATCAAATTTGG - Intronic
1089885511 11:121818856-121818878 CTGTAAATACACAAAAAACTAGG - Intergenic
1091158150 11:133393265-133393287 ATGGAAATACACATAAAACAAGG + Intronic
1091177062 11:133569647-133569669 AATTAAGTACAAATAAAACTGGG - Intergenic
1091735713 12:2919896-2919918 ATATAATTAGAAATCAAATTTGG - Intronic
1092624447 12:10311807-10311829 ATGGGAATACAAATCAAGATAGG + Intergenic
1092699933 12:11217188-11217210 ATGTATACATAAATCAAAATAGG + Intergenic
1092938269 12:13384343-13384365 AAGTGAATACAAATAAAACTAGG - Intronic
1093163971 12:15784198-15784220 ATAAAAAGACAAACCAAACTGGG + Intronic
1093280111 12:17183949-17183971 ATCTCAGTACAAATGAAACTGGG - Intergenic
1093417639 12:18938356-18938378 ATTCAAATACAAATCTAACACGG - Intergenic
1093636486 12:21476885-21476907 ATGTAAAAACAAACCAACTTTGG - Intronic
1095120242 12:38408578-38408600 ATGTAAATACTAATTATCCTTGG - Intergenic
1095501472 12:42844312-42844334 ATGCAAATGGAAACCAAACTGGG - Intergenic
1095725789 12:45451429-45451451 ATGTAAATACTCAACAAACTAGG + Intergenic
1097626050 12:62001913-62001935 GTTTTAATACAAATAAAACTTGG + Intronic
1097701877 12:62828537-62828559 ATGGAGATACAAAACAAAGTGGG - Intronic
1098868816 12:75792909-75792931 ATGAAAATACTAAACACACTAGG + Intergenic
1099197652 12:79637921-79637943 ATGTAAGTACACTTCAAAATGGG - Intronic
1099398515 12:82172014-82172036 ATATAAATACATAGCAAATTAGG + Intergenic
1099617119 12:84950232-84950254 AGAGAAATACAAATCAAAATTGG + Intergenic
1101358123 12:103999948-103999970 AGGTAAATTCAAATCAGCCTTGG - Intronic
1101696139 12:107129032-107129054 ATGTAGATGCAAATAAAATTGGG - Intergenic
1103401138 12:120643533-120643555 AGTTAAAAACAAATGAAACTTGG - Intronic
1103486699 12:121287993-121288015 ATATAAATAAAAATAAAACCAGG + Intronic
1104117402 12:125762889-125762911 GTATGAATACAAATAAAACTGGG + Intergenic
1105221477 13:18332937-18332959 ATTTAATAACAAAACAAACTCGG + Intergenic
1105697368 13:22901838-22901860 ATGTAAATATAACCCAAAGTAGG - Intergenic
1105816554 13:24041443-24041465 ATGTAAATAGAAATCTCACAGGG + Intronic
1106386264 13:29288978-29289000 ATGCAAAAACAAATCTAGCTGGG + Intronic
1107730687 13:43345442-43345464 ATGCACATACATCTCAAACTGGG - Intronic
1109382534 13:61583399-61583421 AGGTAAAAAAAAATCAAAATAGG + Intergenic
1110091954 13:71462213-71462235 ATGAAAATACAAATCATATTAGG + Intronic
1110361832 13:74634611-74634633 ATGTAAATAAAAATAAAAATTGG - Intergenic
1111147055 13:84196163-84196185 ATGAAAATACAAAACAGATTTGG - Intergenic
1111779586 13:92705279-92705301 TTGTCAATAGAAATCAAAGTTGG - Intronic
1111891895 13:94092846-94092868 AGGGAAATACAAATCAAAATAGG - Intronic
1112186770 13:97135291-97135313 ATTTAAATACAAGTCCATCTAGG - Intergenic
1112397887 13:99050142-99050164 AAGTAAAAACAAATCAAAAATGG + Intronic
1112757193 13:102649778-102649800 ATGTAAATACAAATCAAACTTGG + Intronic
1115374622 14:32660763-32660785 ATGGAAATGCTAATTAAACTGGG + Intronic
1116633935 14:47369096-47369118 ATGTAAATAGATATCTATCTAGG - Intronic
1116783234 14:49259760-49259782 ATGTAAATAAAAAACCAACATGG + Intergenic
1120046511 14:79813539-79813561 ATAGATATACAAATCAAACAAGG + Intronic
1120347126 14:83305175-83305197 TTGTAAATAGAGAACAAACTTGG - Intergenic
1120557048 14:85940341-85940363 ATGAAAACACACATCAAAGTAGG - Intergenic
1121197958 14:92091608-92091630 ATGTAAATACAAGCCAAAAAAGG - Intronic
1121366670 14:93318640-93318662 ATAAAAACACAAATCAGACTGGG + Intronic
1122063643 14:99156816-99156838 ATTAAAATATGAATCAAACTTGG + Intergenic
1123631133 15:22260096-22260118 ATCTAAATACACATCACACCAGG - Intergenic
1123701558 15:22918040-22918062 ATGAAAATACAAATTACTCTGGG + Intronic
1125060478 15:35415613-35415635 ATGTAAATATAAAACACACTGGG + Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125243939 15:37612076-37612098 ATGTATATACAAATTTAACATGG + Intergenic
1125639672 15:41219979-41220001 TTTTAAATACAACTCAGACTTGG - Intronic
1126157477 15:45578684-45578706 ATGTAAATACAAGTGAAAAGTGG + Intergenic
1126726909 15:51640936-51640958 AAGTAAAAAGAAAACAAACTAGG + Intergenic
1126791614 15:52226773-52226795 AAGTAAATGCAAATCTGACTTGG - Intronic
1126829138 15:52581888-52581910 GTGTAAACACTAATCTAACTGGG + Exonic
1127061142 15:55186817-55186839 CTGGAAATACATATTAAACTAGG + Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127562594 15:60154522-60154544 ATATAAATATAAATCATACTGGG - Intergenic
1127820886 15:62655086-62655108 ATATAACTGCAAATCAAATTAGG - Intronic
1127991498 15:64121705-64121727 ATTTAAACACAAATCACTCTTGG + Intronic
1128196847 15:65765588-65765610 AGATGAATACAAATAAAACTGGG - Intronic
1128376615 15:67081055-67081077 ATATAAATTCAAACCAAACTTGG + Intronic
1128407782 15:67360789-67360811 ATGTAAATACAGCTCTATCTAGG - Intronic
1129889222 15:79059876-79059898 ATGTAAATAAAAACTAAATTGGG + Intronic
1130374409 15:83315453-83315475 ATCAAAATATAAATTAAACTGGG - Intergenic
1130414160 15:83674960-83674982 ATGTAATTATAAATCCAACAAGG - Intronic
1130949898 15:88577764-88577786 ATGTAAGTGTAAACCAAACTAGG + Intergenic
1131558088 15:93416422-93416444 AAGTAAATTCAAATGGAACTAGG - Intergenic
1133321594 16:4917283-4917305 ATGAAAATATAAACCAAACGTGG + Intronic
1133631861 16:7629471-7629493 AGGGGAATCCAAATCAAACTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135280312 16:21148667-21148689 CTGTAGAAACAAATTAAACTAGG + Intronic
1135500808 16:22994352-22994374 ATACAAATATAAACCAAACTTGG + Intergenic
1135837564 16:25840930-25840952 AAGTAAATACAAATCTCATTTGG - Intronic
1136104757 16:28022034-28022056 ATGTGAATACAAAACCAAATAGG + Intronic
1137049613 16:35696709-35696731 ATGAAAATAAAAATTTAACTTGG - Intergenic
1137994059 16:53189346-53189368 ATAAAAACACAAAACAAACTAGG - Intronic
1138594731 16:58023810-58023832 ATGTAGATGCAAATCCACCTTGG + Intergenic
1139119301 16:63996428-63996450 AGATATATAGAAATCAAACTGGG - Intergenic
1139608049 16:68034066-68034088 TTGAAAATAAAAATAAAACTAGG - Intronic
1140400057 16:74664448-74664470 AATTAAATAAAAATCAAATTCGG + Intronic
1140579644 16:76214603-76214625 ATGTAAGTACAGATGAAAATGGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141971879 16:87490414-87490436 ATCTAAATACACATCACACCAGG + Intronic
1144123889 17:12182988-12183010 ATAAAAATACTAAACAAACTAGG - Intergenic
1144271882 17:13625544-13625566 AAGAAAATGCAAATGAAACTGGG - Intergenic
1146950492 17:36901990-36902012 ATGCAAATAGGAATCAAGCTTGG + Intergenic
1147749821 17:42723450-42723472 ATTTAACTACAAAATAAACTGGG + Intronic
1148257423 17:46147702-46147724 ATGTTTATAAAAATCAAAATGGG + Intronic
1148762892 17:50017094-50017116 ATCCAAATACAAACCAAACCTGG + Intergenic
1150054256 17:61997767-61997789 CTGTAGAGACAAATAAAACTCGG + Intronic
1150268943 17:63850036-63850058 TTATAAATACAAGTCACACTGGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150606574 17:66696569-66696591 ATATAAATCAAAACCAAACTTGG - Intronic
1150900158 17:69265345-69265367 ATGTAAATCCAAAGGATACTTGG - Intronic
1150918170 17:69457331-69457353 AGGTAAATACCACTCAACCTAGG - Intronic
1151841699 17:76623120-76623142 ATTTAGAAAGAAATCAAACTAGG - Intergenic
1153098359 18:1435577-1435599 TTATAAATACAAATCACATTAGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155445500 18:25908115-25908137 ATAAAAATACTAAACAAACTAGG - Intergenic
1155708806 18:28850056-28850078 ATAAAAGTAGAAATCAAACTAGG + Intergenic
1155915503 18:31553345-31553367 ATGTAAGTACAAATCTAAATGGG - Intergenic
1155945171 18:31840540-31840562 GTATAGATAAAAATCAAACTCGG - Intronic
1155954760 18:31947600-31947622 ATGTCAAAACAAAGCAAATTAGG + Intronic
1156846532 18:41672332-41672354 ATGTAAATAAAAAACAATTTGGG - Intergenic
1157347816 18:46855873-46855895 ATTTCAATAGACATCAAACTTGG + Intronic
1157983254 18:52406929-52406951 TTGAAAATACAAAACAAACCTGG - Intronic
1158055939 18:53280305-53280327 ATGTAAACAGAAATGAGACTAGG - Intronic
1158280187 18:55816644-55816666 ATGTAAATATAACTCAAAAAAGG - Intergenic
1159368778 18:67504982-67505004 ATTCAAATACAGAGCAAACTTGG + Intergenic
1159514110 18:69435361-69435383 ATGTAAATACAGATAAAATATGG + Intronic
1159974222 18:74690791-74690813 CTCTAAATAAAAATCAAAATAGG - Intronic
1160277693 18:77452898-77452920 ATGTAAACTGAAATAAAACTAGG - Intergenic
1161272906 19:3399882-3399904 AAGTAAATAAAAATAAAAATAGG + Intronic
1163358529 19:16830227-16830249 TTGAAAATAAAAATCAAAATGGG - Intronic
1164429404 19:28173924-28173946 ACTTAAATATAAATCAAGCTTGG + Intergenic
1167633864 19:50642117-50642139 ATGTAAACACACATCCATCTGGG - Intronic
1168569764 19:57456646-57456668 AAGTAAATACAAGCAAAACTAGG + Exonic
924994595 2:346859-346881 ATTTAAATACAATTCAGTCTAGG - Intergenic
926130238 2:10298399-10298421 CTGTAATTACAAATGAAACTGGG + Intergenic
926333260 2:11843223-11843245 ATGGAAATGCAAATCAATTTTGG - Intergenic
926855477 2:17251671-17251693 ATGTAAATATAAATATAAATGGG - Intergenic
927123841 2:19995098-19995120 AAATAAATAAAAATAAAACTAGG + Intronic
928625139 2:33132264-33132286 GTGAAAAAGCAAATCAAACTAGG + Intronic
929185029 2:39085034-39085056 AAATAAATACAAATAAAAATAGG - Intronic
930603782 2:53471403-53471425 AAGTAGCTACAAAACAAACTTGG - Intergenic
933146251 2:78856986-78857008 AGATAACTGCAAATCAAACTAGG - Intergenic
933480050 2:82845286-82845308 ATGTAAATGTAAAGCAAACTTGG - Intergenic
933848156 2:86342475-86342497 ATGTAATTATAAAAGAAACTGGG - Intergenic
934182573 2:89639530-89639552 ATTTAATAACAAAACAAACTTGG - Intergenic
934292868 2:91713721-91713743 ATTTAATAACAAAACAAACTCGG - Intergenic
934698700 2:96421034-96421056 ATGTAAAGACCAATGACACTTGG - Intergenic
937177484 2:119954709-119954731 ATGTATCTACAAAACAACCTGGG - Intronic
937978979 2:127601621-127601643 ATGTAAATAGTAATCAAAACAGG - Intronic
938225609 2:129613793-129613815 ATCTAAATTCAAATTTAACTGGG - Intergenic
938773883 2:134524159-134524181 ATGCAATTACAAATCAATCTGGG - Intronic
938861991 2:135378950-135378972 ATATAAATAAAAATAAAACTAGG - Intronic
938979766 2:136515031-136515053 AGGTGAATACAAATCCACCTTGG + Intergenic
939047185 2:137263662-137263684 ATCTATATACAAATGAAATTAGG - Intronic
939287291 2:140148763-140148785 ATGTAGATCCAAATGAAACATGG + Intergenic
939358929 2:141143399-141143421 AGGCAAAGAGAAATCAAACTGGG - Intronic
939721994 2:145665295-145665317 ATGGAAATATAATTAAAACTAGG - Intergenic
941480665 2:166006167-166006189 ATGTGAATAAAAATAAAAGTGGG + Intronic
942203741 2:173598663-173598685 ATTTAAATACAAATCTTACATGG + Intergenic
942349352 2:175036883-175036905 ATTTAAAGACAAATAAAACAGGG - Intergenic
942998608 2:182296757-182296779 ATTTAAATACTAATCTAATTGGG - Intronic
943018334 2:182542004-182542026 ATGAAAATTAAAATCAACCTGGG + Intergenic
943792408 2:191948345-191948367 AGGGAAATACAAATAAAACATGG - Intergenic
943829644 2:192443959-192443981 CAGGAAAAACAAATCAAACTTGG + Intergenic
943889324 2:193266147-193266169 ATTTAAACACAAATCCAACCAGG - Intergenic
944643364 2:201751597-201751619 ATGAAAATACGTAACAAACTGGG - Intronic
944840154 2:203616844-203616866 ATGTAAAACCAAACCAACCTTGG - Intergenic
945078581 2:206065810-206065832 AGGGAAATACAAATCAAAATTGG + Intronic
945143402 2:206711859-206711881 AATTAAATAAAAATCAAATTTGG - Intronic
945507745 2:210662242-210662264 ATTTATATACAAAGCTAACTAGG - Intronic
945619291 2:212113107-212113129 ATGAAAATACAGATCGAATTTGG + Intronic
945759030 2:213888566-213888588 ATGTAAGTACACATGAAAGTTGG + Intronic
945816142 2:214607356-214607378 ATTTAAGTACAAATGTAACTAGG + Intergenic
946111075 2:217417967-217417989 AAGTAATTAGAAATCAAACCTGG - Intronic
946237780 2:218335179-218335201 ATATAAATATAAATAAAAATGGG + Intronic
946989262 2:225309491-225309513 ATGAAAAAACAAAACAAAATAGG - Intergenic
948082454 2:235217614-235217636 ATGAAAATAAAAATCATTCTTGG + Intergenic
1169763126 20:9118761-9118783 ATGAAAATCCAAGTCAAATTAGG + Intronic
1169969894 20:11258626-11258648 ATGTAATGATAAATCAAAGTGGG - Intergenic
1170386403 20:15822689-15822711 ATGTATATAAAAATCACAGTTGG - Intronic
1170905159 20:20508523-20508545 ATGTACATACAAATCACAGTGGG - Intronic
1171110368 20:22475433-22475455 ATGTAAATATAAATCTAAGTGGG - Intergenic
1172253887 20:33499733-33499755 ATTTAATTATAGATCAAACTTGG + Intronic
1173447339 20:43130961-43130983 ATCTAAATACAAATGAAGCCAGG + Intronic
1173728888 20:45315124-45315146 ATGTAAATAAAAATCATGATAGG + Intronic
1175556838 20:59868708-59868730 ATGTAAAAAGAAAATAAACTAGG - Intronic
1176427533 21:6558006-6558028 ATGTTTAAACAAATCAAAATGGG + Intergenic
1176729902 21:10483743-10483765 ATTTAATAACAAAACAAACTCGG + Intergenic
1177046650 21:16179038-16179060 AAGTTGATAGAAATCAAACTTGG - Intergenic
1177853354 21:26374942-26374964 ATATAAATACAAATAAGACCTGG + Intergenic
1178006404 21:28225634-28225656 GTGAGAAGACAAATCAAACTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178522501 21:33298311-33298333 ATGTATATAGAAATAAAATTTGG + Intergenic
1179703024 21:43166323-43166345 ATGTTTAAACAAATCAAAATGGG + Intergenic
1180225698 21:46390935-46390957 ATGTAAAAACAAAGCCAACATGG + Intronic
1180570179 22:16708662-16708684 ATATAAAAACCAATGAAACTAGG + Intergenic
1180885130 22:19237625-19237647 ATGTAAATACCAATCAACAGGGG + Intronic
1181785834 22:25226204-25226226 GTGTATAATCAAATCAAACTTGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182912364 22:33995739-33995761 GTGGAAAAACATATCAAACTGGG + Intergenic
1183808708 22:40236120-40236142 AATTAAATACAAGTAAAACTGGG - Intronic
1184081556 22:42224953-42224975 ATGTAAATAGAAATGAAAAGGGG - Intronic
949179328 3:1108675-1108697 GTGCAAATACAAATCAAATCTGG - Intronic
949762434 3:7486231-7486253 ACTTAAATACAAATAAAACAAGG - Intronic
949976447 3:9465105-9465127 ATGAAAATACCAAACAACCTGGG - Intronic
950953734 3:17028988-17029010 ATGGAAATAAAAATCAAGTTCGG - Intronic
951722304 3:25713181-25713203 ATTTAAATACAAAACAAAAATGG + Intergenic
951927746 3:27927091-27927113 ATGTAGCTACAGATCTAACTGGG + Intergenic
952124596 3:30285764-30285786 AAGTAAATAAATATGAAACTAGG - Intergenic
952449887 3:33421696-33421718 AAGAAAATAAAAATCAAATTTGG - Intronic
952594415 3:34998788-34998810 ATGTAAATACCAATTCAAATTGG + Intergenic
953006810 3:38986547-38986569 ATGTAAAAAGAAATCAATCCAGG + Intergenic
954777195 3:53030317-53030339 ATAAAAATACAAAAGAAACTGGG + Intronic
956237283 3:67087741-67087763 ATGCAAATACATATCAAAAAAGG + Intergenic
956242913 3:67149689-67149711 ATGTAAAGACCATTGAAACTAGG + Intergenic
956932544 3:74061263-74061285 ATGTCAATACAGAACAAACTAGG + Intergenic
957108395 3:75921118-75921140 ATATAAAAACCAATGAAACTAGG - Intronic
957381549 3:79436334-79436356 AAAAAAATACAAATCAAACATGG - Intronic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
958477313 3:94601240-94601262 AAGTAAATATAAATTAAAATGGG + Intergenic
958496785 3:94854351-94854373 ATGAAAATACAAAATAAGCTGGG + Intergenic
958781660 3:98550642-98550664 ATTTAAATTCAAATTTAACTAGG - Intronic
959142998 3:102508383-102508405 ATGAAAATACAATTGAAAATTGG - Intergenic
959207407 3:103327814-103327836 ATGTAAATAAAAACCACAATGGG + Intergenic
959870947 3:111327537-111327559 TTGAAAATACAAATCAATTTGGG + Intronic
959924042 3:111902289-111902311 ATGTAAATGAAAATCAAAATAGG + Intronic
960009690 3:112820348-112820370 AGGTAAATAAAAATGAAAGTAGG - Intronic
960294768 3:115929538-115929560 GTGAAAATACACATCAAACAGGG + Intronic
960303646 3:116034533-116034555 ATGAAAAGCCATATCAAACTAGG - Intronic
960392494 3:117095336-117095358 ACGTACATACAAATCAACCCTGG - Intronic
960403918 3:117236643-117236665 ATGTATAAATAAATCATACTGGG - Intergenic
960425556 3:117502699-117502721 ATGAAAATATAACTCTAACTGGG - Intergenic
960551839 3:118984612-118984634 ATGTAAATTCAAATGAAAGAGGG + Intronic
960766000 3:121130814-121130836 TAGAAAATACAAATCAAAATAGG + Intronic
960821717 3:121740219-121740241 ATGAATATACAAGTAAAACTGGG + Intronic
962756070 3:138466326-138466348 AAGTAGAAACAAAACAAACTGGG + Intronic
963470240 3:145731408-145731430 AAATAAATACAAATAAAACTTGG + Intergenic
963652439 3:147997888-147997910 ATTTAAATCCAAATTAAATTTGG + Intergenic
963677897 3:148336207-148336229 ATGAAAAGACATTTCAAACTAGG - Intergenic
964166637 3:153714911-153714933 ATGAATAGACAAATTAAACTAGG - Intergenic
964381932 3:156106095-156106117 ATGGAAATAAAACTCAAACCAGG - Intronic
964575522 3:158162503-158162525 ATTTAAATCCTAATCAAATTGGG + Intronic
964863642 3:161229975-161229997 ATTTAAATAGAAATTAAAATGGG + Intronic
964918934 3:161872224-161872246 ATGTAAATAAAATTAAAGCTTGG + Intergenic
965444686 3:168760446-168760468 ATATAAATAAAATTAAAACTAGG - Intergenic
966102662 3:176291849-176291871 ATGTAAATTGAAATCACAATCGG - Intergenic
966286809 3:178306707-178306729 AGGCAACTCCAAATCAAACTAGG + Intergenic
966631433 3:182079938-182079960 CTGTAAATACAATTCAATATTGG + Intergenic
969169027 4:5344232-5344254 ATCTAAATACTAATCAAAGTGGG + Intronic
970180928 4:13392470-13392492 AGGTAAATACAGAAGAAACTTGG + Intronic
970338081 4:15073914-15073936 GTGTAAATACAAAACAAATATGG + Intergenic
971779980 4:31020843-31020865 ATGTGAATCCTAATCAAACATGG - Intronic
971780700 4:31030506-31030528 ATGTAAATAAAAGTGTAACTTGG - Intronic
971800362 4:31282233-31282255 ATGTAAATTAAAATCACAGTAGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971946204 4:33281299-33281321 AGGTAAATACCAATAAAAATGGG - Intergenic
972071469 4:35023059-35023081 ATTTTAATACAATTCTAACTTGG + Intergenic
972612084 4:40665237-40665259 CTATAAAGAGAAATCAAACTTGG + Intergenic
973066513 4:45800859-45800881 ATGAAAATACAAATGAAAGTTGG - Intergenic
973779808 4:54277621-54277643 ATCTAAATACACATAAAACCTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974659587 4:64869620-64869642 ATGTATTTAAAAATCAAACATGG - Intergenic
975111723 4:70635742-70635764 AACTAAATACAATTGAAACTTGG - Intronic
975247172 4:72132712-72132734 ATGTAAATAAAAACCACAATGGG - Intronic
975719629 4:77237217-77237239 ATATAAACACAAACCAAACTGGG + Intronic
975828070 4:78340561-78340583 ATATAAAGACAAATCAAATATGG + Intronic
975943724 4:79679560-79679582 ACATAAATAAAAATCAAATTTGG + Intergenic
976003124 4:80396596-80396618 TTTTAAAAAGAAATCAAACTAGG - Intronic
976374655 4:84331142-84331164 ATGCAAAGACAACACAAACTAGG - Intergenic
977088271 4:92633319-92633341 ATGAAAATACAACTTAAATTTGG + Intronic
977259944 4:94786226-94786248 ATGTAATTCCAAATCACACAGGG - Intronic
977293129 4:95184528-95184550 AGGTATATACAAATGACACTTGG + Intronic
977561776 4:98540257-98540279 TTGCAAATACAAATCAAAGACGG + Intronic
977731871 4:100363422-100363444 ATGTAAATGTAAAACACACTAGG + Intergenic
977961059 4:103086214-103086236 ATGGAAATGAACATCAAACTGGG - Intronic
978347276 4:107784955-107784977 ATGGAAATACAGAGAAAACTTGG - Intergenic
978779238 4:112532640-112532662 ATTTTAAAACAAATCAAACTGGG - Intergenic
978831724 4:113094158-113094180 ATGTGAATGCAAATTAAATTAGG + Intronic
978900730 4:113946635-113946657 ATGTAAATTAAAATAGAACTTGG - Intronic
979010639 4:115364992-115365014 ATGTAGATAGAAAACAAACTTGG + Intergenic
979166659 4:117541449-117541471 ATAAAAATACAAACCACACTAGG - Intergenic
979452961 4:120893850-120893872 ATGCAAAGACAAATGAAATTAGG - Intronic
980075980 4:128293355-128293377 ATGAAAATACAAATTCAAATAGG - Intergenic
980179838 4:129390117-129390139 CTGTAAATACCAATCAATATTGG + Intergenic
980554115 4:134380609-134380631 AATGAAATACAAATCTAACTGGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981478955 4:145216454-145216476 AAATAAATACAATTAAAACTAGG - Intergenic
983133226 4:164047896-164047918 ATGGAGCTACAAATCAAAATTGG - Intronic
983147936 4:164241432-164241454 ATGAAAATATTAATCAATCTAGG - Intronic
983172597 4:164552543-164552565 ATGTAAATATGAATAAAACGTGG + Intergenic
983703493 4:170628450-170628472 ATGTTGATACAAATGAAAATGGG - Intergenic
983813369 4:172092204-172092226 ATGCAATTAAAAATCAAATTTGG + Intronic
984222872 4:177000061-177000083 ATGTAAATAAAAAGCAGAATAGG - Intergenic
984223503 4:177006259-177006281 ATGTAAATAAAAAGCAGAATAGG - Intergenic
984240187 4:177209090-177209112 ATGCAAATCCAAATCACAATGGG - Intergenic
984503358 4:180585621-180585643 ATATAAATACAACCCCAACTTGG + Intergenic
984576838 4:181459877-181459899 ATTAAAATATAAATCAATCTGGG + Intergenic
985412759 4:189703466-189703488 ATGTGAATAAAAATAAAACTAGG + Intergenic
986551453 5:8960692-8960714 ATGTAAGCACAAATCAAACAAGG + Intergenic
987451373 5:18088294-18088316 TTGAAAAAACAAAACAAACTTGG - Intergenic
988295222 5:29350076-29350098 ATATAAATACAAATAATAATTGG + Intergenic
988347181 5:30052712-30052734 TTTTAAATAAAAATCATACTAGG + Intergenic
988422735 5:31026148-31026170 ATCTAAATACAAGTCAGATTGGG - Intergenic
988468067 5:31510187-31510209 ATGTAAATACAACTCCATGTTGG - Intronic
988535006 5:32059520-32059542 ATGTTAATATAAATGAAATTTGG + Intronic
991316654 5:65316477-65316499 ATGTAATTACAGATATAACTAGG - Intronic
991479942 5:67067521-67067543 GTGTAAATACAAAGCAAATTAGG + Intronic
993399962 5:87437219-87437241 ATATGAATACAAACCAAGCTGGG + Intergenic
994106079 5:95950865-95950887 ATATATATATAAATAAAACTTGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994886678 5:105572255-105572277 TTTTAAATACAATTCAAATTTGG - Intergenic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
995681710 5:114727749-114727771 ATGTAAATGGAAATAAAAATAGG - Intergenic
995850475 5:116540298-116540320 CGGTAAATGCAAACCAAACTAGG + Intronic
995894755 5:116999568-116999590 AAGTAGATACAAGTCTAACTAGG - Intergenic
996737479 5:126771215-126771237 ATGAAAATCAAAATCAGACTTGG + Intergenic
996957756 5:129205057-129205079 AGTTAGATAGAAATCAAACTGGG + Intergenic
997314077 5:132917242-132917264 ATATTAATACAAATCAAAACAGG + Intronic
997482155 5:134193876-134193898 CAGCAAATACAAAACAAACTGGG + Intronic
998449754 5:142225222-142225244 AAGTAAAAACAAATGTAACTGGG - Intergenic
998994351 5:147854212-147854234 ATGTTAATATAAATCAAATGTGG - Intergenic
999204483 5:149838238-149838260 ATGTGCATACACATCTAACTGGG + Intronic
1000012387 5:157244904-157244926 ATGTGCATACAAATCATACGGGG - Intronic
1000362572 5:160461595-160461617 TTGTAAATACAGGTAAAACTTGG + Intergenic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1001213801 5:169836049-169836071 ATTTAAAAACAAAACAAGCTGGG - Intronic
1002117643 5:176976323-176976345 AAATAAATAAAAATAAAACTGGG + Intronic
1002291975 5:178206168-178206190 ATGAAAATACAGATTAAGCTGGG + Intronic
1002509794 5:179707049-179707071 ATGTAAATACTCATTAAAGTAGG - Intronic
1003090851 6:3101608-3101630 AGCAAAATACAAATAAAACTAGG + Intronic
1003836484 6:10077145-10077167 CTATAAAAACAAATCAGACTGGG + Intronic
1005173833 6:23021282-23021304 ATGTAAACACATATCATATTAGG + Intergenic
1005797634 6:29383633-29383655 AAATGAATACAAATAAAACTGGG + Intronic
1006442214 6:34059756-34059778 ATGGTAATATAAATCAAACCAGG + Intronic
1007059752 6:38927036-38927058 ATGTAAAGATGAATAAAACTTGG - Intronic
1007126396 6:39429386-39429408 ATGGAAAAACAAATCAAGATGGG - Intronic
1007944580 6:45814103-45814125 CTGTAAACACAAAGCAAATTAGG + Intergenic
1008199016 6:48563345-48563367 ATGTTGATGCAAATCAAACTAGG - Intergenic
1008755233 6:54787252-54787274 ATGTGAGTGCAAATAAAACTGGG + Intergenic
1009372406 6:62922577-62922599 ATTTACATACAAAACATACTTGG - Intergenic
1009965707 6:70575800-70575822 ATGTAAACACAATTCTAAATAGG + Intronic
1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG + Intronic
1010648289 6:78421107-78421129 ATGTACAAACAAATGATACTGGG + Intergenic
1011077409 6:83451946-83451968 ATTTAAATCCAACTCAACCTGGG - Intergenic
1011853233 6:91656348-91656370 ATCAAAAAACAAATCAAATTTGG - Intergenic
1011932691 6:92733900-92733922 ATGAAAATACAGAGCAAACGTGG + Intergenic
1012130809 6:95489957-95489979 ATATAAATACACATCAAAGGTGG - Intergenic
1012296288 6:97529049-97529071 AAGAAAATAAAAATCAAATTTGG - Intergenic
1012818938 6:104060570-104060592 ATGAAAATACAAGTAAAAATTGG + Intergenic
1013577793 6:111502012-111502034 TTGTAAATTCAAATTTAACTAGG + Intergenic
1014709976 6:124795536-124795558 CTATAAATATCAATCAAACTGGG - Intronic
1014886289 6:126785279-126785301 ATGTGAATACAAAACAGAGTGGG + Intergenic
1015060260 6:128955661-128955683 ATTTTAATAAAAACCAAACTTGG - Intronic
1015827702 6:137332480-137332502 ATGTAAATAAATGCCAAACTGGG - Intergenic
1016543235 6:145190813-145190835 ATGTAAATATAATTCAAAGAAGG + Intergenic
1017579166 6:155841958-155841980 ATGGAAACACAAAACTAACTAGG + Intergenic
1018397064 6:163386378-163386400 ATGTTAAGAGAAATCACACTCGG + Intergenic
1018449724 6:163896470-163896492 ATGAAAAAACAAATCAGACGAGG + Intergenic
1018850331 6:167583951-167583973 ATGCAAATGGAAATCAAAATAGG + Intergenic
1019985516 7:4652603-4652625 ATGAAAATACAAAGGAAATTTGG - Intergenic
1020413809 7:7923055-7923077 TTGTAAATATAAATTAACCTTGG - Intronic
1020490076 7:8771237-8771259 ATTTACATACAAATCAACATAGG - Intergenic
1021236620 7:18150045-18150067 GTGCAAAGACAAATCACACTAGG - Intronic
1022105746 7:27196005-27196027 CTGTGAAGACAAATCAAATTTGG + Exonic
1022117224 7:27272602-27272624 ATGTAAATACTAATCAAAAGAGG - Intergenic
1022143114 7:27510480-27510502 CTGCAAATACCAGTCAAACTTGG + Intergenic
1022537463 7:31106907-31106929 ATGTAAATACTCCTCAAATTTGG + Exonic
1023935139 7:44734314-44734336 CTGTAAAAACAAAACAAACAAGG - Intergenic
1024336774 7:48216306-48216328 ATGTAAATCAAAATCACAATGGG - Intronic
1024467361 7:49726115-49726137 ATGCAAATACAAATGAATCTAGG - Intergenic
1024480872 7:49861224-49861246 ATGCAAATACAAACCACAATAGG - Intronic
1024800521 7:53072666-53072688 GTACAAATACAAATCAAAGTGGG + Intergenic
1024817567 7:53288587-53288609 ATGTAAATGAACATCACACTGGG + Intergenic
1027480448 7:78689449-78689471 TTTGAAAAACAAATCAAACTTGG - Intronic
1028225204 7:88242701-88242723 ACCTAAATTCAAATCTAACTTGG - Intergenic
1028975764 7:96911980-96912002 ATGTTGATAAAAATCAGACTAGG + Intergenic
1028976046 7:96915417-96915439 AAGTAAATAAAAATAAAGCTCGG + Intergenic
1028979017 7:96946123-96946145 ATGAAAAAAAAAATGAAACTTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030156815 7:106464105-106464127 ATGTGGATCAAAATCAAACTAGG - Intergenic
1030434306 7:109496198-109496220 TTGAAAGTACAAATCAAATTGGG + Intergenic
1030853722 7:114524017-114524039 AAGTAAATTCAAATTTAACTGGG + Intronic
1031621850 7:123943546-123943568 ATGTAAATATAATTCAAAGAAGG + Intronic
1032464394 7:132134760-132134782 ATGGAAATACAAATGAGACGGGG - Intronic
1032581252 7:133105418-133105440 ATGTAATTAAAAATCAGACTTGG - Intergenic
1034114266 7:148569203-148569225 AAATATATAAAAATCAAACTGGG + Intergenic
1034599682 7:152237798-152237820 ATTTAAAAACAAAACAAACTCGG - Intronic
1036929170 8:12936483-12936505 CTATAAATAGAAAACAAACTAGG - Intergenic
1039585205 8:38701426-38701448 ATGCAAATAAAAATAAAACTTGG + Intergenic
1040932588 8:52750392-52750414 ATTTATATACAACTCAAAGTAGG - Intergenic
1041191536 8:55360457-55360479 ATGAAAATACATGTCAAACTAGG - Intronic
1041868027 8:62599013-62599035 ATTTCAATACAAAACAAAATGGG + Intronic
1041930264 8:63279186-63279208 ATGTAGATAGAAAACAAAATTGG - Intergenic
1041987438 8:63940245-63940267 ATGAAAAGACAACACAAACTAGG - Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042884542 8:73533393-73533415 ATGAGATTACAAATCAAACTAGG - Intronic
1043305519 8:78789041-78789063 ATGTTAACACTAATCAAAATGGG - Intronic
1043659599 8:82721335-82721357 ATGTTAATATAAATGAAACATGG + Intergenic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1045564786 8:103302706-103302728 ATTTAGATAAAAATTAAACTGGG + Intronic
1045605742 8:103772588-103772610 CTGTATATATAAATCAAATTGGG - Intronic
1046542796 8:115608474-115608496 ATGTAAATACAAATAAATAAAGG - Intronic
1046633497 8:116645733-116645755 GTGTACATACAAATTAAATTTGG - Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1046787094 8:118279395-118279417 ATGGAAATCTAGATCAAACTTGG + Intronic
1046882517 8:119325069-119325091 AGGGAAATTCAAAACAAACTGGG + Intergenic
1051219153 9:14830551-14830573 ATGTAAAGACATATCAACTTAGG + Intronic
1051786274 9:20747320-20747342 ATGTAAAAAAAAATTTAACTTGG - Intronic
1055789608 9:79909774-79909796 ATATAAATACGAATAAAACAGGG + Intergenic
1056549606 9:87641159-87641181 ATGTAAATATCAATCAAATCTGG + Intronic
1057247242 9:93467074-93467096 ATGAAAAAACAAATCAACCTGGG - Intronic
1057923999 9:99126631-99126653 ATGTAAATACATATAACATTTGG + Intronic
1058009059 9:99955064-99955086 TTCTAAATACAAATCAGATTTGG - Intronic
1058255189 9:102753008-102753030 ATCTTAATACAAAAGAAACTGGG + Intergenic
1058261309 9:102836097-102836119 CTGTATATACAAATTATACTAGG + Intergenic
1059420602 9:114188607-114188629 ATGTATATACAAATATATCTTGG - Intronic
1059572378 9:115453114-115453136 ATGGAAATAGAAATAGAACTAGG - Intergenic
1061189246 9:129071937-129071959 ATGAAAATGCAAATCAGAGTGGG - Exonic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187001368 X:15182467-15182489 ATGCAAATTAAAATCAAACAAGG - Intergenic
1187012184 X:15291052-15291074 ATTTAAATTTAACTCAAACTAGG - Intronic
1187315643 X:18191794-18191816 AAATAAATACAAGTAAAACTGGG + Intronic
1187751609 X:22471877-22471899 AGGTAAATAAAAAGCAAAATGGG + Intergenic
1188195867 X:27232552-27232574 ATGGAACTACAGATCAATCTGGG - Intergenic
1188289986 X:28375759-28375781 ATGTAAATATACATGAAAATAGG + Intergenic
1189048299 X:37616929-37616951 ATGTACATACAAATCACCTTAGG - Intronic
1189864612 X:45312855-45312877 AGGTAAAGACAAATAAAAATGGG - Intergenic
1190386923 X:49891261-49891283 ATATCAATACAACTAAAACTTGG + Intergenic
1190399456 X:50017417-50017439 ATGTAAAAGCAAATCACACATGG - Intronic
1190522527 X:51294849-51294871 AATAAAATACAAATGAAACTAGG - Intergenic
1190524621 X:51316282-51316304 ATGTAAATGCACATAAAAATAGG - Intergenic
1192001979 X:67161180-67161202 ATATAAATAGAAACCAAAATAGG + Intergenic
1193265259 X:79461448-79461470 ATATAAATACAATTCAAAGAAGG - Intergenic
1193279753 X:79632443-79632465 AAATAAATACATATTAAACTGGG - Intergenic
1193646588 X:84077478-84077500 ATATAAATACAAATGCAATTTGG + Intronic
1193748727 X:85316698-85316720 ATGAATAGACAAATCAATCTTGG - Intronic
1193859377 X:86645353-86645375 ATTAAAATGCAAATCAAAATGGG + Intronic
1194017295 X:88639052-88639074 ATGTGACTATAAATCAATCTTGG + Intergenic
1194597871 X:95881563-95881585 ATGTTGATACAAACAAAACTTGG + Intergenic
1194682770 X:96873733-96873755 AAATAAGTACAAATAAAACTAGG + Intronic
1194858850 X:98969365-98969387 ATGTAAATACAATTTCACCTGGG + Intergenic
1196739684 X:119013729-119013751 ATGTAAATATAAATGAATATAGG - Intronic
1197100289 X:122645409-122645431 ATGTACATAGAACTCAAACATGG - Intergenic
1197484393 X:127029792-127029814 ATCTAAATGCAAATAAATCTTGG + Intergenic
1199039695 X:143097738-143097760 TTATCAATAAAAATCAAACTAGG - Intergenic
1199295619 X:146154810-146154832 GTGTATATACAAATCAAATATGG - Intergenic
1200939974 Y:8771133-8771155 ATGTACATAGAAATCACAGTGGG + Intergenic
1201015120 Y:9593145-9593167 ATGTAAAGACCATTGAAACTAGG + Intergenic
1201305617 Y:12547763-12547785 ATGTTAATATAAAGCAAAGTAGG + Intergenic
1201379945 Y:13364405-13364427 ATGTCACTACACTTCAAACTAGG - Intronic
1201392264 Y:13511713-13511735 ATGAAAATATTAAGCAAACTAGG + Intergenic