ID: 1112759910

View in Genome Browser
Species Human (GRCh38)
Location 13:102683260-102683282
Sequence AGCTCCTCAGAAGGCCGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22876
Summary {0: 1, 1: 2, 2: 63, 3: 2087, 4: 20723}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112759910_1112759914 7 Left 1112759910 13:102683260-102683282 CCTGCTCGGCCTTCTGAGGAGCT 0: 1
1: 2
2: 63
3: 2087
4: 20723
Right 1112759914 13:102683290-102683312 CAGGCACGTGCCACCGCACCTGG 0: 27
1: 1423
2: 16379
3: 69389
4: 173291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112759910 Original CRISPR AGCTCCTCAGAAGGCCGAGC AGG (reversed) Intergenic