ID: 1112761727

View in Genome Browser
Species Human (GRCh38)
Location 13:102699548-102699570
Sequence TCCCTTATAAGTAGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112761727_1112761732 11 Left 1112761727 13:102699548-102699570 CCACCATGCCTACTTATAAGGGA No data
Right 1112761732 13:102699582-102699604 AATTCCCTCCCAGAGAAGTGAGG No data
1112761727_1112761738 21 Left 1112761727 13:102699548-102699570 CCACCATGCCTACTTATAAGGGA No data
Right 1112761738 13:102699592-102699614 CAGAGAAGTGAGGGTTTCATTGG No data
1112761727_1112761733 12 Left 1112761727 13:102699548-102699570 CCACCATGCCTACTTATAAGGGA No data
Right 1112761733 13:102699583-102699605 ATTCCCTCCCAGAGAAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112761727 Original CRISPR TCCCTTATAAGTAGGCATGG TGG (reversed) Intergenic