ID: 1112761732

View in Genome Browser
Species Human (GRCh38)
Location 13:102699582-102699604
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112761725_1112761732 12 Left 1112761725 13:102699547-102699569 CCCACCATGCCTACTTATAAGGG No data
Right 1112761732 13:102699582-102699604 AATTCCCTCCCAGAGAAGTGAGG No data
1112761727_1112761732 11 Left 1112761727 13:102699548-102699570 CCACCATGCCTACTTATAAGGGA No data
Right 1112761732 13:102699582-102699604 AATTCCCTCCCAGAGAAGTGAGG No data
1112761728_1112761732 8 Left 1112761728 13:102699551-102699573 CCATGCCTACTTATAAGGGAGAC No data
Right 1112761732 13:102699582-102699604 AATTCCCTCCCAGAGAAGTGAGG No data
1112761729_1112761732 3 Left 1112761729 13:102699556-102699578 CCTACTTATAAGGGAGACTCAGT No data
Right 1112761732 13:102699582-102699604 AATTCCCTCCCAGAGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112761732 Original CRISPR AATTCCCTCCCAGAGAAGTG AGG Intergenic