ID: 1112763191 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:102713355-102713377 |
| Sequence | TGTAATCCCAGTTACTCGAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 557367 | |||
| Summary | {0: 66, 1: 3705, 2: 62458, 3: 231908, 4: 259230} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1112763191_1112763193 | -2 | Left | 1112763191 | 13:102713355-102713377 | CCTCTCGAGTAACTGGGATTACA | 0: 66 1: 3705 2: 62458 3: 231908 4: 259230 |
||
| Right | 1112763193 | 13:102713376-102713398 | CAGGTGCCTGCCACCACGCCCGG | 0: 2562 1: 16195 2: 47269 3: 85378 4: 123123 |
||||
| 1112763191_1112763199 | 26 | Left | 1112763191 | 13:102713355-102713377 | CCTCTCGAGTAACTGGGATTACA | 0: 66 1: 3705 2: 62458 3: 231908 4: 259230 |
||
| Right | 1112763199 | 13:102713404-102713426 | TTTTGTGTTTTTAGTGAAGACGG | 0: 8 1: 633 2: 18905 3: 215866 4: 134925 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1112763191 | Original CRISPR | TGTAATCCCAGTTACTCGAG AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||