ID: 1112763191

View in Genome Browser
Species Human (GRCh38)
Location 13:102713355-102713377
Sequence TGTAATCCCAGTTACTCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 557367
Summary {0: 66, 1: 3705, 2: 62458, 3: 231908, 4: 259230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112763191_1112763193 -2 Left 1112763191 13:102713355-102713377 CCTCTCGAGTAACTGGGATTACA 0: 66
1: 3705
2: 62458
3: 231908
4: 259230
Right 1112763193 13:102713376-102713398 CAGGTGCCTGCCACCACGCCCGG 0: 2562
1: 16195
2: 47269
3: 85378
4: 123123
1112763191_1112763199 26 Left 1112763191 13:102713355-102713377 CCTCTCGAGTAACTGGGATTACA 0: 66
1: 3705
2: 62458
3: 231908
4: 259230
Right 1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG 0: 8
1: 633
2: 18905
3: 215866
4: 134925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112763191 Original CRISPR TGTAATCCCAGTTACTCGAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr