ID: 1112763194

View in Genome Browser
Species Human (GRCh38)
Location 13:102713382-102713404
Sequence AATTAGCCGGGCGTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261885
Summary {0: 14909, 1: 57339, 2: 82932, 3: 69005, 4: 37700}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112763194_1112763202 24 Left 1112763194 13:102713382-102713404 CCTGCCACCACGCCCGGCTAATT 0: 14909
1: 57339
2: 82932
3: 69005
4: 37700
Right 1112763202 13:102713429-102713451 TGTCACTATGTTGGCCAGGCTGG 0: 43
1: 9956
2: 117084
3: 221184
4: 290270
1112763194_1112763201 20 Left 1112763194 13:102713382-102713404 CCTGCCACCACGCCCGGCTAATT 0: 14909
1: 57339
2: 82932
3: 69005
4: 37700
Right 1112763201 13:102713425-102713447 GGAGTGTCACTATGTTGGCCAGG 0: 3
1: 473
2: 13092
3: 109934
4: 245243
1112763194_1112763200 15 Left 1112763194 13:102713382-102713404 CCTGCCACCACGCCCGGCTAATT 0: 14909
1: 57339
2: 82932
3: 69005
4: 37700
Right 1112763200 13:102713420-102713442 AAGACGGAGTGTCACTATGTTGG No data
1112763194_1112763199 -1 Left 1112763194 13:102713382-102713404 CCTGCCACCACGCCCGGCTAATT 0: 14909
1: 57339
2: 82932
3: 69005
4: 37700
Right 1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG 0: 8
1: 633
2: 18905
3: 215866
4: 134925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112763194 Original CRISPR AATTAGCCGGGCGTGGTGGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr