ID: 1112763195

View in Genome Browser
Species Human (GRCh38)
Location 13:102713386-102713408
Sequence CAAAAATTAGCCGGGCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 662099
Summary {0: 8009, 1: 75644, 2: 201133, 3: 218112, 4: 159201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112763195_1112763202 20 Left 1112763195 13:102713386-102713408 CCACCACGCCCGGCTAATTTTTG 0: 8009
1: 75644
2: 201133
3: 218112
4: 159201
Right 1112763202 13:102713429-102713451 TGTCACTATGTTGGCCAGGCTGG 0: 43
1: 9956
2: 117084
3: 221184
4: 290270
1112763195_1112763201 16 Left 1112763195 13:102713386-102713408 CCACCACGCCCGGCTAATTTTTG 0: 8009
1: 75644
2: 201133
3: 218112
4: 159201
Right 1112763201 13:102713425-102713447 GGAGTGTCACTATGTTGGCCAGG 0: 3
1: 473
2: 13092
3: 109934
4: 245243
1112763195_1112763199 -5 Left 1112763195 13:102713386-102713408 CCACCACGCCCGGCTAATTTTTG 0: 8009
1: 75644
2: 201133
3: 218112
4: 159201
Right 1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG 0: 8
1: 633
2: 18905
3: 215866
4: 134925
1112763195_1112763200 11 Left 1112763195 13:102713386-102713408 CCACCACGCCCGGCTAATTTTTG 0: 8009
1: 75644
2: 201133
3: 218112
4: 159201
Right 1112763200 13:102713420-102713442 AAGACGGAGTGTCACTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112763195 Original CRISPR CAAAAATTAGCCGGGCGTGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr