ID: 1112763199

View in Genome Browser
Species Human (GRCh38)
Location 13:102713404-102713426
Sequence TTTTGTGTTTTTAGTGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 370337
Summary {0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112763196_1112763199 -8 Left 1112763196 13:102713389-102713411 CCACGCCCGGCTAATTTTTGTGT 0: 416
1: 14564
2: 77416
3: 161439
4: 156778
Right 1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG 0: 8
1: 633
2: 18905
3: 215866
4: 134925
1112763195_1112763199 -5 Left 1112763195 13:102713386-102713408 CCACCACGCCCGGCTAATTTTTG 0: 8009
1: 75644
2: 201133
3: 218112
4: 159201
Right 1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG 0: 8
1: 633
2: 18905
3: 215866
4: 134925
1112763194_1112763199 -1 Left 1112763194 13:102713382-102713404 CCTGCCACCACGCCCGGCTAATT 0: 14909
1: 57339
2: 82932
3: 69005
4: 37700
Right 1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG 0: 8
1: 633
2: 18905
3: 215866
4: 134925
1112763191_1112763199 26 Left 1112763191 13:102713355-102713377 CCTCTCGAGTAACTGGGATTACA 0: 66
1: 3705
2: 62458
3: 231908
4: 259230
Right 1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG 0: 8
1: 633
2: 18905
3: 215866
4: 134925

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112763199 Original CRISPR TTTTGTGTTTTTAGTGAAGA CGG Intergenic
Too many off-targets to display for this crispr