ID: 1112763200

View in Genome Browser
Species Human (GRCh38)
Location 13:102713420-102713442
Sequence AAGACGGAGTGTCACTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112763197_1112763200 3 Left 1112763197 13:102713394-102713416 CCCGGCTAATTTTTGTGTTTTTA 0: 3330
1: 80161
2: 133903
3: 121949
4: 95232
Right 1112763200 13:102713420-102713442 AAGACGGAGTGTCACTATGTTGG No data
1112763195_1112763200 11 Left 1112763195 13:102713386-102713408 CCACCACGCCCGGCTAATTTTTG 0: 8009
1: 75644
2: 201133
3: 218112
4: 159201
Right 1112763200 13:102713420-102713442 AAGACGGAGTGTCACTATGTTGG No data
1112763198_1112763200 2 Left 1112763198 13:102713395-102713417 CCGGCTAATTTTTGTGTTTTTAG 0: 3719
1: 87965
2: 73299
3: 45924
4: 59067
Right 1112763200 13:102713420-102713442 AAGACGGAGTGTCACTATGTTGG No data
1112763194_1112763200 15 Left 1112763194 13:102713382-102713404 CCTGCCACCACGCCCGGCTAATT 0: 14909
1: 57339
2: 82932
3: 69005
4: 37700
Right 1112763200 13:102713420-102713442 AAGACGGAGTGTCACTATGTTGG No data
1112763196_1112763200 8 Left 1112763196 13:102713389-102713411 CCACGCCCGGCTAATTTTTGTGT 0: 416
1: 14564
2: 77416
3: 161439
4: 156778
Right 1112763200 13:102713420-102713442 AAGACGGAGTGTCACTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112763200 Original CRISPR AAGACGGAGTGTCACTATGT TGG Intergenic
No off target data available for this crispr