ID: 1112765268

View in Genome Browser
Species Human (GRCh38)
Location 13:102735062-102735084
Sequence TGAAGTGGGGAGGATCTAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 194}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112765262_1112765268 -4 Left 1112765262 13:102735043-102735065 CCCTGTATTCACATTAAGGTGAA 0: 1
1: 0
2: 1
3: 15
4: 147
Right 1112765268 13:102735062-102735084 TGAAGTGGGGAGGATCTAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 194
1112765259_1112765268 6 Left 1112765259 13:102735033-102735055 CCTCCTGAAACCCTGTATTCACA 0: 1
1: 0
2: 1
3: 9
4: 188
Right 1112765268 13:102735062-102735084 TGAAGTGGGGAGGATCTAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 194
1112765263_1112765268 -5 Left 1112765263 13:102735044-102735066 CCTGTATTCACATTAAGGTGAAG 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1112765268 13:102735062-102735084 TGAAGTGGGGAGGATCTAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 194
1112765260_1112765268 3 Left 1112765260 13:102735036-102735058 CCTGAAACCCTGTATTCACATTA 0: 1
1: 0
2: 1
3: 15
4: 137
Right 1112765268 13:102735062-102735084 TGAAGTGGGGAGGATCTAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112765268 Original CRISPR TGAAGTGGGGAGGATCTAGA AGG Exonic
904626850 1:31811108-31811130 TGAAGTGGGGAGAATGAAGTGGG - Intronic
904959690 1:34322738-34322760 GCAAGTGGAGAGGTTCTAGAAGG - Intergenic
906643950 1:47459554-47459576 TGAGATGGGGAGGGTATAGAGGG + Intergenic
908609765 1:65844743-65844765 AGAAGTGGGGAGGATATACTAGG + Intronic
909269956 1:73610308-73610330 AAAAGTGGGGAGGCTCTACATGG - Intergenic
909653643 1:78004866-78004888 TGAAAATGGGAGGATCTAGAAGG + Exonic
909767087 1:79369634-79369656 TGCAGTGAGGAGGAACTTGAGGG + Intergenic
910650367 1:89559945-89559967 TGGAGTGGTGAGGATTGAGAAGG - Intronic
912482902 1:109997983-109998005 AGGAGTGAGGAGGCTCTAGATGG + Intronic
913303783 1:117401468-117401490 TGGATTGGGGTGGATATAGAGGG + Intronic
914381324 1:147119047-147119069 TGAAGTGAGGAATATCTAAATGG - Intergenic
915610470 1:156988003-156988025 TACAGTGGGGAGGTTCTAAAAGG - Intronic
916275599 1:162990100-162990122 TGGAGTGGGGAGGATGTGGCTGG - Intergenic
917130722 1:171739594-171739616 TGAAGTGGGGGGAATCTTGTAGG + Intronic
920511067 1:206552386-206552408 GGAAGTGGGGAGGACATAGGAGG + Intronic
922229887 1:223676496-223676518 TGAAGTGGGGATGGTCTTGTAGG + Intergenic
923962713 1:239103084-239103106 TGAAGAGGGGAGGTGGTAGAAGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1066061937 10:31731738-31731760 AGGAGTGGGGAGGCTCTAGGAGG + Intergenic
1066600346 10:37099132-37099154 TGTAGTGGGAGGGATCCAGAGGG - Intergenic
1068123443 10:52808347-52808369 GGAAGTGGGAATGATTTAGAAGG + Intergenic
1069896191 10:71681617-71681639 TAAAGTGGGGAGGAAATGGAGGG + Intronic
1070096355 10:73341065-73341087 TGAGATGGGGAGGAATTAGAAGG + Intronic
1077679191 11:4223589-4223611 TGAAGAGGGGAGGTGATAGAAGG + Intergenic
1077688627 11:4320231-4320253 TGAAGAGGGGAGGTGATAGAAGG + Intergenic
1079429064 11:20371239-20371261 TGAAGTGGCGAGGTCCTAGCTGG + Intronic
1079904236 11:26224608-26224630 TGAAGTATGTAGGATCCAGAGGG + Intergenic
1080098657 11:28434080-28434102 TGTCGTGGGGAGGAACTAGGTGG + Intergenic
1081406888 11:42708592-42708614 TGAAGGAGGGTTGATCTAGAGGG - Intergenic
1081608208 11:44540800-44540822 TGAACTGGGGAGGGAGTAGAGGG + Intergenic
1085890046 11:80567770-80567792 TGTAGTGGGAGGGATCCAGAGGG + Intergenic
1086193928 11:84114487-84114509 TGAGGAGGGGAGGATGGAGATGG + Intronic
1088072688 11:105809881-105809903 TGAGGAGGGGAGGATAAAGAGGG - Intronic
1088466268 11:110142817-110142839 TGAATTGGGAAGGATGTACAGGG + Intronic
1088988061 11:114927348-114927370 TGAAGTGGAGTGGGTCTAGGGGG + Intergenic
1089833514 11:121349764-121349786 TGAAGTGGGGAGGATGCATCTGG - Intergenic
1091675622 12:2486911-2486933 TGAAGTGGGAAGGCTCAAAAAGG - Intronic
1091888862 12:4036804-4036826 TGAGGTGGGGAGGTTCTAGTGGG + Intergenic
1092632348 12:10395539-10395561 GGAAGTGGGGTGTATCTAAATGG + Intronic
1093992972 12:25610653-25610675 TGAAGTGGTGATCATATAGATGG + Intronic
1096025638 12:48358708-48358730 TGAAGGGGTGAGGAGTTAGAGGG + Intergenic
1099246543 12:80199349-80199371 AGGAAAGGGGAGGATCTAGAAGG - Intergenic
1100799454 12:98216011-98216033 TGAAGTGGAGAGCATCTGGGTGG - Intergenic
1101400453 12:104382419-104382441 TGCAGGGGGCAGGATCTGGAAGG - Intergenic
1101969987 12:109306112-109306134 GGAAGTGGGGAGGAACTTGGAGG - Intronic
1103420195 12:120774541-120774563 TAGAGTGGGGAGGACCTAGATGG - Intronic
1103980373 12:124733230-124733252 TGAAGTGGGAAGGAACCAGGTGG + Intergenic
1106628015 13:31441109-31441131 AGAAGTGGGGAGGATGAGGACGG + Intergenic
1111962703 13:94828759-94828781 TGCAATGGGGAGTATCTAAAAGG - Intergenic
1112765268 13:102735062-102735084 TGAAGTGGGGAGGATCTAGAAGG + Exonic
1113872463 13:113567880-113567902 GGAAGTGGGCAGGATTTGGAAGG + Intergenic
1114499929 14:23161190-23161212 TGAAGTTGGGAGGAGCCAGGTGG - Intronic
1119432948 14:74580132-74580154 GGAGGTGGGGAGGATGTGGAGGG + Intronic
1119663132 14:76465589-76465611 TCAAGTGGGGAGGATGTTCAGGG + Intronic
1119897554 14:78232735-78232757 CCAAGAGGGGAGGATCTTGAAGG + Intergenic
1120046614 14:79814790-79814812 TGAATTGGGGAGGAACTTTATGG + Intronic
1120833834 14:89022669-89022691 TGGAGTGGGGAGGGTGTTGAAGG - Intergenic
1121082444 14:91119280-91119302 CGAAGAGGGGAGGAATTAGAGGG + Intronic
1126748544 15:51851978-51852000 GGAGGTGGGGAGGATCAGGAAGG - Intronic
1127281610 15:57497955-57497977 AGAGGTGGGGATGGTCTAGATGG + Intronic
1128729711 15:70013045-70013067 TGGGAAGGGGAGGATCTAGAGGG - Intergenic
1130159884 15:81388207-81388229 TGGAGTGAGGAGGATCATGAGGG + Intergenic
1130354076 15:83114159-83114181 TGGAGTGGGGAGGAACAGGAGGG - Intronic
1130551385 15:84891885-84891907 TGAGGTGGGGAGTTTGTAGAAGG + Intronic
1131916620 15:97272429-97272451 TCAAGTTTGGAGGAACTAGAGGG - Intergenic
1132955471 16:2590468-2590490 TGAAGTGGGAAGTATACAGAAGG + Intronic
1135346805 16:21695723-21695745 GGAAGTGGGGAGCATTTACAGGG - Intronic
1135684472 16:24487405-24487427 TGATGTGGGCAGGATCTTCAGGG + Intergenic
1136030960 16:27502698-27502720 TGCGGTAGGGAGGATTTAGATGG - Intronic
1136089872 16:27911097-27911119 GGAAGTGGGCAGGAACTACAGGG - Intronic
1136250670 16:29002598-29002620 TGGAGTGGGCAGCATCAAGACGG + Intergenic
1138627801 16:58266274-58266296 TGAAGAGAGGAGGATCTAATAGG - Intronic
1141757076 16:85998442-85998464 TGATGTGGAGAGGATGGAGAGGG - Intergenic
1142254373 16:89006815-89006837 GGGAGTGGGGAGGAGATAGAGGG - Intergenic
1143777243 17:9207619-9207641 GGAAGTGGAAAGGATCTAGCAGG - Intronic
1144632295 17:16880457-16880479 TGCAGTGATGAGGATGTAGAGGG - Intergenic
1148764842 17:50031693-50031715 TGATTTGGGGAGGATTTACAAGG - Intergenic
1148982606 17:51591723-51591745 AGAAGTGGGGACGGACTAGATGG - Intergenic
1149776072 17:59358219-59358241 TGAGGTTGGGAGCATTTAGAAGG + Intronic
1149779447 17:59385655-59385677 TGAGGAGGGGAGGATTCAGAGGG + Intronic
1150344876 17:64396991-64397013 TGCAGTGGGGAGGGTGCAGAGGG - Intronic
1153527882 18:6014971-6014993 TGAAGTGGGGTGGATATAAGGGG + Intronic
1153720658 18:7898430-7898452 TGAAGCGGGGAGGATCAGGGAGG + Intronic
1155318660 18:24596888-24596910 TGAAGAGCTGAGAATCTAGAAGG - Intergenic
1155632001 18:27905408-27905430 TGTTGTGGGAAGGATCCAGAGGG - Intergenic
1157391679 18:47308624-47308646 TGAATTTGGGAGGCTCTGGATGG - Intergenic
1157701124 18:49762056-49762078 TGAAGGCAGGAGGATCTGGAGGG + Intergenic
1159106153 18:64003340-64003362 TGAAGTGGGGACCATCTCCAGGG + Intronic
1161797365 19:6394860-6394882 TGATGGGGGGAAGCTCTAGATGG + Intergenic
1163446088 19:17347370-17347392 TGAAGTGGGGAGGGTCCTGAAGG + Intergenic
1164037386 19:21466794-21466816 TGTAGTGGGGAGGAGCAAGGAGG - Intronic
1164706678 19:30325175-30325197 CAAAGTGCGGAGGACCTAGACGG - Intronic
1165433709 19:35785801-35785823 TCCAGTGGGGAGGAACTCGAAGG - Intronic
1166772835 19:45294610-45294632 TTAAGTGGGGAGGATTTTCAGGG - Intronic
1167491031 19:49792717-49792739 TGAAGGGGCGAGACTCTAGAGGG - Intronic
1167735002 19:51288815-51288837 TGGAGTGGGGAGGTTGGAGACGG + Intergenic
925028566 2:629052-629074 GGAAGTGAGCAGGAACTAGACGG + Intergenic
925953940 2:8942626-8942648 GAAAGTGGGGAGCATGTAGAAGG - Intronic
929915415 2:46131542-46131564 TGGAGTGGGGAGGAAAGAGAGGG + Intronic
930629117 2:53733154-53733176 TGAAATGGGAAGGATAGAGAAGG + Intronic
932757101 2:74416453-74416475 TGAAGTGGGGAGGCTGAGGAAGG + Intronic
935967244 2:108492953-108492975 TGAAGAGGGAAGGATTCAGATGG - Intronic
936464001 2:112730953-112730975 TGATGGGGTGAGGATATAGAGGG - Intronic
936689494 2:114869664-114869686 TGAGATAGGGAGGAACTAGATGG - Intronic
937013458 2:118582389-118582411 TGAAGTGGGGCTGGTGTAGAAGG - Intergenic
939693037 2:145289439-145289461 TAAATTTTGGAGGATCTAGAGGG + Intergenic
941032854 2:160532648-160532670 TGTTGTGGGGAGGATGGAGAGGG + Intergenic
941102016 2:161307246-161307268 CAAAGTGGGGAGTATTTAGAAGG + Intergenic
947073777 2:226319438-226319460 TGGAGTGGGGCAGATCTACAAGG + Intergenic
947847819 2:233259745-233259767 TGGAGATGGGAAGATCTAGAGGG - Intronic
948942811 2:241204508-241204530 TGTGGTGGGCAGGATGTAGAGGG + Intronic
1169323209 20:4652605-4652627 AGAAGTGGGGAGGGTCAAGGGGG - Intergenic
1169624499 20:7549143-7549165 TGAAGTGGGGAGCAGTTTGAGGG - Intergenic
1172967182 20:38845180-38845202 CGGAGAGGGGAAGATCTAGAGGG + Intronic
1173552657 20:43943620-43943642 TGAAGTAGGGAGGAGGCAGAGGG + Intronic
1173690271 20:44955392-44955414 TGAAGTGAGGAGGAGAAAGAAGG + Intronic
1175523245 20:59616447-59616469 TGAAGGGAGGAAGTTCTAGAGGG - Intronic
1176061489 20:63174740-63174762 GGAGGTGGGGAGGATGTGGAAGG - Intergenic
1176066048 20:63196013-63196035 TGATGTGTGGAGGAACTGGAAGG - Exonic
1176553432 21:8241533-8241555 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
1176572354 21:8424557-8424579 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
1176580263 21:8469117-8469139 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
1182163242 22:28144941-28144963 TGAAGTTGGGAGGAACCTGATGG + Intronic
1183482558 22:38073134-38073156 TGAAGTGGGGCAGATCTCCAGGG - Intronic
1183566879 22:38621909-38621931 TGCAGTGGGGGGGATTCAGAGGG - Intronic
1203258430 22_KI270733v1_random:158561-158583 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
949940679 3:9151956-9151978 TGATGTGGGGAGGAGCAGGAGGG - Intronic
950593072 3:13953038-13953060 GGAAATGAGGAGGATTTAGATGG + Intronic
950923336 3:16716655-16716677 TCAAGTGAGGAGGAACAAGATGG + Intergenic
952964146 3:38610682-38610704 GGGTGTGGGGAGGTTCTAGAGGG - Intronic
953549200 3:43887560-43887582 TTACATGGGGAGGATGTAGAAGG - Intergenic
953877078 3:46672415-46672437 TGAGGTTGGGAGGATCCAAACGG + Intronic
960049619 3:113227427-113227449 GGAAGTGGGGAAGAGCCAGATGG + Intronic
960587102 3:119330159-119330181 TGCAGTTGGGAGAATGTAGAGGG + Intronic
961404527 3:126668768-126668790 TGAGGTGGGGAGGAGCTGGGAGG + Intergenic
963088173 3:141457290-141457312 TGATATGGGGAGGATATAGCTGG + Intergenic
963088764 3:141462817-141462839 TGAAGTGCTGAGGGTCTATAAGG - Intergenic
966751720 3:183328396-183328418 TGAAGTGGGGACAGTCTTGAGGG + Intronic
966849806 3:184157221-184157243 TGAGGAGGGATGGATCTAGAAGG + Intronic
967234259 3:187368868-187368890 TGACGTGGTGAGAAACTAGAAGG - Intronic
968750754 4:2387646-2387668 TTGGGTGGGGAGGTTCTAGAAGG + Intronic
971576960 4:28286820-28286842 TGTAGTGGGGGGGATCGAGTGGG + Intergenic
972668493 4:41191171-41191193 TGGAGTGGGGAGGATGAGGAGGG + Intronic
972993839 4:44854602-44854624 TGAAGAGGGGAGGGTAAAGAGGG + Intergenic
973634810 4:52852106-52852128 TGAAGAGGAGAGGATGGAGAGGG - Intergenic
973727958 4:53794564-53794586 TGAAGTGCGGAGGATTTTCAGGG - Intronic
976381099 4:84399958-84399980 TGGATTTGGGAGGATATAGAGGG + Intergenic
978974263 4:114849539-114849561 TAAAGCTGGGAGGATCTAAAAGG - Intronic
981725115 4:147839294-147839316 TGAAATGGGAAGTATCTGGAAGG + Intronic
991966457 5:72096323-72096345 TGGAGAGTGGAGGATCTGGAGGG - Intergenic
993482669 5:88444094-88444116 TGAAGTGGAGAGAGTATAGAAGG - Intergenic
993546393 5:89218240-89218262 TGAACTGGGGAGGGTCAAGTAGG + Intergenic
995501743 5:112814553-112814575 AGAAGTGGGGATGCTCTTGAAGG - Intronic
1000154720 5:158539269-158539291 TGAAAGGGGGAGGAACTAGAGGG - Intergenic
1000334131 5:160229370-160229392 TGATGTGGGCAGGACCTGGAGGG - Intronic
1005209545 6:23444683-23444705 TGAAGTGGGGAGGATCTGCTTGG + Intergenic
1006181079 6:32153845-32153867 GGAAGTGGGGAGAATCAAGGCGG + Intronic
1007368292 6:41409460-41409482 TGGAGTGGGGAGGAGAGAGAGGG + Intergenic
1007980310 6:46148333-46148355 TGAAGAGGCTAGGATTTAGAAGG + Intergenic
1011520980 6:88205780-88205802 TGAAGTGGGGAGAGTGAAGATGG + Intergenic
1013073974 6:106754333-106754355 GGAACTGAGGAGGATCCAGAAGG + Intergenic
1013177641 6:107691029-107691051 TGCAGAGGGGAGGAACTTGAGGG - Intergenic
1014524732 6:122489066-122489088 TGAGGTGGGCAGGGCCTAGAAGG - Intronic
1016443240 6:144106445-144106467 TGAAGTGGGGAGAAGTTTGAAGG + Intergenic
1021461252 7:20889248-20889270 TGATATGGAGAGGAGCTAGAAGG - Intergenic
1021564889 7:22007317-22007339 TGAAATGGGAAGGATATAGCAGG - Intergenic
1023120371 7:36902952-36902974 TGGAGTGAGGAGGAGCTGGAAGG - Intronic
1023705489 7:42937173-42937195 TAAAGTGAGGTGGAACTAGATGG + Intronic
1027138460 7:75640244-75640266 TAAAGTGGGGTTGATCTAGGTGG - Intronic
1031016113 7:116578401-116578423 AGAAGATGGGAGGATCTTGAAGG - Intergenic
1032462112 7:132119558-132119580 AGAAATGGGGAGGATTTAAAGGG - Intergenic
1033727897 7:144140668-144140690 TGAAGTGGGGAGTATACAAAGGG + Intergenic
1036136495 8:6166536-6166558 TGAACTTCAGAGGATCTAGATGG + Intergenic
1036452546 8:8881525-8881547 TATAGTGGGGAGCATATAGATGG - Intronic
1037057880 8:14467012-14467034 GGAAGTGAGGAGAATCTAAAGGG - Intronic
1038215144 8:25555155-25555177 TCTGGTGGGGAGGATGTAGAGGG - Intergenic
1039637213 8:39179884-39179906 TGAAGCGGGTAGGACCAAGATGG - Intronic
1041053153 8:53957031-53957053 TGAAGTGGGGATGATGATGATGG - Intronic
1045364128 8:101459928-101459950 TGAAGTGGGGAGGAAACAGAAGG + Intergenic
1048730223 8:137431812-137431834 TAAAGTGAGGAGGAACCAGAAGG + Intergenic
1050140395 9:2511129-2511151 TGAGGTGGGGAGGTGATAGAAGG - Intergenic
1051811698 9:21056770-21056792 TGAAGTGGGGAGGAGATAACAGG + Intergenic
1051859465 9:21607632-21607654 TGAACTGGGTAGGAGGTAGAAGG + Intergenic
1055064652 9:72106732-72106754 TTATGTGGGCAGGATATAGATGG + Intergenic
1057226435 9:93295748-93295770 TGGAGAGGGGAGGATAGAGAGGG - Intronic
1057491747 9:95525593-95525615 TGAAGTGGGGAGGGGCTTGCTGG + Intergenic
1058076376 9:100656107-100656129 TGCTGTGGGAAGGACCTAGAGGG + Intergenic
1061181738 9:129028406-129028428 GGCAGTGGGGCGGAGCTAGAGGG + Intergenic
1062035010 9:134379127-134379149 TGTGGTGGGGAGGAGCTATAAGG - Intronic
1062233713 9:135498024-135498046 TGGTGTGGGGAGGTTCTAGGAGG + Intronic
1203474624 Un_GL000220v1:140577-140599 TGCAGTGGTGAGAAGCTAGATGG + Intergenic
1187026161 X:15437636-15437658 TGAAGTAGGTAGGCTCTAAATGG - Intronic
1187669096 X:21650942-21650964 GGAAGTGGAGAGGCTCTATAAGG - Intronic
1192828701 X:74727636-74727658 TGAGCTGGGGAGAATCTTGAAGG + Intergenic
1194334464 X:92628501-92628523 TGGAGAGGGGAGGAACTATATGG + Intergenic
1195684460 X:107572974-107572996 TCAAGTGGGTAGAAACTAGAGGG + Intronic
1197308618 X:124875895-124875917 TGAAGTGAGGAAGCACTAGAAGG - Intronic
1197564867 X:128070603-128070625 TGAAGTGTGGAGGAGGTTGATGG - Intergenic
1199570547 X:149263087-149263109 TGAAGTCAGGAGGATGGAGAAGG - Intergenic
1199611744 X:149623155-149623177 TGGAGAGGGGAGGATAAAGAGGG - Intronic
1200642942 Y:5745555-5745577 TGGAGAGGGGAGGAACTATATGG + Intergenic
1201061737 Y:10052298-10052320 TGAGGAGGGGAGGAAATAGAAGG + Intergenic