ID: 1112767221

View in Genome Browser
Species Human (GRCh38)
Location 13:102758361-102758383
Sequence TGAAGCTAAATGAAATAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112767221 Original CRISPR TGAAGCTAAATGAAATAGGT TGG (reversed) Intronic
901937872 1:12639437-12639459 TGAATCTGAGTGAACTAGGTGGG + Intergenic
902491399 1:16784460-16784482 TCAAGAGAAATGAAATACGTAGG - Intronic
903267925 1:22169382-22169404 TTCAGCTAAAGGAAATATGTTGG - Intergenic
904385357 1:30138169-30138191 TGAGATTAAATGAAAAAGGTAGG - Intergenic
905024136 1:34838253-34838275 TGAAGCTCCATGAAGAAGGTGGG - Intronic
906619782 1:47266643-47266665 TGAAGGTAAAAGAAAAATGTAGG - Intronic
907788737 1:57640457-57640479 TGAGGCTAAATGAATGAGGAGGG + Intronic
908141116 1:61186048-61186070 TTAAGGTAAATGAAATATTTTGG - Intronic
908611083 1:65862016-65862038 TAAAGCTTATTGAAATAGGAAGG - Intronic
910917047 1:92299730-92299752 TAAATCAAAATGAAATAGGAAGG - Intronic
912220072 1:107664177-107664199 TGAAGAAAAATAAAATAGGAGGG - Intronic
912247420 1:107974669-107974691 TTATGCTAAGTGAAAGAGGTTGG + Intergenic
912617610 1:111120891-111120913 TGGAGGTATATGAAATAGTTTGG - Intronic
916123053 1:161546115-161546137 TGATGCTAAACAAAATTGGTAGG + Intronic
916132945 1:161627483-161627505 TGATGCTAAACAAAATTGGTAGG + Intronic
916495087 1:165339531-165339553 TGAAGAAGAAGGAAATAGGTGGG + Intronic
916500943 1:165386179-165386201 TGAATTTAAATGAAATACTTTGG - Intergenic
917550711 1:176025220-176025242 TTCAACTAAATGAAATAGATGGG + Intronic
918817234 1:189203455-189203477 TTATGCTAAATGAAATACATTGG + Intergenic
918864803 1:189881593-189881615 TTAAGCCAAATGAAATGGTTTGG - Intergenic
918873744 1:190011113-190011135 TAAAGATAAATAAAATAGTTAGG + Intergenic
919109127 1:193195272-193195294 TTACGCTAAACGAAATAGGCTGG - Intronic
919531942 1:198732585-198732607 AGGAGCTGAATGAAATATGTAGG - Intronic
919596073 1:199563724-199563746 AGAAGAAAAATGATATAGGTCGG + Intergenic
920894240 1:210028540-210028562 TTATGCTAAGTGAAATAAGTTGG - Intronic
921000805 1:211040856-211040878 TGAAACAAGATGAAGTAGGTAGG - Intronic
921334172 1:214069590-214069612 TGAATCTCAATCACATAGGTGGG - Intergenic
921338236 1:214109363-214109385 TAAACCTAAATAAAATAGGAAGG + Intergenic
922349325 1:224722758-224722780 GGAAGCTTAAAGAAATGGGTGGG + Intronic
923138080 1:231135785-231135807 TTATGCTAAGTGAAATAAGTCGG - Intergenic
923529044 1:234798083-234798105 TCAAGAGAAATGAAATACGTAGG + Intergenic
923533354 1:234829220-234829242 CCAAGCACAATGAAATAGGTAGG + Intergenic
1063198948 10:3769113-3769135 TGCAACTAAATGAATTATGTGGG - Intergenic
1065372387 10:25001652-25001674 TGTAGCTACATGTAATAGATTGG - Intronic
1065885725 10:30075201-30075223 GGAATCTGAATGAAACAGGTTGG + Intronic
1066477156 10:35758555-35758577 TGAAGCTACAAGAAATAAGTTGG - Intergenic
1068395824 10:56459960-56459982 TGGAACTAAATGAAATAGAATGG + Intergenic
1068557129 10:58471356-58471378 TCAAGCATAATGATATAGGTAGG - Intergenic
1069113643 10:64477004-64477026 TGAAGAAAAATGAAAAAGGGAGG - Intergenic
1069115347 10:64498482-64498504 TTAAGCCAAATGTAATATGTTGG + Intergenic
1070089060 10:73266423-73266445 TGAAGGTAAAAGGATTAGGTAGG - Intronic
1070562425 10:77578018-77578040 TGGAGCTAAATTAAACTGGTGGG + Intronic
1072468182 10:95686874-95686896 TGAAGACAAATGAAATAATTGGG - Intronic
1075928890 10:126277025-126277047 TGAAGCTAAATGAAGTAGCAGGG + Intronic
1078948518 11:16100299-16100321 TGAAGCTTGTTGAAACAGGTTGG + Intronic
1079118619 11:17658828-17658850 TCATGCTAAGTGAAATAAGTCGG + Intergenic
1081369491 11:42282411-42282433 TTATGCTAAATGAACTAGTTAGG + Intergenic
1082683408 11:56207792-56207814 TGCTGCCAAATGAAAAAGGTAGG - Intergenic
1083183769 11:61005633-61005655 TGAAAGTAAATGGAATAGGCTGG + Intronic
1083920456 11:65779384-65779406 TGAAGGTAAAAGAGATGGGTGGG + Exonic
1085281019 11:75330808-75330830 TGAAGCTGAATGAAAGTGGCAGG + Intronic
1086229867 11:84555536-84555558 TTATGCTAAGTGAAATAGGTTGG + Intronic
1087874128 11:103335640-103335662 TGAAGCTATCTGGAATAGTTTGG - Intronic
1089834388 11:121357338-121357360 TGCAAGTAAATGAAATAGTTGGG + Intergenic
1090046435 11:123339074-123339096 TTACGCTAAATGAAAGAAGTCGG + Intergenic
1091495324 12:967579-967601 TAAAACTAAATGACATAGGCAGG - Intronic
1091821746 12:3480655-3480677 TGAAGCTATAAGAAAGCGGTGGG - Intronic
1092603842 12:10097836-10097858 TGAAGCTAAGTGACAAAAGTAGG - Intronic
1092632057 12:10391830-10391852 TTGAACTAAACGAAATAGGTAGG - Exonic
1093396590 12:18690729-18690751 TGAGTCAAAATGAAATAGGCAGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095735860 12:45555525-45555547 CGAAACAAAATGAAAGAGGTGGG + Intergenic
1096875206 12:54624495-54624517 TGAAGGGAAAAGAAATAGATCGG - Intergenic
1097814801 12:64060672-64060694 TGGAATTAAATTAAATAGGTTGG - Intronic
1098199296 12:68037722-68037744 TGAAGTGAAATGTAATAGCTGGG + Intergenic
1098861435 12:75715280-75715302 TGGAGAAAAATGAAATATGTAGG - Intergenic
1100554258 12:95676739-95676761 TAAAGAAAAATTAAATAGGTTGG + Intronic
1100906657 12:99307809-99307831 TACAGCTAAATAAAAAAGGTTGG - Intronic
1101179087 12:102190840-102190862 TGGAGTGAAATGAAATGGGTGGG + Intronic
1101274479 12:103184423-103184445 TCAAACTCAATGACATAGGTAGG - Intergenic
1102611980 12:114120362-114120384 TGAAGCTGTATGTATTAGGTTGG - Intergenic
1103690156 12:122765971-122765993 TGAATGAAAATGAAACAGGTGGG - Intronic
1104091175 12:125519063-125519085 TGAAGCTACATGAAATGGCTTGG + Intronic
1105390317 13:19971042-19971064 TGAAGCTTAATGAGCAAGGTGGG + Intronic
1106992111 13:35432945-35432967 TTAAGCTGAAAGGAATAGGTGGG - Intronic
1109037396 13:57283369-57283391 AGAAGTTGAATGAATTAGGTAGG - Intergenic
1109341563 13:61067318-61067340 TGGAGCTAAAAGAAAAGGGTGGG + Intergenic
1110746917 13:79064688-79064710 TGAAGTTCAATGAAACAGATGGG + Intergenic
1111254919 13:85654000-85654022 TGGAGCAAAATGAAAAAGGTAGG - Intergenic
1111789820 13:92840153-92840175 TTATGCTAAGTGAAATATGTCGG - Intronic
1112046796 13:95605516-95605538 GGAAACTAAAGGAAATAGGTAGG - Intronic
1112767221 13:102758361-102758383 TGAAGCTAAATGAAATAGGTTGG - Intronic
1114794320 14:25695426-25695448 TGAGGGTCAATGAAATAGCTAGG - Intergenic
1115013842 14:28585842-28585864 TGAAGCTAAATAAAACAAATGGG - Intergenic
1115280104 14:31652170-31652192 TTAAGCTTAATGAAATAGCCAGG + Intronic
1115356971 14:32459097-32459119 TTATGCTACATGAAATAAGTCGG + Intronic
1116569183 14:46493470-46493492 TTACGCTAAATGAAATAAGTCGG + Intergenic
1117661356 14:58008859-58008881 TAAAGCTAGAAGAAATAGATTGG + Intronic
1118526933 14:66655340-66655362 TTAAAAAAAATGAAATAGGTAGG - Intronic
1119040074 14:71266188-71266210 TTAGGCTAAATAAAATAAGTCGG + Intergenic
1125063721 15:35456929-35456951 TGAAATAAAATGAAATAGATGGG - Intronic
1127005809 15:54568857-54568879 TAAAGCTAAATGTGCTAGGTAGG + Intronic
1127306533 15:57711204-57711226 TGAAGATCAAAGAAATAAGTAGG - Intronic
1131848843 15:96516369-96516391 TGAAGATATATGAAAGATGTGGG - Intergenic
1133142268 16:3755233-3755255 TAAAGTTAAATGGAATTGGTAGG - Intronic
1133323184 16:4927212-4927234 TGAAACTAAATGATACAGGAAGG + Intronic
1134146052 16:11763473-11763495 TAATGCAAAATGAAACAGGTAGG - Exonic
1134813852 16:17189690-17189712 TTAAGCTAAGTGAAATAAGCAGG + Intronic
1136219096 16:28816509-28816531 TGATGCTAAGTGAAATAAGGTGG - Intergenic
1138025374 16:53518154-53518176 TGAAGATAAATGGATTAGCTAGG + Intergenic
1138133592 16:54502428-54502450 TGAAGCTAAGTGAAATCAGCTGG - Intergenic
1143722038 17:8819194-8819216 TGAAACTGAATGAGATGGGTGGG + Exonic
1143788289 17:9273237-9273259 TGAGGATAAATGAGATACGTGGG + Intronic
1146480691 17:33202755-33202777 TGAAGCTAAATAAAGCAGGAAGG - Intronic
1150435170 17:65148185-65148207 TTATGCTAAGTGAAATAGGCCGG - Intronic
1150666487 17:67143919-67143941 TGAACCTAAATAAAAAAGTTTGG - Intronic
1151235279 17:72715516-72715538 TTATGCTAAGTGAAATAGGACGG + Intronic
1155839355 18:30627832-30627854 AAAAGCTGAAGGAAATAGGTTGG - Intergenic
1156836001 18:41555829-41555851 TGGAGGAAAATGAAAAAGGTGGG - Intergenic
1158038780 18:53068035-53068057 AGAAGCTAAAGGAACTATGTAGG + Intronic
1158251792 18:55497835-55497857 TAAAGCTACATGAAATTGGAAGG + Intronic
1159275615 18:66217566-66217588 TGAAGCTTTATGAAAAAGTTAGG - Intergenic
1159621001 18:70638176-70638198 TTATGTTAAATGAAATATGTTGG - Intronic
1160256588 18:77252494-77252516 TCTACCTAGATGAAATAGGTGGG - Intronic
1160606579 18:80055414-80055436 TGAAGATAAATTAACTAGTTGGG - Intronic
1161621528 19:5299942-5299964 TGAAGAAAAATTAAATAGGCCGG + Intronic
1162942422 19:14019445-14019467 CGAAGATAAATTAAATAGTTTGG + Intergenic
1165324582 19:35106875-35106897 TGAAGCTAAAAGAAATACATTGG + Intergenic
1165657118 19:37543820-37543842 AGAAGCAAAATGAAATAGGAGGG + Intronic
1165998671 19:39863994-39864016 TGGAGCTAAATCAAAGAGGCAGG + Intronic
925686060 2:6475164-6475186 TGAATCTAAATGAAGTAGGTTGG - Intergenic
926407104 2:12566044-12566066 TTAAGGTAAATGAAATAGTTTGG + Intergenic
928480714 2:31680525-31680547 TGATGCTAAATGAGTTAGGGAGG + Intergenic
929091951 2:38226423-38226445 TGAAGGAAAATTATATAGGTCGG + Intergenic
929835200 2:45390134-45390156 TAAATATATATGAAATAGGTGGG - Intronic
929871711 2:45764584-45764606 TGAGGCTAAATGAAAGAGGTAGG + Intronic
930679083 2:54236235-54236257 TAAATCTAAATAAAATAGGCTGG - Intronic
930788667 2:55299915-55299937 TGAAGCTAAATGAAAAAACCAGG + Exonic
931589603 2:63868110-63868132 TCAAGATAAATGTAAGAGGTAGG + Intronic
931879670 2:66555305-66555327 TGGAGCCAAATGAAAGAGGGAGG - Intronic
931913018 2:66922775-66922797 AGATTCCAAATGAAATAGGTTGG - Intergenic
933107170 2:78345313-78345335 AGAAACTAAAGGAAAGAGGTGGG - Intergenic
934603019 2:95672597-95672619 TCAAGCTAAATGACAGAGATTGG - Intergenic
937144504 2:119631375-119631397 TGAAAATCAATGAAATAGGCCGG + Intronic
937844574 2:126565513-126565535 TAAAGCTAAATGCAATGTGTAGG + Intergenic
937881047 2:126865083-126865105 TGAAGCTAAAGGAAAAGGGAAGG + Intergenic
938268642 2:129948945-129948967 TTAAATTAAATTAAATAGGTGGG + Intergenic
938954687 2:136286790-136286812 TGAAGCAGAATGAAAGAGGAGGG - Intergenic
939827443 2:147031835-147031857 TTAAACTAAATTAATTAGGTAGG + Intergenic
940507090 2:154569930-154569952 TGAAACTAAGTGAATTATGTGGG - Intergenic
940541837 2:155030118-155030140 AGAAGCTAAAATAAATGGGTTGG - Intergenic
941034353 2:160551550-160551572 TGAACCGAATTGAAAGAGGTTGG - Intergenic
941360408 2:164544477-164544499 AGGAGCTAAATGAAATAGCTTGG + Intronic
942099437 2:172564714-172564736 AGAAGCTAAATGAGATGTGTTGG + Intronic
944682759 2:202091902-202091924 TGAAGCAAAATGAAAGTTGTGGG + Intronic
945344409 2:208695941-208695963 GGAGGCTTAATGGAATAGGTGGG - Intronic
945868027 2:215198171-215198193 TTATGCTAAATGAAATAAGCTGG + Intergenic
946798040 2:223377465-223377487 TTATGCTAAGTGAAATAAGTCGG + Intergenic
1170125185 20:12955273-12955295 TGAAGCAAACTGAAAGAGATTGG + Intergenic
1170149524 20:13215255-13215277 GGAAGCTAAATGAACTCTGTGGG + Intergenic
1170924019 20:20706174-20706196 TTAAGATAACTGAAAAAGGTTGG - Intronic
1172210530 20:33194896-33194918 TGGAGCTAAAGGAGATAGGGGGG - Intergenic
1172422872 20:34832206-34832228 TTATGCTAAGTGAAATAAGTCGG + Intergenic
1174789257 20:53462575-53462597 TGAAGCTAAATGAAGTTAATGGG - Intronic
1178125783 21:29514171-29514193 GGAGGATAAATGAAAGAGGTGGG + Intronic
1178313517 21:31550356-31550378 TGATGCTAAATGAAAGAAGCCGG + Intronic
1178678425 21:34650863-34650885 TGTAGCTGCTTGAAATAGGTGGG - Intergenic
1182218947 22:28742574-28742596 TGAAGTTAGAGGAAATAGGGGGG + Intronic
951979330 3:28548363-28548385 TCCAGATAAATGAAATATGTAGG + Intergenic
952614906 3:35259121-35259143 TAAAGCTGGATGAAATATGTTGG + Intergenic
952916142 3:38244543-38244565 TTATGCTAAGTGAAATAGGCCGG - Intronic
953228124 3:41039403-41039425 TGAAGCTCAAAGACAGAGGTTGG - Intergenic
953560794 3:43990909-43990931 AGGAGCTAATTGACATAGGTGGG + Intergenic
954984801 3:54780364-54780386 TGTTGCTAAATGCAATATGTTGG + Intronic
957691982 3:83582483-83582505 TTATGCTAAATGAAATAGGATGG - Intergenic
959741052 3:109720120-109720142 TGAAGCTAAATGGAATAGGGAGG + Intergenic
959828278 3:110828016-110828038 AGAAGGTAAATGAATGAGGTTGG - Intergenic
960582650 3:119294242-119294264 TGGAGCTAGAGGAAGTAGGTGGG - Intergenic
962087592 3:132208191-132208213 TGAAGCTACATGAAACAAGAAGG - Intronic
962714933 3:138117646-138117668 TTATGCTAAATGAAATAAGCTGG + Intergenic
963834793 3:150047395-150047417 TGAGGCTAAATGACATGGCTGGG + Intronic
965380976 3:167987668-167987690 TTCTGCTAAATGAAATAGCTGGG + Intergenic
966133222 3:176667980-176668002 TTATGCTAAATGAAAGAAGTTGG - Intergenic
966368796 3:179223486-179223508 TGAGGCTAAAAGAAATTGTTGGG - Intronic
966765163 3:183454675-183454697 TAAAATTAAATGAAATAGGCTGG - Intergenic
968007969 3:195255858-195255880 TGCAGCTAAATGAGGGAGGTGGG + Intronic
970262465 4:14242534-14242556 TGAAGATAAATGACATATCTAGG + Intergenic
970858671 4:20677132-20677154 TCAAGTTAAAAGATATAGGTAGG + Intergenic
971556347 4:28016854-28016876 TGAAAATTAATAAAATAGGTAGG + Intergenic
971556409 4:28017702-28017724 TGAAAATAAATGAACAAGGTTGG + Intergenic
972209294 4:36817742-36817764 TGAATCTAAATGGACTAGGTGGG + Intergenic
972970084 4:44563901-44563923 TGAAGCTAAGTTAAATTTGTAGG + Intergenic
974785628 4:66616874-66616896 ATAAGCTCAATGAAAAAGGTTGG - Intergenic
976048315 4:80980009-80980031 AGAAGGAAAATGAAATAGCTAGG + Intergenic
976402765 4:84625745-84625767 TGTAATTAAATGAAGTAGGTTGG + Intronic
976631474 4:87241663-87241685 AGAAGCTGAAAGAAAAAGGTAGG + Intergenic
977253527 4:94715037-94715059 TGACGCTAAAGGACATAGCTTGG - Intergenic
978597386 4:110393075-110393097 GGCAGCTAAATGAGACAGGTAGG + Intronic
979574609 4:122273860-122273882 TAATGCTAAATGAAAAAAGTAGG + Intronic
980719874 4:136681457-136681479 TGTAGCTAAATTAAATAGAAAGG - Intergenic
984083818 4:175283548-175283570 TGAAGGTTAGTGAAATGGGTGGG + Intergenic
984167050 4:176315239-176315261 TAAAGCTAAATTGAATATGTAGG - Intergenic
985379512 4:189377478-189377500 TGAACCTAAATAAAACAGATAGG - Intergenic
985389331 4:189478796-189478818 TGAATCTAAATAAAATAGCTTGG - Intergenic
986080941 5:4393707-4393729 TCAGGCTAATTGAAATAGCTAGG + Intergenic
986099040 5:4588362-4588384 TGAGACTAAATCTAATAGGTTGG + Intergenic
989088134 5:37697974-37697996 TGAATCTAAATGAAAAACTTAGG - Intronic
989416243 5:41180089-41180111 TGAGGATAAATGAAATACTTGGG + Intronic
989441616 5:41478496-41478518 TGAAAGTATATGAAATAGGAAGG + Intronic
990687613 5:58324054-58324076 TGCATCTGAATGAAAGAGGTAGG + Intergenic
991969924 5:72129945-72129967 TAAATATAAATGAAATAGTTTGG + Intronic
992200637 5:74380529-74380551 TCAAGCAACTTGAAATAGGTAGG + Intergenic
992598120 5:78366628-78366650 TCAAGGTAAATGAAATAAGATGG - Intronic
992850021 5:80797685-80797707 TGATGCAAAGTGAAAAAGGTTGG - Intronic
992982805 5:82194213-82194235 AGAAGCCAAGTAAAATAGGTGGG + Intronic
993520756 5:88896804-88896826 GGAAGTTAAATGGAATAGTTGGG - Intronic
994150619 5:96443427-96443449 AGAATCTAGATGTAATAGGTTGG - Intergenic
994250807 5:97534578-97534600 TTAAGCTAAGTGAAATAAGCTGG - Intergenic
994364474 5:98896527-98896549 TGAAGTTAAATAAAATTGATAGG + Intronic
995786549 5:115836470-115836492 TGAAGCTAAATGGAAAAGTCAGG - Intronic
995841284 5:116445682-116445704 TGTAGCTAAAGGAAAAAGTTAGG - Exonic
999700225 5:154221080-154221102 GTAAGATAAATGAAATAGGTAGG + Intronic
999880105 5:155853247-155853269 AGAAGCTAAATGAGAAGGGTGGG - Intergenic
1000205750 5:159056990-159057012 TGCAAATAAATGAAATATGTGGG + Intronic
1000750075 5:165084259-165084281 TCAAGTTAAATGAAAAAGTTTGG - Intergenic
1003654885 6:7997695-7997717 CTAAGTTAAATGAAATAGTTGGG - Intronic
1003716844 6:8656413-8656435 TTATGCTAAGTGAAATAAGTTGG - Intergenic
1003927508 6:10889979-10890001 TTATGCTAAATGAAATAAGCGGG - Intronic
1004440670 6:15649378-15649400 TTATGCTAAATGAAATAAGCCGG + Intronic
1004620597 6:17327147-17327169 TGAAGGAAAAAGAAAAAGGTGGG + Intergenic
1005423244 6:25674315-25674337 GGAAGAAAAATGAAATAGATTGG - Intronic
1005699030 6:28381488-28381510 TGAAGCTAAAGGAGTTAAGTGGG + Exonic
1008947737 6:57117368-57117390 TGTAGTTAAATAAAATATGTAGG + Intronic
1009294368 6:61926597-61926619 TGCAGCAAACTGGAATAGGTTGG + Intronic
1009843482 6:69106556-69106578 TGATGGTAATTGAAATAAGTTGG - Intronic
1010472003 6:76239776-76239798 TGAAACTAACTGAAATAGACAGG + Intergenic
1013486716 6:110603847-110603869 TGAGGCAAAATGACATAGTTTGG + Intergenic
1013552717 6:111224422-111224444 TGAAACTAAAAGAAATTGCTTGG + Intronic
1014178559 6:118357381-118357403 AGAAGGAAAATGATATAGGTTGG + Intergenic
1014474777 6:121858784-121858806 TTAAGCTAAATAAAATATATTGG - Intergenic
1014788877 6:125648477-125648499 TGACTATAAATGAAACAGGTTGG - Intergenic
1015886282 6:137921939-137921961 TGAAGGGAAATGAAAGAGGGAGG + Intergenic
1018597676 6:165500687-165500709 GGAAGATAAATGAAAGAGGAAGG + Intronic
1020531262 7:9338930-9338952 TGAAGTGAAATGAAATAAGGAGG - Intergenic
1020646610 7:10821764-10821786 TAAAGCTCAATGAAATTGGAAGG + Intergenic
1021198915 7:17704964-17704986 TTATGCTAAATGAAATAAGCCGG + Intergenic
1021440962 7:20675639-20675661 AAAAGCAAAATTAAATAGGTAGG + Intronic
1021530549 7:21640021-21640043 TGAACCTAAATTCAATTGGTTGG + Intronic
1022216615 7:28269388-28269410 TAAAGATAAATTAAATAAGTGGG + Intergenic
1022583090 7:31576686-31576708 TGTAGGTAAAAGAAAAAGGTAGG + Intronic
1027109955 7:75429714-75429736 TGTAAATAAATGAAAGAGGTGGG + Intronic
1028211905 7:88083958-88083980 TGAAGCCAAATGAAAAGGGATGG - Intronic
1029991730 7:104968347-104968369 TGAAGCAAAATGAAATGGAAAGG + Intergenic
1030766973 7:113422041-113422063 TGGAGCTACAGGAAATTGGTGGG + Intergenic
1031036173 7:116790378-116790400 TTTTGCTAAATGAAATAAGTCGG - Intronic
1032782989 7:135179043-135179065 AGAAGCAAAAGGAAATAGGAAGG + Intergenic
1032922490 7:136565899-136565921 AGAAGAGAAATGTAATAGGTTGG - Intergenic
1033883368 7:145915407-145915429 TGAAGCTAAATAGAATTGGAAGG - Intergenic
1035594426 8:844216-844238 TGAAGCTGAATCAAAATGGTAGG + Intergenic
1038604682 8:28988197-28988219 TCATGCTAAATGAAAGAAGTTGG - Intronic
1041569200 8:59317436-59317458 CTAAGGTATATGAAATAGGTGGG - Intergenic
1043550575 8:81367723-81367745 TTATGCTAAATGAAATAAGATGG + Intergenic
1044921437 8:97173625-97173647 TGATGCTGAAGGAAATAGTTAGG - Intergenic
1045088878 8:98717920-98717942 TTATGCTAAATGAAGTAAGTCGG + Intronic
1046005646 8:108479892-108479914 TGAAACAGAATGAAATAGCTGGG - Intronic
1046042042 8:108917597-108917619 AAAAGATAAATGAAACAGGTTGG + Intergenic
1046897921 8:119493217-119493239 TTATGCTAAGTGAAATAGTTGGG + Intergenic
1047482212 8:125295031-125295053 TGAAACTACTTAAAATAGGTTGG + Intronic
1049836207 8:144737098-144737120 TTAAGCAAAATAAAATAGGCCGG - Intronic
1049983986 9:931131-931153 TTATGCTAAATGAAAGAAGTCGG - Intronic
1053805122 9:41793633-41793655 AGAAGAAAAATAAAATAGGTAGG + Intergenic
1054140139 9:61521730-61521752 AGAAGAAAAATAAAATAGGTAGG - Intergenic
1055696123 9:78886588-78886610 TGAAGGTATATGAACTAGATGGG - Intergenic
1059797209 9:117711264-117711286 AGAAGCTAAATAAAATGGGTGGG + Intronic
1060843271 9:126812184-126812206 TTATGCTAAATGAAAGAGGTCGG - Intronic
1061328701 9:129879255-129879277 CGAGGCTAAATGAGATAGCTGGG + Intronic
1186854373 X:13611911-13611933 TAAAGCAAAATGAAAAGGGTTGG - Intronic
1188258537 X:27993533-27993555 TGAAGATAAATGAATTTGGCTGG - Intergenic
1188315141 X:28664492-28664514 TAAAGCTAAAAGAAACATGTAGG - Intronic
1190133737 X:47775033-47775055 TAATGTTAAATGAAATAAGTCGG + Intergenic
1190472169 X:50793159-50793181 TTATGCTAAATGAAATAAGCTGG + Intronic
1192262519 X:69514327-69514349 TCATGCTAAATGAAATAAGCTGG - Intronic
1192385934 X:70669725-70669747 TGAACCCAAATGAAATATGAAGG - Intronic
1192969452 X:76216419-76216441 TGAAGATAAATAAAATTGATAGG - Intergenic
1194002348 X:88446166-88446188 TTATGCTAAGTGAAATAAGTTGG + Intergenic
1194409335 X:93538295-93538317 AGAAGCTAAAAGATACAGGTAGG - Intergenic
1194427636 X:93759592-93759614 TGAGACTAAATGAAATACCTTGG - Intergenic
1196792843 X:119479957-119479979 TGAAAGTGAATGACATAGGTAGG - Intergenic
1197814373 X:130481507-130481529 TGTAGCCAAATGAAATAGTAAGG + Intergenic
1197989207 X:132298999-132299021 TGCAGCTAAATGAACTATATGGG - Intergenic
1198315183 X:135458564-135458586 TGAAGATAAATTAAATATATGGG - Intergenic
1198656775 X:138923346-138923368 TGAAAATAAATGGATTAGGTTGG - Intronic
1198947752 X:142033699-142033721 TGAAGCTAAGTGATATAGTTGGG + Intergenic
1199925888 X:152463589-152463611 TGAAGCAAAAATACATAGGTGGG + Intergenic
1201210274 Y:11674129-11674151 TGAAGCGAAATGAAATGGAATGG + Intergenic