ID: 1112772765

View in Genome Browser
Species Human (GRCh38)
Location 13:102809741-102809763
Sequence TTGGAGATGAATAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1520
Summary {0: 1, 1: 4, 2: 54, 3: 266, 4: 1195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112772765 Original CRISPR TTGGAGATGAATAGTGATGA TGG (reversed) Intronic
900415667 1:2533394-2533416 CTGGAGATGGACAGTGGTGATGG - Intergenic
900426158 1:2580131-2580153 CTGGAGATGGATGGTGGTGATGG + Intergenic
900976798 1:6022568-6022590 CTGGAGATGGATGGTGGTGATGG - Intronic
901117699 1:6861784-6861806 CTGGAGATGGATGGTGCTGATGG - Intronic
901257025 1:7838287-7838309 CTGGAGATGGATGGTGGTGATGG - Intronic
901431644 1:9218859-9218881 CTGGAGATGGATGGTGGTGATGG - Intergenic
902158100 1:14505987-14506009 CTGGAGGTGAATGGTGGTGATGG + Intergenic
902180160 1:14682049-14682071 CTGGAGATGGATAGTGATGATGG - Intronic
902215659 1:14932902-14932924 TTGGAAATGGATTGTGGTGATGG - Intronic
902342292 1:15791872-15791894 CTGGAGATGTATGGTGGTGATGG + Intergenic
902548577 1:17205891-17205913 ATGGTGATGAACAGTGATGATGG + Intronic
902944897 1:19828150-19828172 ATGGAGATGGATGGTGGTGAGGG - Intergenic
903134854 1:21302753-21302775 TTGGAGGTGGAAGGTGATGACGG + Intronic
903308990 1:22437790-22437812 ATGGAGATGGATGGTGGTGATGG - Intergenic
903472479 1:23596967-23596989 TTGGAAATGAATAGGTTTGATGG + Intronic
903520526 1:23944255-23944277 CTGGAGATGGATGGTGATGATGG - Intergenic
904448437 1:30594947-30594969 CTGGAAATGGATAGTGATAATGG + Intergenic
904783669 1:32969453-32969475 CTGGAGATGGATGGTGGTGATGG - Intergenic
904860185 1:33531879-33531901 CTGGAAATGGATAGTGGTGATGG + Intronic
904913948 1:33956244-33956266 TTGTGGATGGATAGTGGTGATGG - Intronic
905073091 1:35245132-35245154 CTGGAAATGGATGGTGATGATGG - Intergenic
905138889 1:35824865-35824887 CTGAAAATGGATAGTGATGATGG - Intronic
905160733 1:36031608-36031630 CTGGAAATGGATAGTGATGATGG - Intronic
905288144 1:36899592-36899614 ATGGAGATGAGTGGTGCTGATGG + Intronic
905845559 1:41228325-41228347 CTGGAGATGGATGGTGATGAGGG + Intronic
906008258 1:42498340-42498362 CTGGAGATGGATGGTGGTGATGG + Intronic
906229089 1:44145550-44145572 CTGGAGATGGATGGTGGTGATGG + Intergenic
906504381 1:46367212-46367234 TTGGAGATGAAGAATGCAGATGG - Intergenic
906579660 1:46925878-46925900 TTGGAAATAGGTAGTGATGATGG - Intergenic
906604063 1:47153010-47153032 TTGGAAATAGGTAGTGATGATGG + Intergenic
906789713 1:48648138-48648160 TTGGAGATGGATGGTGTTGTTGG - Intronic
906911129 1:49952067-49952089 CTGGAAATGGATAGTGATAATGG + Intronic
906958219 1:50395300-50395322 CAGGAGATGAATGGTGGTGATGG - Intergenic
906968021 1:50478699-50478721 TTGGAAATAAATAGTAGTGATGG - Intronic
907005043 1:50904423-50904445 CTGGAGATGAATGGTGGTAATGG + Intronic
907027742 1:51138370-51138392 CTGAAGATGAATGGTGGTGATGG - Intronic
907061811 1:51434628-51434650 TTGGAAATGAATGGTGATGATGG + Intronic
907084253 1:51654980-51655002 CTGGAGATGGATGGTGATGATGG + Intronic
907125199 1:52043927-52043949 TTGGGAATGAAAAGTGAGGATGG - Intronic
907233606 1:53024368-53024390 ATGGAGATGAAAGGTGATGATGG + Intronic
907474470 1:54696402-54696424 CTGGAGATGAATGGTGGTGATGG - Intronic
907528911 1:55073120-55073142 CTGGAGATGGATGGTGGTGATGG + Intronic
907738060 1:57135182-57135204 TTAGAGATGAATAGTGGTTTTGG - Intronic
907773845 1:57493236-57493258 CTGGAGATGGATGGTGATAATGG - Intronic
907923442 1:58934074-58934096 TTGGAGATGGATGGTGGTGATGG + Intergenic
907931466 1:59004980-59005002 CTGGGGATGGATGGTGATGATGG + Intergenic
908058166 1:60315194-60315216 CTGGAGATGGATGGTGGTGATGG + Intergenic
908141895 1:61193613-61193635 TTGGAGTAGAAAAGAGATGAAGG + Intronic
908222986 1:62027049-62027071 CTGGAGATGGATGGTGATGATGG - Intronic
908266388 1:62383480-62383502 CTGGAGATGGATGGTGGTGATGG + Intergenic
908290464 1:62661337-62661359 CTGGAGATAAATAGTGGTGATGG + Intronic
908322733 1:62993762-62993784 CTGGAGATGGATGGTGGTGATGG + Intergenic
908345726 1:63230380-63230402 CTGGAGATGGATGGTGGTGATGG - Intergenic
908368922 1:63460225-63460247 TTGGAAATAGATAGTGGTGATGG - Intronic
908384288 1:63626292-63626314 CTGGAGATGGATAGTGGTGATGG - Intronic
908475602 1:64484565-64484587 CTAGAGATGGATGGTGATGATGG - Intronic
908631297 1:66111343-66111365 CTGGAGATGGATGGTCATGATGG - Intronic
908725783 1:67175425-67175447 CTGGAGATAAATGGTGGTGATGG - Intronic
908734472 1:67261922-67261944 TTTGTGCTGAATAGTGATGTGGG - Intergenic
908787993 1:67754127-67754149 TTGGAGGTGAGGAGAGATGAAGG - Intronic
908962801 1:69720934-69720956 CTGGAGATGGATGGTGGTGATGG - Intronic
909706361 1:78589380-78589402 TGGGAGATGATTAGTCATGAAGG - Intergenic
909972807 1:82010377-82010399 CTGGAGATGAATGGTGGTGAAGG + Intergenic
910292183 1:85610108-85610130 CTGGAGATGGATGGTGGTGATGG - Intergenic
910293221 1:85618510-85618532 GTGCAGATGAATACTGATTATGG + Intergenic
910302819 1:85726673-85726695 TTGGAGATAGATAATGAAGATGG - Intergenic
910700625 1:90070309-90070331 TTTGAGATGAAAAATGATAATGG + Intergenic
910763343 1:90756879-90756901 TTGGAGATGGATGGTGGTGATGG - Intergenic
910775299 1:90868695-90868717 CTGGAAATGGATAGTGATCATGG - Intergenic
910834346 1:91493245-91493267 CTGGAGATGGATGGTGGTGATGG + Intergenic
910938415 1:92506208-92506230 TTGGAGATGGATAGTGGTCATGG - Intergenic
911212133 1:95153207-95153229 CTGGAGATGGATGGTGGTGATGG + Intronic
911266633 1:95752425-95752447 ATGGAAATGGATGGTGATGATGG - Intergenic
911422932 1:97668068-97668090 CTGTGGATGAATAGTGCTGATGG + Intronic
911606015 1:99906075-99906097 CTGGAGATGGACAGTGATGATGG - Intronic
911747286 1:101453753-101453775 TTGGGGCTGAATCTTGATGAAGG + Intergenic
911790447 1:102009167-102009189 CTGGAAATAAATAGTGATGATGG + Intergenic
911967549 1:104386817-104386839 TTGGAGAGGAAGAGTGAAGGAGG - Intergenic
912037357 1:105334964-105334986 TTGGAGGAGAAGATTGATGATGG + Intergenic
912479516 1:109970197-109970219 ATGGAGATGGATGGTGGTGATGG + Intergenic
912542039 1:110424197-110424219 CTGGAGATGGATGGTGGTGATGG + Intergenic
912653402 1:111462342-111462364 ATGGAGCTGGATAGTGGTGATGG + Exonic
912708487 1:111932454-111932476 CTGAAGATGGATAGTGGTGATGG - Intronic
913148671 1:116018092-116018114 CTGGAGATGAATAGTGGCAATGG - Intronic
913178827 1:116299588-116299610 TAGGAGATGAGGATTGATGAGGG - Intergenic
913428270 1:118759288-118759310 ATGGAGATAAATAGTGGTGATGG - Intergenic
914019283 1:143850007-143850029 TTGGAAATGAATTGTCATGTTGG - Intergenic
914224659 1:145710227-145710249 CTGGAGATGGATGGTGGTGATGG - Intergenic
914923902 1:151867018-151867040 TTGGAAATAGATAGTGGTGATGG - Intergenic
915381282 1:155443080-155443102 TTGGAGATAAAAAGTGATTTTGG - Intronic
915669335 1:157475252-157475274 CTAGAAATGGATAGTGATGATGG + Intergenic
915922394 1:159986337-159986359 CTGGAGATGGACAGTGGTGATGG + Intergenic
916178007 1:162058758-162058780 GTGGAAATGAATAGTGGTAACGG - Intergenic
916202135 1:162282179-162282201 CTGGAGATGGATGGTGGTGATGG - Intronic
916471650 1:165129467-165129489 CTGGAGGTGGCTAGTGATGATGG - Intergenic
916643450 1:166757468-166757490 CTGGAGATGGATGGTGATTATGG - Intergenic
916914351 1:169390008-169390030 CTGGAGATAAACAGTGATGATGG + Intronic
916933925 1:169608284-169608306 TTGGAGATGAATAATGGTGATGG - Intronic
917002759 1:170377996-170378018 TTGGAGATGGATAGTGATGATGG - Intergenic
917139467 1:171820604-171820626 TTGGAGCTAGATAGTGATGATGG - Intergenic
917737540 1:177934241-177934263 CTGGAGATGGCTAGTGGTGATGG - Intronic
917811791 1:178665766-178665788 CTGGAGATGGATAGTGATGATGG + Intergenic
917891577 1:179443481-179443503 CTGGAAATGAATGGTGGTGATGG - Intronic
918189352 1:182157424-182157446 ATAGAGATGAATGGTGGTGATGG - Intergenic
918441148 1:184568301-184568323 CTGGAGATGGATGGTGGTGATGG - Intronic
918858608 1:189792116-189792138 TTGCACATGAATAATGTTGATGG + Intergenic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
919272748 1:195371096-195371118 GTGGTGATGAATATTGACGATGG + Intergenic
919422623 1:197389598-197389620 CTGGAGATGGATGGTGGTGACGG + Intronic
920669141 1:207989778-207989800 CTAGAGATGGATAGTGGTGATGG - Intergenic
920862220 1:209719491-209719513 CTGGAGATGGATGGTGGTGATGG + Intronic
920894213 1:210028356-210028378 CTAGAGATGGATAGTGGTGATGG - Intronic
920991584 1:210944839-210944861 CTGGAGATGAATAGTGGTGATGG - Intronic
921042400 1:211446352-211446374 TTGGAAATGGACAGTGGTGATGG + Intergenic
921149672 1:212389755-212389777 GTGGAGATGGATGGTGGTGATGG + Intronic
921218535 1:212956949-212956971 CTGGAGATGGATGGTGGTGATGG - Intronic
921621802 1:217333845-217333867 GGGGAGATGAATGGTGGTGATGG - Intergenic
921650030 1:217666646-217666668 CTGGAGATGAACAGTGGTGATGG - Intronic
922149358 1:222984713-222984735 TTGGAAATGGATGGTGGTGATGG - Intronic
922295004 1:224242210-224242232 CTGGAGATGAGTAGTGGTGATGG + Intronic
922332973 1:224594061-224594083 CTGGAGATGGATAGTGGTGATGG + Intronic
922337314 1:224628362-224628384 CTGGAGATGGATGGTGGTGATGG - Intronic
922667526 1:227485425-227485447 TTGAAAATGGATAGTGGTGATGG + Intergenic
922923601 1:229329508-229329530 TTGGAGATGAAGAATCATCATGG + Intronic
923070973 1:230564134-230564156 CAGGAGATGAATGGTGGTGAGGG + Intergenic
923137725 1:231133148-231133170 CTGCAGATGGATGGTGATGACGG + Intergenic
923325541 1:232877135-232877157 CTGGAGATGGATGGTGCTGATGG - Intergenic
923366551 1:233267447-233267469 CTGGAGATGGATGGTGGTGACGG - Intronic
923409932 1:233697343-233697365 CTGGAGATGGATAGAGATGATGG + Intergenic
923487123 1:234444019-234444041 TTGGAGATGGATGATGGTGATGG + Intronic
923541988 1:234894997-234895019 CTGGAGATGGATGGTGGTGATGG + Intergenic
923668934 1:236023518-236023540 CTGGAGATGAACAGTGGTGATGG + Intronic
923689924 1:236182253-236182275 CTAGAGATGGATGGTGATGATGG - Intronic
923701350 1:236303139-236303161 CTGGGAATGAATAGTGGTGATGG + Intergenic
923720569 1:236463653-236463675 CTGGAGGTGAATGGTGGTGACGG - Intronic
923763816 1:236873355-236873377 TTGGACGTAAATAGTGATGATGG + Intronic
924210373 1:241759803-241759825 CTGGAGATGGATGGTGATGAAGG - Intronic
924244149 1:242065382-242065404 TTGGAAATGGATAGTGGTGATGG - Intergenic
924327276 1:242908626-242908648 CTGGAAATGAATAGTGGTGATGG + Intergenic
924868904 1:248018728-248018750 CTGGAGATGCATGGTGGTGATGG - Intronic
924904264 1:248434585-248434607 CTGGAGATGGATGGTGGTGATGG + Intergenic
924923625 1:248657462-248657484 CTGGAGATGGATGGTGGTGATGG - Intergenic
1062852250 10:753752-753774 GTGGAGATGAATATTGGTGGTGG + Intergenic
1063135820 10:3215288-3215310 CTGGAGGTGGATGGTGATGATGG - Intergenic
1063475425 10:6324387-6324409 TTGGAGATGGATGGTGTTGATGG + Intergenic
1063499509 10:6540312-6540334 CTGGAGATGGATGGTGGTGATGG - Intronic
1063550972 10:7032785-7032807 CTGGAGATGGATGGTGGTGATGG + Intergenic
1063571403 10:7217232-7217254 CTGGAGATGGATGGTGGTGATGG + Intronic
1064467756 10:15601482-15601504 CTGGAGATGGACAGTGCTGATGG + Intronic
1064704126 10:18053103-18053125 CTGGAGATGGATGGTGGTGATGG + Intergenic
1064952286 10:20866281-20866303 CTGGAGATGGATGGTGGTGAGGG + Intronic
1065018647 10:21484277-21484299 TTGGAGATGGATGGTGGTAATGG + Intergenic
1065067359 10:21983836-21983858 TTAGAAATGAATAATGAAGATGG + Intronic
1065425221 10:25595797-25595819 CTGGAATTAAATAGTGATGATGG + Intronic
1065488592 10:26258460-26258482 CTGGAGATGAATATTGATGATGG - Intronic
1065633404 10:27705957-27705979 CTGGAGATGGATAGTGGTAATGG - Intronic
1065810703 10:29440568-29440590 CTGGAGATGGATGGTGGTGATGG - Intergenic
1065828640 10:29595053-29595075 TTGCAGATGTAGAGTGGTGAAGG - Intronic
1065873009 10:29972181-29972203 GTGGAGATGGATGGTGGTGATGG - Intergenic
1065885992 10:30077514-30077536 CTGGAAATGAATAGTCATGATGG - Intronic
1065905438 10:30246951-30246973 CTGGAGATGGATAGTGGTGATGG + Intergenic
1066070337 10:31802246-31802268 CTAGAGATGGATGGTGATGATGG + Intergenic
1066075835 10:31875765-31875787 CTGGAGATGGATGGTGGTGATGG - Intronic
1066079796 10:31919287-31919309 CTGGAGATGAAGGGTGGTGATGG + Intronic
1066673982 10:37868973-37868995 CTGGAACTAAATAGTGATGATGG - Intergenic
1067237567 10:44464154-44464176 CTGGAAATGAATGGTGGTGATGG - Intergenic
1067546763 10:47197429-47197451 ATGGAGATGGATGGTGGTGATGG - Intergenic
1067678827 10:48412868-48412890 CTGGAGATGGATGGTGGTGATGG - Intronic
1067684990 10:48461044-48461066 CTGGAGATGGATAGTGCTGATGG + Intronic
1067717542 10:48701006-48701028 ATGGAGCTGGATAGTGCTGATGG - Intronic
1067800732 10:49357182-49357204 CTGGAGATGAATGTTGTTGATGG + Intergenic
1068199614 10:53765998-53766020 TTGGGGATGAAAAGCAATGATGG + Intergenic
1068223444 10:54074268-54074290 TTAGAGATGGATAGTGATGATGG - Intronic
1068574705 10:58672167-58672189 CTGGAGATGGATGGTGATGATGG - Intronic
1068684001 10:59850248-59850270 CTGGAGATGGACAGTGCTGACGG + Intronic
1068850908 10:61739544-61739566 TTTGAAATGAAAAGTGATTAGGG + Intronic
1068888735 10:62126250-62126272 CTGGAGATGGACAGTGGTGATGG + Intergenic
1068958138 10:62839653-62839675 CTGGAGATGGATGGTGATGATGG - Intronic
1069218422 10:65852268-65852290 GGGAAGATGAATAGTGTTGAAGG + Intergenic
1069399164 10:68023614-68023636 CTAGAGATGAATGGTGATGATGG + Intronic
1069675374 10:70242860-70242882 CTGGAGATGGATGGTGGTGATGG + Intergenic
1069707223 10:70466604-70466626 CTGGAGATGGATGGTGCTGATGG - Intergenic
1069965572 10:72112474-72112496 CTGGAGATGGATAGTGATGATGG + Intronic
1070058422 10:72957254-72957276 CTGGAGATGGATAGTGGTGATGG - Intergenic
1070065915 10:73034369-73034391 CTGGAAATGGATAGTGCTGATGG - Intronic
1070228382 10:74536575-74536597 CTGGAGAGGAATAGTGGTGATGG - Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070423983 10:76267404-76267426 TTGGAAATAAATAGTTGTGATGG - Intronic
1070532804 10:77351970-77351992 TTGGACAGGAATATTTATGAGGG + Intronic
1071308583 10:84322331-84322353 CTGGAGATGGATGGTGGTGATGG + Intergenic
1071517006 10:86304666-86304688 TTGGAGATCGACAGAGATGATGG - Intronic
1071519538 10:86320595-86320617 CTGGAGATGGATGGTGGTGATGG + Intronic
1071585546 10:86817164-86817186 TGGGAGATGGATGGTGGTGATGG - Intronic
1072631132 10:97147332-97147354 TTGGGTATAGATAGTGATGATGG + Intronic
1072712898 10:97729201-97729223 ATGGAGATGGATGGTGGTGATGG - Intergenic
1072809546 10:98448375-98448397 GTGGAGATGGATGGTGGTGATGG - Intergenic
1072906584 10:99459613-99459635 CTGGAGATGGATGGTGGTGATGG - Intergenic
1073399399 10:103244400-103244422 CTGGAGATGGATGGTGGTGATGG - Intergenic
1073564987 10:104527344-104527366 CTGGAGATGAATAGTAATAATGG + Intergenic
1073911287 10:108347889-108347911 TTGGAGATGAATAGTAACAATGG + Intergenic
1074712443 10:116188526-116188548 CTGGAGATGGATGGTGGTGATGG + Intronic
1074767410 10:116709760-116709782 TTGGAAATAGATAGTGGTGATGG + Intronic
1074958966 10:118421489-118421511 TGAAAGATGAATAATGATGAAGG - Intergenic
1075887958 10:125918191-125918213 CTGGAGATGGATGGTGGTGATGG + Intronic
1075948056 10:126454817-126454839 CAGGAGCTGCATAGTGATGATGG + Intronic
1075952272 10:126490536-126490558 CTGGAGATGGATGGTGATGATGG + Intronic
1075971409 10:126657236-126657258 CTGGAGATGGTTAGTGGTGATGG - Intronic
1077387809 11:2280162-2280184 CTGGAGATGGATGGTGATAATGG + Intergenic
1077826577 11:5816236-5816258 CTGGAGATGGAGAGTGGTGATGG + Intronic
1078189563 11:9081261-9081283 AGGGAGATGAATAGTGGTGATGG - Intronic
1078241266 11:9532687-9532709 CTGGAGATGGATGGTGGTGATGG - Intergenic
1078657701 11:13257432-13257454 ATGGAGATGGATGGTGGTGATGG + Intergenic
1078764375 11:14280222-14280244 CTGGAGATGGATGGCGATGATGG - Intronic
1078882888 11:15470207-15470229 CTGGAGATGAATGGTGGTTAAGG - Intergenic
1079058966 11:17230995-17231017 CTGGAGATGGATGGTGGTGATGG - Intronic
1079088847 11:17466573-17466595 CTGGAGATGGATAGTGGTGATGG + Intronic
1079155361 11:17941306-17941328 CTGGAGATGGATGGTGGTGATGG - Intronic
1079250599 11:18784556-18784578 CTGGAGATGGACAGTGGTGATGG + Intronic
1079368271 11:19828275-19828297 CTGGAGATAAATAATGGTGATGG - Intronic
1079415487 11:20231721-20231743 CTGGAGATGGATAGCAATGATGG + Intergenic
1079503571 11:21129821-21129843 TTGGAGATGGATGGTGGTGATGG + Intronic
1079793466 11:24768657-24768679 TTCGTGATGATTAGTGATGTTGG - Intronic
1080272104 11:30461278-30461300 CTGGAGATGGATGGTGGTGATGG + Intronic
1080288883 11:30648328-30648350 CTGGAGATGGATAGTGGTGATGG - Intergenic
1080809288 11:35686874-35686896 CTAGAGATGGACAGTGATGATGG - Intronic
1080858004 11:36129076-36129098 GTAGAGAGGAATAATGATGAGGG + Intronic
1080869380 11:36223933-36223955 CTGGAGCTGGATAGTGGTGATGG + Intronic
1081052540 11:38362498-38362520 ATGGAGATGAATGGTGGTGATGG - Intergenic
1081114242 11:39178654-39178676 TTGACTATGAATAGTGATGTAGG + Intergenic
1082063077 11:47877110-47877132 CTGGAGATGGATGGTGGTGATGG + Intergenic
1082626125 11:55488377-55488399 TTGGAGATGAGCAGTGATGATGG - Intergenic
1082642090 11:55674741-55674763 CTGGAGCTGGATGGTGATGATGG - Intergenic
1082891998 11:58149544-58149566 CTGGAGAAGGATAGTGGTGATGG - Intronic
1083030623 11:59588601-59588623 TTGGAGATGGAGGGTGGTGATGG + Intronic
1083206919 11:61156814-61156836 CTGGAGAGGAATGGTGGTGATGG - Intronic
1083963719 11:66029687-66029709 TTGGAGATGAAAAGTAATGATGG + Intergenic
1084539972 11:69780131-69780153 CTGGAGATGGATGGTGGTGATGG - Intergenic
1084616242 11:70237958-70237980 CTGGAGATGGATGGTGGTGATGG - Intergenic
1084619554 11:70260179-70260201 CTGGAGATGGATGGTGGTGATGG - Intergenic
1084676095 11:70635619-70635641 CTGGAGATGGATGGTGGTGATGG + Intronic
1084704512 11:70808071-70808093 CTGGAGATGGATGGTGGTGATGG + Intronic
1085064946 11:73486282-73486304 CTGGAGATGGATGGTGGTGATGG - Intronic
1085250965 11:75143662-75143684 CTGGAGATGGATGGTGAGGATGG + Intronic
1085367873 11:75969074-75969096 CTGGAGATGGATGGTGATAATGG - Intronic
1085436997 11:76514672-76514694 TTGGAGATAGATGGTGTTGATGG - Intronic
1085573030 11:77576090-77576112 CTGTAGATGGATAGTGGTGATGG - Intronic
1085587605 11:77725143-77725165 CTGGAGATGGATGGTGGTGATGG + Intronic
1085614393 11:77984609-77984631 CTGGAGATGGATGGTGGTGATGG + Intronic
1085656175 11:78317197-78317219 TTGGAGATGGATGGTGGTAATGG + Intronic
1085660177 11:78357065-78357087 CTGGAGATGGATGGTGGTGATGG + Intronic
1085991043 11:81844884-81844906 TTGGAGATGAATAGTGCATGGGG + Intergenic
1086130054 11:83392216-83392238 CTGGAGATGAATAATGGTGATGG - Intergenic
1086295305 11:85360475-85360497 TTGTAGAAGAATAGTAGTGAAGG - Intronic
1086753321 11:90527187-90527209 TTGGAGATAGATGGTGATGATGG + Intergenic
1086806835 11:91254350-91254372 CTGGAGATAGAGAGTGATGATGG - Intergenic
1087269215 11:96094013-96094035 TTAGAGGATAATAGTGATGAAGG - Intronic
1087745519 11:101941224-101941246 TTGGAGACAGATAATGATGATGG - Intronic
1088204912 11:107381140-107381162 CTGGAAATGGATAGTGGTGATGG + Intronic
1088475007 11:110226538-110226560 CTGGAGATGGATGGTGGTGATGG + Intronic
1088522994 11:110719308-110719330 TTGGAAATGGATGGTGGTGATGG + Intergenic
1088741815 11:112773790-112773812 TTGGAGATAAGGAGTGATGATGG + Intergenic
1088791989 11:113234370-113234392 CTGGAGATGGATGGTGGTGATGG - Intronic
1088939189 11:114436536-114436558 CTGGAGATAAATGGTGGTGATGG + Intronic
1088998521 11:115027462-115027484 ATGGAGATGGATGGTGGTGATGG + Intergenic
1089084606 11:115806392-115806414 TTGGAAATAAATAAAGATGAAGG + Intergenic
1089119316 11:116122432-116122454 ACGGAGATGGATGGTGATGATGG + Intergenic
1089347285 11:117798536-117798558 TTGGAAATGGTAAGTGATGATGG - Intronic
1089402614 11:118173083-118173105 CTGGAGGTGAGGAGTGATGAGGG - Intronic
1089767706 11:120780246-120780268 CTGGAGATAGATAGTGGTGATGG - Intronic
1089906946 11:122049709-122049731 CTGGAGATGAATAGTGGTGATGG - Intergenic
1090129028 11:124120101-124120123 TTGGAGATGAAGGGTGGTGATGG - Intronic
1090130477 11:124136544-124136566 TTAGAGATGAGTAGAAATGACGG - Intronic
1090171279 11:124607252-124607274 TTGAATATGAGTAGTGATAATGG - Intergenic
1090218775 11:124996627-124996649 CTGGAGATGGATGGTGGTGATGG - Intronic
1090285922 11:125499102-125499124 CTGTAGATGAATAGTGGTGGTGG - Exonic
1090464027 11:126917363-126917385 CTGGAAATAAATAGTGGTGATGG + Intronic
1090567791 11:128014785-128014807 TTGGAGCTGAATATTTAGGACGG - Intergenic
1090577265 11:128119096-128119118 TTGGAGATGGATAGCGGTAATGG - Intergenic
1090924245 11:131235628-131235650 TATGTGATGAATAGTGAAGAGGG - Intergenic
1091405402 12:206159-206181 CTGGAGATGAATGGTGGTGATGG - Intronic
1091568983 12:1668071-1668093 CTGTAGATGAATGGTGGTGATGG + Intergenic
1091608641 12:1982299-1982321 CTGGAGATGGATAGCGGTGATGG - Intronic
1091747421 12:3001322-3001344 CTGGAAATGGATGGTGATGATGG - Intronic
1091839123 12:3606749-3606771 CTGGAGATGGATGGTGGTGATGG - Intronic
1091897167 12:4114923-4114945 CTGGAGATGAACGGTGGTGATGG - Intergenic
1091909881 12:4221023-4221045 TTGGAAATAGATAGTGGTGATGG - Intergenic
1092130239 12:6106498-6106520 CTGGAGATGGATGGTGGTGATGG + Intronic
1092611070 12:10173953-10173975 CTGGAGATGGATGGTGGTGATGG - Intronic
1093550998 12:20411222-20411244 CTGAAGATGGATATTGATGATGG - Intronic
1093808323 12:23463859-23463881 TTGGAGATGAATGGTGATGATGG + Intergenic
1094130185 12:27066540-27066562 TGTGAGGTGAAGAGTGATGAAGG - Intergenic
1094179648 12:27578552-27578574 TGTGAGGTGAAGAGTGATGAAGG - Intronic
1094572382 12:31652369-31652391 TAGGAGATATATGGTGATGAAGG - Intronic
1095189544 12:39240790-39240812 TTGGAAAACAATAGAGATGATGG - Intergenic
1095198376 12:39352115-39352137 CTGGAGATGGATGGTGGTGACGG - Intronic
1095265562 12:40153229-40153251 CTGGAGCTGGATGGTGATGACGG - Intergenic
1095422123 12:42035315-42035337 TTGGAGATGGATGGTGCTGATGG + Intergenic
1095577102 12:43752791-43752813 CTGGAGATGAATGGTGGTGAGGG + Intronic
1095621834 12:44265521-44265543 TAGAAGGTGAATAGTGAAGATGG + Intronic
1095684639 12:45019051-45019073 CTGGAGATGAATGGTCGTGATGG + Intronic
1095711041 12:45288321-45288343 CTGGAGATGGATGGTGGTGATGG - Intronic
1095748307 12:45683771-45683793 TTGGACATGAATGGTGGTGATGG + Intergenic
1095766165 12:45898343-45898365 GTGGAGATGGATAGTGGTGATGG + Intronic
1096007045 12:48182172-48182194 TTGGTGATGAAGAGTGAGGCTGG - Intergenic
1096168159 12:49442832-49442854 CTGGACATGAATGGTGATAATGG - Intronic
1096196140 12:49649975-49649997 TTGGAGAATAAAAGGGATGAGGG - Intronic
1096394294 12:51254080-51254102 CTGGAGATGCATAGTGGTGTTGG + Intronic
1096756896 12:53807190-53807212 CTGGAGATGGATGGTGTTGATGG - Intergenic
1096981760 12:55732130-55732152 GTGGAGATGGATGGTGCTGATGG + Intergenic
1097152919 12:56992793-56992815 ATGGAGATAAATGGTGCTGATGG + Intergenic
1097411711 12:59262493-59262515 CTGGAGATGGATGGTGCTGATGG + Intergenic
1097609280 12:61798477-61798499 CTGGAGATAGATGGTGATGATGG - Intronic
1097633020 12:62087207-62087229 ATGGAGATGGATAGTCATGATGG + Intronic
1098253971 12:68597840-68597862 CTGGAGATGAATAGTGGTGATGG - Intergenic
1098323838 12:69279684-69279706 CTGGAAATGGATAGTGGTGATGG - Intergenic
1098385317 12:69912391-69912413 CTGGAGATGGATGGTGGTGATGG - Intronic
1098682489 12:73374210-73374232 CTGGAGATGAATAGTGGTGATGG - Intergenic
1098932293 12:76433514-76433536 CTGAAAATTAATAGTGATGAAGG + Intronic
1099198874 12:79652153-79652175 CTGGAGATGGATAATGGTGATGG + Intronic
1099371602 12:81837855-81837877 TTGGTGATGGATGGTGGTGATGG + Intergenic
1099964046 12:89426298-89426320 CTGGAAATAGATAGTGATGATGG + Intronic
1099993858 12:89755434-89755456 CTGGAGATGGATGGTGATGGTGG + Intergenic
1100107173 12:91190087-91190109 TTGGAAATAGATAGTGGTGATGG - Intergenic
1100128984 12:91466632-91466654 TTGTAGATGATTAGAGATAAAGG - Intergenic
1100276119 12:93073432-93073454 TTAGAGATGGATGGTGGTGATGG - Intergenic
1100376579 12:94021696-94021718 CTGGAGATGGATGATGATGATGG + Intergenic
1100476229 12:94938189-94938211 CTGGAAATGAACAGTGGTGATGG + Intronic
1100996770 12:100309299-100309321 GTGGAGATGTATGGTGGTGATGG - Intronic
1101040950 12:100754969-100754991 TTGGAACTGGGTAGTGATGATGG + Intronic
1101078547 12:101156867-101156889 TTCAAGATGAATTGTGATGTTGG + Exonic
1101136254 12:101746361-101746383 TTAGAAATGAGTAGTGCTGATGG - Exonic
1101156292 12:101930674-101930696 CTGGAGATGGATGGTGGTGATGG - Intronic
1101164782 12:102017896-102017918 CAGGAGATGGATGGTGATGATGG - Intronic
1101210749 12:102533242-102533264 CTGGAGATGGATGGTGGTGATGG + Intergenic
1101321925 12:103680193-103680215 TTGGAGAAGGATGGTAATGATGG + Intronic
1101766035 12:107700273-107700295 CTGGAGATGCATTGTGGTGATGG - Intronic
1101934241 12:109044276-109044298 CTGGAGATGGATGGTGGTGATGG + Intronic
1102185499 12:110944861-110944883 TTGGAGATGGATGGTGGTGATGG - Intergenic
1102246015 12:111356317-111356339 CTGGAGATGGAGGGTGATGATGG - Intergenic
1102358327 12:112260042-112260064 GTGGAGATGGATGGTGGTGATGG - Intronic
1103048533 12:117759564-117759586 CTGGAGATGGATGGTGGTGATGG - Intronic
1103064846 12:117888886-117888908 TTTGAGATGGATAGTGGTGATGG + Intronic
1103352380 12:120293696-120293718 CTGGAGGTAAGTAGTGATGATGG - Intergenic
1103584530 12:121942181-121942203 TTGGAACTGGATAGAGATGATGG - Intronic
1104406639 12:128523325-128523347 CTGGAGATGGATGGTGATGATGG + Intronic
1104412540 12:128571480-128571502 TTGGAGGTGGATGGTGGTGATGG - Intronic
1104414408 12:128585955-128585977 CTGGAGATGGATGGTGGTGACGG + Intronic
1104618483 12:130291134-130291156 CTGGAGATGGATGGTGGTGATGG - Intergenic
1105401627 13:20101170-20101192 CTGCAGATGGATAGTGGTGATGG + Intergenic
1105405940 13:20132831-20132853 CTGGAGATGGATGGTGATGATGG - Intergenic
1105431070 13:20338581-20338603 CTGGAGATGGATGGTGATGATGG + Intergenic
1106006586 13:25775693-25775715 TTGGAAACGATTAGTCATGATGG - Intronic
1106063624 13:26321445-26321467 CTGGAGATGGATGGTGGTGATGG + Intronic
1106163741 13:27223552-27223574 CTGGAGATGCATGGTGGTGATGG + Intergenic
1106198119 13:27511241-27511263 CTGGAGATGGATGGTAATGATGG - Intergenic
1106198623 13:27516307-27516329 CTGGAGATGGATGGTGGTGATGG + Intergenic
1106355909 13:28982939-28982961 CTGGAGATGGATGGTGGTGATGG + Intronic
1106425239 13:29622507-29622529 CTGGAGATGAATGGTGGTAATGG + Intergenic
1106699051 13:32209217-32209239 CTGGGGATAAATAGTGGTGATGG + Intronic
1106806972 13:33319442-33319464 CTGGAATTAAATAGTGATGATGG + Intronic
1106812545 13:33374341-33374363 CTGGAGATGGATAGTGGTGATGG + Intergenic
1106913706 13:34489406-34489428 CTGGAGATGGGTAGTGATGTCGG - Intergenic
1107353665 13:39542939-39542961 CTGGAAATGGATAGTGGTGATGG - Intronic
1107385629 13:39905365-39905387 CTGGAGATGGATGGTGGTGATGG - Intergenic
1107829374 13:44360699-44360721 CTGGAGATGAATGTTGGTGATGG + Intergenic
1108001452 13:45909012-45909034 TTGGAGATGGATGGTGGTGATGG + Intergenic
1108093023 13:46869960-46869982 TTGGAAATAGATAGTGGTGATGG + Intronic
1108177460 13:47807871-47807893 AAGGAGATGAAAACTGATGAAGG + Intergenic
1108376671 13:49820453-49820475 TTGTAGATGGAAAGTGAAGAAGG + Intergenic
1108416094 13:50199617-50199639 TTGGAGATGGATGGTGGGGATGG - Intronic
1108432726 13:50370551-50370573 CTGGAGACGTATAGTGGTGATGG + Intronic
1108459149 13:50647687-50647709 CTGGAGATGAATGGTGGTGATGG - Intronic
1108580503 13:51824449-51824471 TTGGAAATAGATAGTGGTGATGG - Intergenic
1108953764 13:56124206-56124228 TTGGAAATAGATAGTGGTGATGG - Intergenic
1109585294 13:64393933-64393955 TTGCAGATTAACAGTGATTAAGG - Intergenic
1109684285 13:65793443-65793465 TTGGAAATTGATAGTGGTGATGG + Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109997084 13:70142723-70142745 TTGGAGAAGAATACTTATAAAGG + Intergenic
1110048684 13:70864890-70864912 CTGGAGATGGATAATGGTGATGG - Intergenic
1110178785 13:72590517-72590539 CTGGAAATGGATAGTGGTGATGG + Intergenic
1110666482 13:78123588-78123610 GTGGAGAAGAATGGTGAAGAAGG + Intergenic
1111191379 13:84811752-84811774 AAGGTGATGACTAGTGATGAAGG + Intergenic
1112022428 13:95383321-95383343 CTGGAGATGGATGGTGGTGATGG + Intergenic
1112025659 13:95408683-95408705 CTATAGATGAATAGTGGTGATGG + Intergenic
1112100511 13:96183834-96183856 CTGGAGATAAATGGTGGTGATGG + Intronic
1112264187 13:97907677-97907699 CTGGAGATGGATGGTGATGATGG + Intergenic
1112386927 13:98948629-98948651 TTGGAGATGGATGGTGGTGATGG - Intronic
1112395204 13:99023540-99023562 CTGGAGATGAATGGTGATGATGG + Intronic
1112441839 13:99430056-99430078 CTGGAGATGGATGGTGGTGATGG - Intergenic
1112533768 13:100229969-100229991 CTGGAGATGAATAGTTCTGTTGG + Intronic
1112588986 13:100746627-100746649 CTGGAGATGGATAGTGGTGATGG + Intergenic
1112675953 13:101701901-101701923 CTAGAGATGAATGGTGGTGATGG + Intronic
1112741131 13:102473699-102473721 TTGGAGATGGATAGTGGTGAGGG + Intergenic
1112772765 13:102809741-102809763 TTGGAGATGAATAGTGATGATGG - Intronic
1112844043 13:103616064-103616086 GTGGAGATCAAGAGTGATGAGGG + Intergenic
1113529944 13:111016449-111016471 CTGGAGATGGACAGTGGTGATGG + Intergenic
1113556475 13:111239636-111239658 GTGGAGATGGTTAATGATGAGGG + Intronic
1113717875 13:112526533-112526555 TTGGGGATGGGTGGTGATGATGG - Intronic
1113717910 13:112526767-112526789 TTGGGGATGGGTGGTGATGATGG - Intronic
1114972058 14:28043728-28043750 TTGGAGATGGATGATGGTGATGG + Intergenic
1115194700 14:30783960-30783982 ATGGAGATGAATGGTGGTGAGGG - Intergenic
1115273551 14:31581314-31581336 CTGGGGATGAATAGTGAGGATGG - Intronic
1115476083 14:33814155-33814177 TTGGATATGGAGAGAGATGATGG + Intergenic
1115796784 14:36945778-36945800 CTGGAGATGAATGGTGGAGATGG + Intronic
1116348628 14:43829601-43829623 TTGAATATGAATGGTGAAGAAGG + Intergenic
1117417899 14:55514703-55514725 TCGGAGATGGATAGTGGTGGTGG + Intergenic
1117517334 14:56514813-56514835 CTAGAGATGGATAGTGGTGATGG + Intronic
1117554583 14:56871105-56871127 ATGGAGATGGATGGTGGTGATGG + Intergenic
1117758662 14:59003247-59003269 CTGGAGATGGATGGTGGTGATGG + Intergenic
1117803488 14:59467301-59467323 TTGGAGATGGGGAGTGAAGAAGG + Intronic
1117868381 14:60172744-60172766 TTGGTGAGGAATCCTGATGAGGG - Intergenic
1117989018 14:61415762-61415784 CTGGAGATGGATGGTGGTGATGG - Intronic
1118398658 14:65359423-65359445 CTGGAGATGTATGGTGGTGATGG - Intergenic
1118546257 14:66892799-66892821 CTGGAGATGGACAGTGGTGATGG + Intronic
1118789687 14:69078811-69078833 CTAGAGATGGATAGTGGTGATGG + Intronic
1118799772 14:69179208-69179230 CTGGAGATGGATGGTGGTGACGG - Intergenic
1118824647 14:69369143-69369165 TTGCAGATGATAACTGATGAGGG + Intergenic
1118996075 14:70837517-70837539 CTGGAGATGGATGGTGGTGATGG + Intergenic
1119059782 14:71462770-71462792 GTGGAAATGAAAAGTGATCAAGG + Intronic
1119134459 14:72204186-72204208 TTAGAAATAAATAGTGGTGATGG - Intronic
1119188232 14:72660109-72660131 CTAGAGATGGATGGTGATGATGG + Intronic
1119801580 14:77450035-77450057 CTGGAGATGGATAGTGGTGATGG - Intronic
1120086800 14:80284810-80284832 CTGGAGATGGTTAGTGGTGATGG - Intronic
1120737677 14:88072027-88072049 ATGGAGATTAAAAGTGATGAGGG + Intergenic
1120995472 14:90414980-90415002 GTGGAGATGGATGGTGGTGATGG + Intergenic
1121032412 14:90670413-90670435 GTGGAAATAGATAGTGATGATGG + Intronic
1121058403 14:90880206-90880228 CTAGAGATGGATGGTGATGATGG - Intronic
1121081331 14:91110853-91110875 CTGGAGATGGTTAGTGATGATGG - Intronic
1121092352 14:91191360-91191382 CTGGAGATGAATGGGGGTGATGG + Intronic
1121092497 14:91192404-91192426 CTGGAGATGAATGGGGGTGATGG + Intronic
1121093225 14:91197469-91197491 CTGCAGATGGATGGTGATGATGG - Intronic
1121132855 14:91464367-91464389 CTGGAGATGAATAATGGTGATGG + Intronic
1121308303 14:92921253-92921275 CTGGAAATGGATAGTGATGATGG - Intergenic
1122020294 14:98832474-98832496 CTGGAGATGGATGGTGGTGATGG - Intergenic
1122146708 14:99693907-99693929 CTGGAGATGGATGGTGGTGATGG - Intronic
1122219256 14:100225613-100225635 CTGGAGATGGATGGTGATGATGG + Intergenic
1122583385 14:102786260-102786282 CTGGAGATGGATGGTGGTGATGG + Intronic
1122639251 14:103147791-103147813 CTGAAGATGGATGGTGATGATGG + Intergenic
1122676676 14:103420642-103420664 CTGGAAATGAATAGTGGTGATGG - Intronic
1122752563 14:103949075-103949097 CTGGAGATGGATGGTGGTGAAGG + Intronic
1122868949 14:104625397-104625419 CTGGAGATGGATGGTGGTGATGG + Intergenic
1122915965 14:104859134-104859156 GTGGAGATGAATGGTGGCGATGG - Intergenic
1122916056 14:104859493-104859515 GTGGAGATGAATGGTGGTGATGG - Intergenic
1122916101 14:104859686-104859708 GTGGAGATGAATGGTGGCGATGG - Intergenic
1122916126 14:104859788-104859810 GTGGAGATGAATGGTGGTGATGG - Intergenic
1122916152 14:104859892-104859914 GCGGAGATGAATGGTGGTGATGG - Intergenic
1122916205 14:104860148-104860170 GTGGAGATGAATGGTGGTGATGG - Intergenic
1122916702 14:104862552-104862574 CTGGAGATGGATGGTGGTGATGG - Intergenic
1202870195 14_GL000225v1_random:155860-155882 CTGGAGATGGATGGTGGTGATGG - Intergenic
1123685510 15:22794410-22794432 GTGGAGATGGATGGTGGTGATGG + Intronic
1123962642 15:25421622-25421644 TCAGAGATGGATAGTGGTGATGG + Intronic
1124230149 15:27937945-27937967 TTGGATATGAAAAGTGCTAATGG - Intronic
1124246811 15:28078290-28078312 CCAGAGATGAATAGTGATGAAGG - Intronic
1124357627 15:29008297-29008319 CTGGAGATGGATGGTCATGATGG + Intronic
1124486216 15:30119515-30119537 CTGGAAATGAATAGTGGTGATGG - Intergenic
1124541290 15:30588500-30588522 CTGGAAATGAATAGTGGTGATGG - Intergenic
1124547942 15:30650002-30650024 CTGGAAATGAATAGTGGTGATGG - Intronic
1124644681 15:31429497-31429519 GTGGAGATGGATAGTGGTAAAGG + Intronic
1124757368 15:32419087-32419109 CTGGAAATGAATAGTGGTGATGG + Intergenic
1124964033 15:34420012-34420034 CTGGAGATGGATGGTGGTGATGG + Intronic
1124980647 15:34566243-34566265 CTGGAGATGGATGGTGGTGATGG + Intronic
1125026832 15:35039070-35039092 CTGGAGATGGATGGTGGTGATGG - Intergenic
1125367024 15:38928489-38928511 TTGGATAGGAATGGTGATGCTGG + Intergenic
1125571509 15:40722576-40722598 CTGGAGATGAATAGTGGTGATGG + Intronic
1125865373 15:43042619-43042641 TTGGAGAAGGATGGTGGTGATGG + Intronic
1125871811 15:43109035-43109057 TTGGAGATGTGTAGTGGTAATGG + Intronic
1125873719 15:43125414-43125436 CTGGAGATGGATAGTAGTGATGG - Intronic
1125917129 15:43497791-43497813 CTGGAGATGGATGGTGGTGATGG + Intronic
1126646331 15:50878350-50878372 CTGGAGATGGATGGTGGTGATGG + Intergenic
1127146171 15:56026356-56026378 TTGAATAAGAATAGTGATGGTGG + Intergenic
1127266118 15:57363543-57363565 CTGGAGATGGATGGTGATGGTGG - Intergenic
1127315066 15:57787345-57787367 CTGGAGATGGATGGTGGTGATGG + Intergenic
1127960042 15:63884058-63884080 TTGGAGAACAAGAGAGATGAAGG + Intergenic
1128007206 15:64254294-64254316 CTGGAGATGGATGGTGGTGATGG + Intronic
1128165420 15:65460089-65460111 CTGGAAATGGATAGTGGTGATGG - Intronic
1128177429 15:65568260-65568282 GTGGAGATGGATGGTGATTATGG + Intronic
1128287279 15:66447798-66447820 CTGGAGATGGATGGTGGTGATGG - Intronic
1128299484 15:66556823-66556845 CTGGAGATGGATGGTGGTGATGG + Intronic
1128355601 15:66924291-66924313 TTGGAGATGTACGGTGGTGACGG - Intergenic
1128636662 15:69306765-69306787 ATGGAGATGGATGGTGGTGATGG - Intronic
1128681453 15:69655153-69655175 TTGCAGATGGATGGTGGTGATGG - Intergenic
1128914211 15:71545071-71545093 CTAGAAATGAATAGTGGTGATGG + Intronic
1129319422 15:74766033-74766055 CTGGAGATGGACAGTGGTGATGG + Intergenic
1129432540 15:75510794-75510816 CTGAAAATGAATAGTGGTGATGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129654201 15:77512312-77512334 CTGGAGATGAATGGTGGTGATGG + Intergenic
1129989081 15:79946189-79946211 TTGCAGATGAAAACTGTTGATGG + Intergenic
1130080822 15:80731949-80731971 CTAGAGATGAATGGTGGTGATGG - Intronic
1130981980 15:88818821-88818843 CTGGAGATGGATGGTGATAATGG + Intronic
1131238311 15:90716571-90716593 CTGGAGATGGATAGTGGTGATGG + Intergenic
1131471937 15:92705101-92705123 CTGGAGATGGATGGTGGTGATGG - Intronic
1131521220 15:93117453-93117475 CTGGAGATGGACAGTGGTGATGG + Intergenic
1132034577 15:98471612-98471634 CTGGACATGGATGGTGATGATGG - Intronic
1132060171 15:98685966-98685988 CTGGAGATGGACAGTGGTGATGG - Intronic
1132093905 15:98967920-98967942 CTGGAGATGGATGGTGGTGATGG + Intergenic
1132212999 15:100039440-100039462 TTTGAGATGAATCGAGGTGAAGG - Intronic
1132241128 15:100257836-100257858 TTGGAGGTGGATAGCGGTGATGG - Intronic
1132349560 15:101131093-101131115 CTGTGGATGAATAGTGGTGATGG + Intergenic
1132393391 15:101455036-101455058 CTGGAGATGGACAGTGGTGATGG + Intronic
1133168229 16:3964117-3964139 CTGGGGAGGAGTAGTGATGATGG + Exonic
1133210856 16:4262738-4262760 CTGGAGATGAATGATGAAGAGGG - Intronic
1133388975 16:5393798-5393820 CTGGAGATGGATGGTGGTGATGG - Intergenic
1133654935 16:7852111-7852133 CTGGAGATGGATGGTGGTGATGG - Intergenic
1133723764 16:8518758-8518780 TTTGAGATGGATGGTGGTGATGG + Intergenic
1133986408 16:10672072-10672094 CTGGAGATGGATTGTGGTGATGG + Intronic
1134101935 16:11458668-11458690 CTGGAGATAAGTAGTGGTGATGG + Intronic
1134535357 16:15022085-15022107 TTAGATATGATTAGTGATGAGGG + Intronic
1134569647 16:15280337-15280359 TTGGAGGTGAATAGAGAGAATGG + Intergenic
1134732732 16:16475712-16475734 TTGGAGGTGAATAGAGAGAATGG - Intergenic
1134759894 16:16705050-16705072 CTGGAGATGGATGGTGGTGATGG - Intergenic
1134810670 16:17164451-17164473 CTGGAGATGGATATTGGTGATGG - Intronic
1134934710 16:18236256-18236278 TTGGAGGTGAATAGAGAGAATGG + Intergenic
1134986178 16:18654155-18654177 CTGGAGATGGATGGTGGTGATGG + Intergenic
1135067838 16:19325444-19325466 CTGGAAATGGATAGTGGTGATGG + Intergenic
1135073428 16:19372323-19372345 TTGGAGATAGCTAGGGATGATGG - Intergenic
1135510535 16:23079125-23079147 GTAGAGATGGATAGTGATAATGG + Intronic
1135535805 16:23293561-23293583 CTGGAGATGGATAGTGGTGATGG + Intronic
1135583184 16:23645482-23645504 TTGGAAATGGATAGTGGAGATGG - Intronic
1135759440 16:25125499-25125521 TTGGAGAGGGATAGGGAAGAGGG - Intronic
1136094113 16:27942012-27942034 CTGGAGGTAAATGGTGATGATGG + Intronic
1137267060 16:46877779-46877801 CTGGAGATGAACAGTGGTTATGG - Intergenic
1137386733 16:48048978-48049000 TGGGAGATGATTAGGCATGAGGG + Intergenic
1137912743 16:52394778-52394800 CTGGAGATGGATGGTGGTGATGG + Intergenic
1137980983 16:53069353-53069375 CTGGAGATGGATAGTGGTGATGG - Intronic
1137981403 16:53073059-53073081 CTAGAGATGGATAGTGGTGATGG - Intronic
1138052103 16:53790206-53790228 TTGAAGATGGATAGTGGTGATGG - Intronic
1138085863 16:54133263-54133285 TTGGAGATGTATAGTGGTGATGG - Intergenic
1138133444 16:54501431-54501453 CTGGAGGTGGATAGTGGTGACGG - Intergenic
1138357812 16:56398943-56398965 CTGGAGATAGATGGTGATGAAGG + Intronic
1138817005 16:60214189-60214211 ATAGAGTTTAATAGTGATGATGG + Intergenic
1139024925 16:62804903-62804925 TTCCAGATGATTAGTGATGTTGG + Intergenic
1139141744 16:64272422-64272444 ATGGAGATGGATGGTGCTGATGG + Intergenic
1139220433 16:65176277-65176299 CTGAACATGGATAGTGATGATGG + Intergenic
1139370454 16:66465586-66465608 CTGGAGATGGATAGTGTTGATGG - Intronic
1139671634 16:68496290-68496312 CTGGAGATGAATGGTCATGACGG + Intergenic
1139679108 16:68546338-68546360 TTGAAGATGGGTAGTGGTGATGG - Intronic
1139860689 16:70018704-70018726 TTAGATATGATTAGTGATGAGGG - Intergenic
1140825708 16:78704019-78704041 TTGGAGATGGATAGGGGTGATGG - Intronic
1140911479 16:79457041-79457063 TTGAAGATTAATAGAGATGGTGG + Intergenic
1140943795 16:79748653-79748675 ATGCAGTTAAATAGTGATGATGG + Intergenic
1141172243 16:81698689-81698711 CTGGAGATGAACGGTGGTGATGG - Intronic
1141196181 16:81863127-81863149 CTGGAGATGGATGGTGGTGACGG - Intronic
1141341413 16:83207168-83207190 CTGGAGATGGATGGGGATGATGG - Intronic
1142493089 17:291080-291102 GTGGAGATGAACACTGAAGATGG + Intronic
1142726176 17:1816060-1816082 TTGGAAATGAATAGTGCTGATGG - Intronic
1142732532 17:1870549-1870571 CTGAAGATGGATGGTGATGATGG - Intronic
1143278916 17:5735605-5735627 CTGGAGATGGATGGTGATGATGG + Intergenic
1143607687 17:7999007-7999029 CTGGAGATGGACAGTGGTGATGG + Intergenic
1143759658 17:9091801-9091823 CTGGAGACGGATGGTGATGATGG - Intronic
1143861380 17:9893280-9893302 CTGGAGATGGATGGTGGTGACGG - Intergenic
1143914545 17:10279654-10279676 CTGGAGCTGAATGGTGGTGATGG - Intergenic
1144132594 17:12261014-12261036 CTGGAGATGGATGGTGCTGATGG - Intergenic
1144257849 17:13487225-13487247 CTGGAAATGAATATTGGTGATGG + Intergenic
1144366107 17:14546374-14546396 CTGGAGATAAATAGTGATGATGG - Intergenic
1144569785 17:16389795-16389817 CTGGAGATGGATGGTGGTGATGG + Intergenic
1144716520 17:17439860-17439882 CTGGAGATGAATGGTGGTGATGG + Intergenic
1144887008 17:18470219-18470241 CTGGAGATGGATGGTGGTGATGG - Intergenic
1144963573 17:19061168-19061190 CTGGAGATAAATAATGGTGATGG + Intergenic
1144964117 17:19064872-19064894 CTGGAGATAAATAATGGTGATGG - Intergenic
1144971586 17:19113358-19113380 CTGGAGATAAATAATGGTGATGG - Intergenic
1144983849 17:19187272-19187294 CTGGAGATAAATAATGGTGATGG + Intergenic
1144984376 17:19190967-19190989 CTGGAGATAAATAATGGTGATGG - Intergenic
1145105046 17:20108100-20108122 CTGGAGATGGATGGTGGTGATGG + Intronic
1145145208 17:20474076-20474098 CTGGAGATGGATGGTGGTGATGG + Intergenic
1145361995 17:22219898-22219920 CTGGAGATGGATGGTGGTGATGG + Intergenic
1145715450 17:27015426-27015448 CTGGAAATACATAGTGATGATGG + Intergenic
1145854498 17:28140335-28140357 CTGGAAATGGATAGTGCTGATGG + Intronic
1145893764 17:28438972-28438994 ATAGAGATGGATAGTGGTGATGG - Intergenic
1146010369 17:29189596-29189618 CTGGAAATGGATAGTGGTGATGG + Intergenic
1146224883 17:31057002-31057024 CTGGAGATGGATGGTGGTGATGG + Intergenic
1146316495 17:31811423-31811445 ATGGAGATGAACAGTGGTGACGG + Intergenic
1146353729 17:32117294-32117316 CTGGAGATGGATGGTGGTGATGG - Intergenic
1146449122 17:32958140-32958162 CTGGAGATGGATGGTGGTGATGG - Intergenic
1146511236 17:33450556-33450578 CTGGAGATGGATGGTGGTGATGG + Intronic
1148294207 17:46486078-46486100 CTGGAGATGAATGGTAGTGATGG - Intergenic
1148316390 17:46703792-46703814 CTGGAGATGAATGGTAGTGATGG - Intronic
1148829592 17:50422677-50422699 TTGGAGATGAATGGTGGTAATGG - Intergenic
1149167655 17:53772697-53772719 TTAGATATGAATGGTGATGATGG - Intergenic
1149169025 17:53787744-53787766 CTGGAAATGTATAGTCATGATGG + Intergenic
1149316969 17:55447751-55447773 CTGGAAATGGATAGTGATGATGG - Intergenic
1149352812 17:55809032-55809054 TTGGAGAAGACTACTGATGTAGG - Intronic
1149603189 17:57906523-57906545 CTGGAAATGGATAGTGGTGATGG + Intronic
1149643535 17:58221129-58221151 GTGGCGATGGATGGTGATGATGG - Intronic
1149663519 17:58349924-58349946 CTGGAGATGGATGGTGGTGACGG + Intronic
1149672258 17:58425020-58425042 TTGTAGATGAATGGTAGTGATGG + Intronic
1149889907 17:60378822-60378844 CTGGAAATGGATAGTGGTGATGG + Intronic
1149903112 17:60499971-60499993 CTGGAAATGAATGGTGTTGATGG + Intronic
1150189491 17:63223167-63223189 TTGGAGCTGAATAGAGGTGATGG + Intronic
1150222193 17:63502081-63502103 CTGGAGATGGACAGTGGTGATGG - Intronic
1150271559 17:63869240-63869262 CTGGAGATGGATGGTGGTGAGGG - Intergenic
1150335057 17:64324998-64325020 CTGGAGATGGATAGTGGTGGTGG + Intronic
1150417264 17:64997565-64997587 TTCAAGATGAAGAGTGAGGAGGG - Intergenic
1150423847 17:65060877-65060899 TTGGAAATAGATAGTGATGATGG + Intergenic
1150444985 17:65221873-65221895 TGGGAGGTGATTAGTCATGAGGG - Intronic
1150792721 17:68211528-68211550 TTGGAATTAAATAGTGGTGATGG + Intergenic
1151142307 17:72005519-72005541 CTGGAGATGAATAGTCGTGATGG + Intergenic
1151208278 17:72524620-72524642 TTGTGGATGGATGGTGATGATGG + Intergenic
1151649946 17:75460897-75460919 CTGGAGATGGATAGTGATGAGGG - Intronic
1151722603 17:75866071-75866093 CTGGAGATGGATGGTGCTGATGG - Intergenic
1151796614 17:76350663-76350685 CTGGAAATGAATAGTGGTGATGG + Intronic
1152193518 17:78902868-78902890 TTGGAGATGAATATGGTTGTTGG - Intronic
1152425514 17:80216474-80216496 CTGGAGATGGATGGTGGTGATGG + Intronic
1152438516 17:80290611-80290633 TGGGAAATGAAGAGAGATGATGG - Exonic
1152474341 17:80508241-80508263 CTGGAAATGAATGGTGGTGATGG + Intergenic
1152988237 18:338708-338730 CCAGAGATGAATAGTGGTGAAGG + Intronic
1153006742 18:503892-503914 CTGGAGATGGATGGTGGTGATGG + Intergenic
1153174373 18:2354398-2354420 CTGTGGATGAATGGTGATGATGG - Intergenic
1153341116 18:3975984-3976006 CTGGAGATGGATGGTGGTGACGG + Intronic
1153526871 18:6004909-6004931 CTGGAGATGGATGGTGATGCTGG + Intronic
1153683816 18:7525869-7525891 CTGGAGATGAATGGTGGTGATGG + Intergenic
1153772555 18:8427305-8427327 CTGGAGATGGATGGTGGTGATGG - Intergenic
1153843136 18:9024688-9024710 CTGGAGATGGATAGTGGTGATGG + Intergenic
1153906285 18:9664534-9664556 CTGGAGGTGGATGGTGATGATGG - Intergenic
1154942363 18:21127296-21127318 CTGGAGATGAATGGTGATGATGG - Intergenic
1155042159 18:22073853-22073875 TTGCAGGTGATAAGTGATGAGGG + Intergenic
1156022277 18:32613521-32613543 TTGGAAATACATAGTGGTGATGG - Intergenic
1156381047 18:36561638-36561660 TTAGAAATAAATAGTGATGATGG - Intronic
1156619924 18:38838826-38838848 TATGAAATCAATAGTGATGATGG - Intergenic
1157162564 18:45327441-45327463 CTGGAGATGGATAGTGGTGATGG - Intronic
1157337335 18:46751059-46751081 TTGGAGATGGATGGTGGTGATGG - Intronic
1157363759 18:47044390-47044412 CTGGAGATGGATGGTGGTGATGG + Intronic
1157556244 18:48614746-48614768 CTGGAAATAGATAGTGATGATGG + Intronic
1157955013 18:52087071-52087093 AAGCAGATGAATATTGATGAAGG + Intergenic
1158112532 18:53956738-53956760 ATGGAGATCAACAGTGAAGAAGG + Intergenic
1158129518 18:54137491-54137513 CTTGAGATGAATGGTGGTGATGG - Intergenic
1158379675 18:56915516-56915538 CTGGATCTGAATAGTGAAGAAGG - Intronic
1158430644 18:57383368-57383390 CTGGAGATGAATGGTGGTGATGG - Intergenic
1158750766 18:60257392-60257414 TCTCAGATGATTAGTGATGATGG - Intergenic
1158895146 18:61905892-61905914 CTGGAAATGAATAGTGGTGATGG - Intergenic
1158976164 18:62713813-62713835 TTGCAGATGAAGAGTGAAGGGGG - Intergenic
1159003939 18:62996415-62996437 TGGGAGGTGATTAGTCATGACGG + Intergenic
1159221237 18:65465592-65465614 TTGGAGATGAAGTGTGGTGGTGG + Intergenic
1159344273 18:67178938-67178960 CTGGAGATGGAAAGTGGTGATGG + Intergenic
1159579599 18:70220219-70220241 CTGGAGATGGATGGTGGTGATGG + Intergenic
1159617726 18:70600686-70600708 CTGGAGATGGATAGTGATAATGG - Intergenic
1159980588 18:74774691-74774713 TTGTAGATGAAAGGAGATGAAGG + Intronic
1160177808 18:76610424-76610446 TTGGAAATGGAGAGTGGTGACGG - Intergenic
1160191704 18:76719995-76720017 CTGGAGATGGATAATGTTGATGG + Intergenic
1160361984 18:78291099-78291121 CTGGAGATACATAGTGATGATGG - Intergenic
1160598016 18:79990772-79990794 CTGGAGATGGATAGTGGTGATGG - Intronic
1161360167 19:3844101-3844123 CTGGAGATGGATGGTGGTGACGG + Intronic
1161694850 19:5760653-5760675 CTGGAGATGGATGGTGGTGATGG + Intronic
1161758259 19:6150752-6150774 CTAGAGATGAACAGTGGTGACGG + Intronic
1161928327 19:7318093-7318115 CTGGAGATGGATGGTGGTGATGG - Intergenic
1162000018 19:7738271-7738293 TGCGAGATGAATGGTGGTGATGG + Intergenic
1162005694 19:7777373-7777395 CTGGAGATGGATGGTGGTGATGG + Intergenic
1162133043 19:8538915-8538937 CTGGAGATGGGTAGTGGTGATGG + Intronic
1162181752 19:8873999-8874021 TTAGAAATAAATAGTGGTGATGG + Intronic
1162228706 19:9246913-9246935 CTGGAGATGGATGGTGAGGATGG + Intergenic
1162317550 19:9949077-9949099 CTGGAGATGAGTGGTGATGATGG + Intergenic
1162330169 19:10023259-10023281 CTGGAGATGGATAGCGGTGATGG + Intergenic
1162399685 19:10437780-10437802 CTGGAGATGGATGGTGGTGATGG - Intronic
1162425782 19:10594595-10594617 CTGGAGATGGATGGTGGTGACGG - Intergenic
1162475515 19:10897147-10897169 TTGGTGAGGAATAGGGATGCTGG + Intronic
1162639094 19:11993714-11993736 ATGGAGATCAAGAGTGAAGAGGG + Intergenic
1162872403 19:13596182-13596204 CTGGAGATGGATGGTGGTGACGG + Intronic
1163092254 19:15028668-15028690 CTGGAGATGGATGGTGGTGAAGG - Intergenic
1163097430 19:15069919-15069941 TTGGAATTGGATAGTGGTGATGG + Intergenic
1163165937 19:15498305-15498327 TTGGAGATGGCTGGTGGTGATGG - Intronic
1165007223 19:32817210-32817232 CTGGAGATGGATAGCGATGATGG - Intronic
1165052712 19:33152339-33152361 TTGGAAATAAATAGTGGTGATGG - Intronic
1165137965 19:33682485-33682507 CTGGAGATGGATAGTGGTGATGG - Intronic
1165177093 19:33938490-33938512 TTGAAGATAGATAGTGGTGATGG - Intergenic
1165216523 19:34278108-34278130 CTGGAGATGGATGGTGGTGATGG - Intronic
1165263494 19:34640691-34640713 TTGGACATCGATAGTGGTGATGG - Intronic
1165263881 19:34644468-34644490 TTGGACATCGATAGTGGTGATGG - Intronic
1165286086 19:34843241-34843263 CTGGAGATGAATAGTGGCGATGG - Intergenic
1165299043 19:34956089-34956111 CTGGAGACGAATGGTGGTGATGG + Intergenic
1165553716 19:36610919-36610941 CTGGAGATGGATGGTGGTGATGG - Intronic
1165649449 19:37472871-37472893 TTGAAGATGAATAGAGAAAAAGG + Intronic
1166036882 19:40174965-40174987 GGGGAGGTGATTAGTGATGAGGG - Intergenic
1166135538 19:40775008-40775030 GTGCAGAGGAATAGTGATCATGG + Intronic
1166208565 19:41290041-41290063 TTAGAGATGAACAGGCATGAGGG + Intronic
1166424451 19:42663784-42663806 CTGGAAATGGATAGTGATAACGG - Intronic
1167081825 19:47281426-47281448 TTAAAGATGAATGGTGGTGATGG - Intergenic
1167228771 19:48268298-48268320 CTGGAGATGAATCGTGATGATGG + Intronic
1167457459 19:49604720-49604742 TTGGAGATGGATGGTGGTGACGG - Intronic
1168184632 19:54691745-54691767 CTGGAGATGGATGGGGATGATGG + Intronic
1168376444 19:55883875-55883897 CTGGAGATGGATGGTGGTGATGG + Intergenic
1168439787 19:56354201-56354223 CTGGAGATGGATGGTGGTGATGG + Intronic
1168573192 19:57487567-57487589 TTGGAGATGATAGATGATGATGG - Intergenic
925332446 2:3069231-3069253 CTGGAGATGGATGATGATGATGG + Intergenic
925341445 2:3140686-3140708 TGGGAGATGAACATTGGTGAGGG - Intergenic
925614001 2:5728066-5728088 TTCTAGATGAAAAGAGATGAAGG - Intergenic
926267072 2:11333058-11333080 ATGAAAATGAATTGTGATGATGG + Intronic
926609004 2:14926692-14926714 CTGGAGATGGACAGTGGTGATGG - Intergenic
926712619 2:15893849-15893871 CTGGAGATGGATGGTGGTGATGG + Intergenic
928383091 2:30838087-30838109 CTGGAGATGAACAGTGATGATGG + Intergenic
928887464 2:36166068-36166090 CTGGAGATGGATGGTGGTGAAGG + Intergenic
928915922 2:36470310-36470332 TTAGCTATGAAAAGTGATGAAGG + Intronic
928928165 2:36598833-36598855 ATGGAGATGGATGGTGGTGATGG + Intronic
929185355 2:39088406-39088428 CTGGAGATGGATAATGGTGATGG - Intronic
929488209 2:42373674-42373696 CTGGAAATGGATAGTGGTGATGG - Intronic
929538770 2:42803406-42803428 GCGGAGATGAATAGTGGAGATGG + Intergenic
929593324 2:43160714-43160736 GGGGAGATGTATATTGATGAGGG + Intergenic
929892795 2:45932712-45932734 TTGGAGATGGATAGTGGTCATGG - Intronic
929906801 2:46053425-46053447 ATGGAGATGGATAGTGGTGACGG - Intronic
930201049 2:48552409-48552431 TTAGAGGTGGATAGTGGTGATGG + Intronic
930644219 2:53887061-53887083 CTAGAGATAAATGGTGATGATGG + Intronic
931174235 2:59836858-59836880 TTGAAGAAGAATACTGATGAAGG - Intergenic
931260929 2:60618535-60618557 TTGGGGATAGATAATGATGATGG - Intergenic
931497398 2:62823680-62823702 TTTAAGAAGAATAGTAATGAGGG - Intronic
931663129 2:64588034-64588056 TTGGAATTAGATAGTGATGATGG - Intronic
931800345 2:65751843-65751865 CTGGAGATGGATGGTGGTGATGG - Intergenic
931914794 2:66942370-66942392 TTAGAAATGGATAGTGGTGATGG + Intergenic
932219425 2:69988589-69988611 CTGAAGATGAATGGTGTTGATGG + Intergenic
932680531 2:73820828-73820850 CTGGAGATGGATAGTGGTAATGG - Intergenic
933672809 2:85025444-85025466 CTGGAGATGGACAGTGGTGATGG - Intronic
933737862 2:85509722-85509744 CTGGAGATGGATAGTGGTGATGG + Intergenic
933761844 2:85677977-85677999 CTGGAGATGGATGGTGGTGATGG - Intergenic
933781321 2:85803692-85803714 CTGGAGATGGATAGTAGTGATGG - Intergenic
933808279 2:86015900-86015922 CTGGAGATGGATGGCGATGATGG - Intergenic
933867795 2:86538332-86538354 CTGGAGATGGATAGTGGTGATGG + Intronic
934049653 2:88199591-88199613 TTGGAGATGGATGGCGGTGATGG + Intergenic
934119439 2:88825781-88825803 CTGGAGATGGATGGTGGTGACGG - Intergenic
934204611 2:89915262-89915284 TTCCAGAATAATAGTGATGATGG + Intergenic
934515608 2:94984598-94984620 CTGGAGATGGATGGTGGTGACGG + Intergenic
934723525 2:96599324-96599346 CTGGAGATGGATGGTGGTGATGG + Intronic
934770021 2:96901710-96901732 ATGGAGATGGATGGTGGTGATGG + Intronic
934850146 2:97693990-97694012 CTGGAGATGAATGCTGGTGATGG - Intergenic
935044898 2:99472438-99472460 CTGGAGATGGATAGTGGTGATGG + Intronic
935229419 2:101082837-101082859 CTGGAGATGGATGGTGGTGATGG + Intronic
935542894 2:104370129-104370151 CTGGAGATGGATGGTGGTGATGG + Intergenic
935574213 2:104692207-104692229 ATGGAGATGAATAGTGGTGATGG - Intergenic
935619761 2:105118517-105118539 CTGGAGATGGATGGTGGTGATGG + Intergenic
935625036 2:105165223-105165245 CTGGAGATGGACAGTGGTGATGG - Intergenic
935711929 2:105906885-105906907 CTGGAGATGGATGGTGATGATGG - Intergenic
935938661 2:108215299-108215321 CTGGAAATGGATAGTGATGATGG + Intergenic
935988824 2:108700709-108700731 TTGGAAATGGATATTGATGATGG + Intergenic
936001005 2:108830319-108830341 TTGGGGATGGATAGTGATGATGG + Intronic
936162910 2:110098304-110098326 CTGGAGATGGATGGTGGTGATGG - Intronic
936235179 2:110736308-110736330 TTGGAGCTGGACAGTGGTGATGG - Intronic
936239617 2:110776329-110776351 CTGGAGATGGATGGTGATGATGG + Intronic
936264296 2:110989677-110989699 GTGGAGATGAATAGTGGTAATGG + Intronic
936383348 2:112007126-112007148 TTGGAGATGGATGGTAGTGATGG - Intronic
936385627 2:112025880-112025902 TTGGAGATAGATGGTGGTGATGG - Intronic
936458867 2:112696345-112696367 CTGGAGATGGATGGTGGTGATGG + Intergenic
936498908 2:113050514-113050536 CTGGAGATGGATGGTGGTGATGG + Intronic
936990322 2:118357120-118357142 CTGGAGATGGATAGTGATGATGG - Intergenic
937210317 2:120264683-120264705 CTGGAGATGGATGGTGGTGATGG - Intronic
937608413 2:123829408-123829430 CTGGAGATGCATGGTGATGGTGG - Intergenic
937824456 2:126351682-126351704 CTGGAGATGGATGGTGATGATGG + Intergenic
937893380 2:126957503-126957525 CTGGAAATGGATAGTGGTGATGG + Intergenic
937963108 2:127478457-127478479 CTGAAGATGAATGGTGGTGATGG + Intronic
938054821 2:128207195-128207217 CTGGGAATGAATAGTGGTGATGG - Intergenic
938154072 2:128913853-128913875 TTGGAGATGGAATGTGGTGATGG + Intergenic
938799021 2:134743041-134743063 CTGGAGATGGATGGTAATGAGGG + Intergenic
938825159 2:134997402-134997424 CTGGGGATGAATAGTTGTGATGG + Intronic
938922052 2:136004028-136004050 CTGGAGTTGAGTAGAGATGAAGG - Intergenic
939915272 2:148033730-148033752 TTGAAGTTGAAAATTGATGAAGG + Intronic
940087525 2:149877465-149877487 TTGGAGATAAAAAGTAATTAAGG + Intergenic
940091106 2:149918383-149918405 TTGAAAATGAATAGTGGTGATGG + Intergenic
940212748 2:151272997-151273019 CTAGAGATGGATAGTGGTGATGG + Intronic
940283066 2:152007285-152007307 CTAGAGATGGATAGTGATGATGG - Intronic
940335725 2:152525349-152525371 TTGGAGATGACTAATGCAGATGG + Intronic
940448434 2:153807077-153807099 TTGGGCATGAATAATGATGATGG - Intergenic
940535548 2:154936963-154936985 CTGGAGATGGGTAGTGGTGATGG - Intergenic
940645670 2:156390268-156390290 CTGGAGATGGATGGTGGTGATGG + Intergenic
940648514 2:156416876-156416898 TTGGTGAGGAAGAGTGGTGAAGG + Intergenic
940716574 2:157232037-157232059 CTGGAGATGGATAGTGATGAAGG - Intergenic
940804257 2:158168270-158168292 CTGGAGATGGATAGAGATGGAGG + Intergenic
940854796 2:158721701-158721723 CTGGAGATGGATAGTGTTGATGG + Intergenic
941692175 2:168512246-168512268 CTGGAGATGGATGGTGGTGATGG + Intronic
941728898 2:168893899-168893921 CTGGAGATGAATAGCGGTGATGG - Intronic
941732953 2:168938587-168938609 CTAGAGATGAATAGTGGTGATGG + Intronic
941947968 2:171121131-171121153 CTACAGATGAATAGTGGTGATGG + Intronic
942179051 2:173362374-173362396 CTGGAGATGGATGGTGGTGATGG + Intronic
942271220 2:174277393-174277415 CTGGAGATGGACAGTGGTGATGG - Intergenic
942364168 2:175205377-175205399 ATGGAGATGGATGGTGGTGATGG - Intergenic
942617497 2:177809171-177809193 CTGGAGATGGATAGTGGTGATGG + Intronic
942695544 2:178639255-178639277 CTGGAAATGGATAGTGTTGATGG - Intronic
942728614 2:179038421-179038443 TTGGAAATACATAGTGGTGATGG + Intronic
942762896 2:179420751-179420773 CTGGAGAGGGATGGTGATGATGG - Intergenic
943058230 2:183009711-183009733 CTGGAGATGGATGGTGCTGATGG - Intronic
943073173 2:183165604-183165626 ATGGCAATGGATAGTGATGATGG - Intergenic
943078082 2:183222541-183222563 CAGGAGATGAATAATGATGCTGG - Intergenic
943151713 2:184122197-184122219 TTGGAGATGTTTAAGGATGATGG - Intergenic
943300138 2:186188079-186188101 ATGGAGATGAATGGTAGTGATGG + Intergenic
943547413 2:189298120-189298142 TTGAAGAGAAAGAGTGATGAAGG - Intergenic
943609970 2:190020673-190020695 CTGGAGATAAATGGTGGTGATGG - Intronic
943613585 2:190065357-190065379 CTGAAGATGAATGGTGGTGATGG + Intronic
943640111 2:190348474-190348496 CTGGACATGAACAGTGCTGATGG - Intronic
943792384 2:191948042-191948064 TTGGAGATGAAGAGAGTTGCAGG + Intergenic
943844587 2:192628776-192628798 TTGGAAATGAATAGCAGTGATGG - Intergenic
944117366 2:196203793-196203815 CTGGAGATGGATAGTGATGATGG - Intronic
944155857 2:196606875-196606897 CTGGAGCTGAATGGTGGTGATGG + Intergenic
944467654 2:200019325-200019347 CTGAAGATGAATGGTGATAATGG - Intergenic
944652180 2:201842069-201842091 CTGGAGATGGACAGTGGTGACGG - Intronic
944944370 2:204666308-204666330 TGTGAGATGAAGAGTCATGAAGG + Intronic
944947327 2:204704170-204704192 CTGGAGATGAATAGTGGTGCTGG - Intronic
945108362 2:206338762-206338784 TTGGTGATGGATAGTGGTGATGG - Intergenic
945204996 2:207322056-207322078 CTGGAGATGAATGGTGGTGATGG + Intergenic
945490775 2:210452086-210452108 TTGAAAATAAATAGTGCTGATGG + Intronic
945642094 2:212443228-212443250 GTGGAGATGAAAAGTGATCAAGG - Intronic
946493622 2:220173392-220173414 CTGGAGATGGATGGTGGTGATGG + Intergenic
946523147 2:220488425-220488447 TGGGAGAGGATTGGTGATGAAGG - Intergenic
946902776 2:224388626-224388648 CTGGAAATGTATAGTGGTGATGG + Intronic
946993686 2:225365954-225365976 CTGGAGATGGATGGTGGTGATGG - Intergenic
947150751 2:227112650-227112672 TTGGAGATGGATGGTGGTCATGG - Intronic
947450512 2:230203902-230203924 CTGGAGATGGATGGTGGTGATGG + Intronic
947497885 2:230651905-230651927 CTGGAGATGGATGGTGGTGATGG - Intergenic
947890113 2:233610280-233610302 CTGGAGATGAATGGTGGTGTTGG - Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948552847 2:238786192-238786214 CTGGAGCTGAATAGTGGTGACGG - Intergenic
948582163 2:238995730-238995752 CTGGAGATGAATGGAGGTGATGG + Intergenic
1168906601 20:1408963-1408985 CTGGAGATGGATGGTGATGATGG - Intergenic
1168920295 20:1529006-1529028 CTAGAGATGTATAGTGGTGATGG - Intergenic
1168988030 20:2067484-2067506 CTGGAGATGAATGGCGGTGATGG + Intergenic
1169024359 20:2356034-2356056 CTGGAGATGGATGGTGGTGACGG + Intergenic
1169024780 20:2360523-2360545 TTTGAGATGAATGATGGTGATGG - Intergenic
1169098518 20:2925114-2925136 TTGGAGATGGACAGTGGTGATGG - Intronic
1169188512 20:3641174-3641196 CTGGAGATGGATAGTAATGATGG + Intronic
1169340287 20:4791323-4791345 CTGGAGATGGATGGTGGTGATGG + Intronic
1169763978 20:9128751-9128773 CTGGAGATGAATAGTAATGATGG - Intronic
1170242214 20:14180005-14180027 CTGGAGATGGAAAGTGGTGATGG - Intronic
1170315176 20:15033133-15033155 CTGGAAATGGATAGTGGTGATGG + Intronic
1170638490 20:18130325-18130347 ATGGAGATGAATAGTGATGCTGG + Intergenic
1170656944 20:18296374-18296396 CTGGAGATAGATAGTGGTGATGG - Intronic
1170888474 20:20359954-20359976 CTGGAGATGGACAGTGGTGAGGG + Intronic
1170960946 20:21025397-21025419 CTGGAGATGGATAGTGCTGATGG + Intergenic
1171001370 20:21419123-21419145 CTGGAGATGGATGGTGGTGATGG + Intergenic
1171139920 20:22731920-22731942 CTGGAGATGGATCGTGGTGATGG - Intergenic
1172044096 20:32067312-32067334 ATGGAGATGGATGGTGGTGAGGG - Intronic
1172265967 20:33614491-33614513 TTGGAGATGGATGGTGATGATGG - Intronic
1172488229 20:35312965-35312987 CTGGAGATGAATGGTGGTGACGG + Intronic
1172656134 20:36539658-36539680 CTGGAGATGGATGGTGGTGATGG + Intergenic
1172730785 20:37085599-37085621 CTGGAGATGGACAGTGGTGATGG - Intronic
1172994525 20:39060133-39060155 TTGGAGATGGATAATGGTGATGG + Intergenic
1174264599 20:49322267-49322289 TTGGAAATGATTGGTGAGGATGG + Intergenic
1174783579 20:53412502-53412524 CTGGAGATGGATGGTGGTGATGG - Intronic
1176040467 20:63062853-63062875 CTGGAGATGGACAGTGGTGATGG - Intergenic
1176378693 21:6100908-6100930 TTGGAGGTGGATGGTGGTGATGG - Intergenic
1176409237 21:6438840-6438862 CTGGAGATGGATGGTGGTGATGG - Intergenic
1177138648 21:17333696-17333718 CTGGAGATGGATGGTGGTGATGG + Intergenic
1177343747 21:19840575-19840597 ATGGAGATGGATGGTGGTGATGG + Intergenic
1177358877 21:20043985-20044007 TTGGAGGTGGATGGTGGTGATGG - Intergenic
1177891724 21:26812653-26812675 TTGGAGATGAATGATGGTGATGG - Intergenic
1178259662 21:31087404-31087426 TTGGAAATGGATAGTGGTGATGG - Intergenic
1178282722 21:31297360-31297382 CTGGAGATGGATGGTGGTGATGG + Intronic
1178289218 21:31352368-31352390 TTGGACATAGATAGTGGTGATGG + Intronic
1178440844 21:32597046-32597068 CTGGAGATGGATGGTGCTGATGG - Intronic
1178496037 21:33087038-33087060 CTGCAGATGGATGGTGATGATGG + Intergenic
1179212005 21:39332711-39332733 CTGGAGATGGATAGTGGTGATGG + Intergenic
1179302267 21:40123198-40123220 CTGGAGATGGATGGTGGTGATGG + Intronic
1179405141 21:41119603-41119625 CTGGAGGTGAAAGGTGATGATGG - Intergenic
1179520184 21:41938479-41938501 CTGGAGGTGGATGGTGATGATGG - Intronic
1179680086 21:43013623-43013645 CTGGAGATGGATGGTGTTGATGG - Intronic
1179684732 21:43047162-43047184 CTGGAGATGGATGGTGGTGATGG - Intergenic
1179744782 21:43437329-43437351 TTGGAGGTGGATGGTGGTGATGG + Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1180216428 21:46326198-46326220 TTGGATATAGATATTGATGAAGG + Intronic
1180224649 21:46384989-46385011 CTGGAGATGGATGGTGGTGATGG - Intronic
1180860304 22:19075513-19075535 CTGGAGATGGATGGTGGTGATGG - Intronic
1180890089 22:19281322-19281344 TTGGAGATGGATGGTGGTGATGG + Intronic
1181483301 22:23214905-23214927 CTGGAGATGGATAGTGGTGATGG - Intronic
1181506114 22:23358836-23358858 CTGAAGATGTATAGTGGTGATGG + Intergenic
1181541732 22:23576822-23576844 CTGGAGATGGATGGTGGTGAAGG - Intronic
1181548842 22:23623700-23623722 TTGGAAAAGAATAGTGTTGGTGG + Intronic
1181551961 22:23644692-23644714 CTGGAGATGGATGGTGGTGAAGG - Intergenic
1181557839 22:23682071-23682093 TTTGTGATGATTAGTGATGTGGG - Intergenic
1181613059 22:24032070-24032092 TTGGAGATGGATGGTGGTGATGG - Intronic
1181656683 22:24306732-24306754 CTGGAGATGGATGGTGATGATGG - Intronic
1181663377 22:24370979-24371001 CTGGAGATGGATGGTGGTGATGG + Intronic
1181755143 22:25018490-25018512 CTAGAGATGGATGGTGATGATGG - Intronic
1181784439 22:25216706-25216728 CTGGGGATGGATAGTGGTGATGG - Intergenic
1181796392 22:25314592-25314614 CTGGAGATGGATGGTGGTGAAGG + Intergenic
1181889633 22:26050817-26050839 TTGCTTATGAGTAGTGATGAGGG + Intergenic
1182233704 22:28859164-28859186 CTGGAGATTGACAGTGATGATGG - Intergenic
1182252190 22:29009871-29009893 CTGGAGATGGTCAGTGATGATGG - Intronic
1182273432 22:29170096-29170118 TTGCAGAGGAAAGGTGATGAGGG + Intergenic
1182402396 22:30089808-30089830 TTAGAAATGGATAGTGATAATGG - Intronic
1182608030 22:31522417-31522439 TTGGGTATGGATAGTGGTGATGG - Intronic
1182760250 22:32716934-32716956 TTGGAGATGGATGGTGGTAATGG - Intronic
1182873889 22:33673615-33673637 CTGGAGATGGATAGTGATGATGG - Intronic
1183065343 22:35358857-35358879 CTGGAGATGGATGGTGGTGATGG + Intergenic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1184612220 22:45611846-45611868 ATGGAGGTGAATGGTGGTGAAGG + Intergenic
1184756796 22:46520814-46520836 CTGGAGATGGAGGGTGATGATGG - Intronic
1184931546 22:47684980-47685002 CTGGAGATGAATGGTGGTGATGG - Intergenic
949703933 3:6793715-6793737 TTTTAGATGATTATTGATGATGG + Intronic
949857436 3:8474798-8474820 GTAGAGATGGATGGTGATGATGG + Intergenic
949948074 3:9206034-9206056 TCTGAGATGAATAGTGGTGACGG + Intronic
949949443 3:9217070-9217092 CTGGAGATGGATGGTGGTGACGG + Intronic
949989459 3:9566672-9566694 TTGGAAATGAACAGTGGTGATGG - Intergenic
950135117 3:10575491-10575513 GTGGAGATGGATAGTGGTGATGG + Intronic
950615501 3:14154700-14154722 CTGGAGATGGATGGTGGTGATGG + Intronic
950719034 3:14869520-14869542 CTGGAAATGAATGGTGTTGATGG - Intronic
950842492 3:15980733-15980755 CTGGAGATGAATAGTGATGATGG + Intergenic
950925720 3:16739448-16739470 TTGGAAGTAGATAGTGATGATGG - Intergenic
951378883 3:21957847-21957869 TAGTAGATGAATGGTGGTGAAGG - Intronic
951426349 3:22550486-22550508 CTGCAGATGAATGGTGGTGATGG + Intergenic
951992936 3:28696235-28696257 TTTGAGATAAATATTGGTGAAGG + Intergenic
952208972 3:31209969-31209991 ATGGAGATGGATGGTGGTGATGG + Intergenic
952245868 3:31592046-31592068 CTGGAGATGGATGGTGGTGATGG - Intronic
952499517 3:33947225-33947247 CTAGAAATGGATAGTGATGATGG - Intergenic
952816353 3:37451345-37451367 GTGGAGATGGATGGTGGTGAAGG + Intergenic
953121683 3:40049679-40049701 TTAGAAATGATTAGTGAGGAAGG + Intronic
953312559 3:41893202-41893224 TTGGAAATGAATAGTGGTGATGG + Intronic
953728956 3:45428606-45428628 CTGGAGATGAAGAGTGATAATGG - Intronic
953764285 3:45723667-45723689 GTGGAAATGAACAGTGATGATGG - Intronic
953988961 3:47468981-47469003 CTGGAAATGGATAGTGATGATGG + Intronic
954283913 3:49604296-49604318 CTGGAGATGGATGGTGGTGATGG - Intronic
954493273 3:50928227-50928249 CTGGAGATGAATTGTGATGATGG - Intronic
954601356 3:51872941-51872963 CTGGAGATGGATGGTGGTGATGG + Intergenic
954743501 3:52773368-52773390 CTGGAGATGGATGGTGGTGATGG + Intergenic
954835790 3:53466572-53466594 TTGTAGATGAATATTGATAGTGG - Intergenic
954880498 3:53832845-53832867 TTGGAAACGGATAGTGGTGATGG + Intronic
954980164 3:54738660-54738682 ATGGAAATGTATAGGGATGATGG - Intronic
955011578 3:55021733-55021755 TTAGAGATGAATAAGAATGAAGG - Intronic
955208001 3:56914908-56914930 CTGGAGATGGATGGTGGTGATGG + Intronic
955304009 3:57811165-57811187 ATGGAGATGAATGGTGATAATGG - Intronic
955339360 3:58113125-58113147 ATGGAGATGGATGGTGGTGATGG - Intronic
955893639 3:63676065-63676087 TTGTAGATGATTAGTGGTGGAGG + Intronic
956011412 3:64835454-64835476 CTGGAAATGAATAGTGGAGATGG - Intergenic
956027589 3:64999899-64999921 CTGGAGATAGATAGTGGTGATGG + Intergenic
956064284 3:65380433-65380455 CTGGAGATGGATGATGATGATGG - Intronic
956185118 3:66555117-66555139 TTGGAGAGAAGTAGTGATAAAGG + Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
957164173 3:76649759-76649781 TTGGATATGAATAGGTATCAGGG + Intronic
957393468 3:79609912-79609934 CTGGAGAAGAATGGTCATGATGG + Intronic
958730305 3:97953945-97953967 TTAGAAACGAATAGTGGTGATGG + Intronic
958959706 3:100497482-100497504 CTGGAGATGGATGGTGGTGATGG - Intronic
959055148 3:101560536-101560558 CTGGAGATGGATAGTAGTGATGG - Intergenic
959182905 3:103004830-103004852 TTGGAAATGTATGGTTATGAGGG + Intergenic
959582961 3:108000667-108000689 TTGGGGATGGATGGTGGTGATGG + Intergenic
959685863 3:109145534-109145556 CTGGAGATGGATAGCGGTGATGG + Intergenic
959689801 3:109186501-109186523 TTGGAAATAGATAGTGGTGAAGG + Intergenic
959726410 3:109547295-109547317 CTGCAGATGAATAGTGGTGATGG - Intergenic
959735959 3:109658880-109658902 CTGGAGATGGATAGTGGTGATGG + Intergenic
959992964 3:112648846-112648868 CTAGAGATGGATAGTGGTGATGG - Intronic
960058942 3:113298894-113298916 CTGGAGATGGATGGTGGTGATGG + Intronic
960083028 3:113561445-113561467 GTGGAGATGAACAGTGAAGTGGG + Intronic
960231792 3:115237015-115237037 CTGAAGATGGATAGTGGTGATGG - Intergenic
960466410 3:118001304-118001326 TTTTAGAACAATAGTGATGATGG - Intergenic
960635153 3:119777660-119777682 CTGGATATGAATAGTGGTGATGG + Intergenic
960657184 3:120018058-120018080 TTTGTGATGATGAGTGATGATGG - Intronic
960742194 3:120846583-120846605 TTCTAAATGAATAGTGGTGATGG - Intergenic
960959614 3:123061041-123061063 CTGGAGATGAATAATGGTGATGG - Intergenic
961020817 3:123505321-123505343 CTGGAGATGGATGGTGATGATGG + Intronic
961118593 3:124353357-124353379 TGGGAAATGAAAATTGATGAGGG - Intronic
961142724 3:124568896-124568918 CTGGAGATGGATGGTGATGATGG + Intronic
961156481 3:124684045-124684067 CTGGAAATGGATAGTGGTGATGG - Intronic
961528316 3:127523192-127523214 CTGGAGACGGATGGTGATGATGG + Intergenic
961597180 3:128027767-128027789 CTGGAGATGGATGGTGGTGATGG + Intergenic
961771138 3:129250763-129250785 TTGGTGGTGAATATTTATGATGG - Intronic
961834770 3:129648325-129648347 TTGGACATGGCTAGTGAGGAAGG + Exonic
962290018 3:134127239-134127261 CTGGAGATGGATGGTGATGCTGG + Intronic
962492920 3:135911011-135911033 CTGGAGATGGATAGTGGTGATGG + Intergenic
962558554 3:136581300-136581322 CTGGAAATGAAGAGTAATGAAGG - Intronic
962760042 3:138503108-138503130 ATGGAGATGGATGGTGATGTTGG - Intronic
963190419 3:142464778-142464800 TTGGAGAGGGATGGTGGTGATGG + Intronic
963242883 3:143027363-143027385 CTGGAGATGGATGGTGGTGATGG - Intronic
963337939 3:143999036-143999058 TTGGAAATAGATAGTGGTGATGG - Intronic
963537715 3:146548632-146548654 TTTCTGATGAATAGTGATGCTGG + Intergenic
963624895 3:147658928-147658950 TTGGAGATGGATAGTGGTAATGG - Intergenic
963753332 3:149205808-149205830 CTGGAAATGGATAGTGGTGACGG + Intronic
963823602 3:149927069-149927091 CTGGAGATGGATGGTGGTGATGG - Intronic
963943438 3:151118623-151118645 CTGGAGATGGATAGTGACAATGG - Intronic
963955612 3:151250358-151250380 CTAGAGATGCATGGTGATGATGG - Intronic
964043465 3:152293264-152293286 GTGGAGTTGAATAGTGCTGAAGG + Intronic
964774241 3:160257681-160257703 CTGGAAATGGATAGCGATGATGG - Exonic
965505364 3:169509427-169509449 CTGGAGATGAGTAATGGTGATGG - Intronic
965675318 3:171189005-171189027 CTGGAGATGGACAGTGGTGAAGG - Intronic
965691252 3:171359024-171359046 CTGGAGATGGGTAGTGGTGAAGG + Intronic
965801940 3:172503631-172503653 CTGGAGATGAATAGTAGTGATGG + Intergenic
966435264 3:179876654-179876676 TTGGAGATGAATAGTGGTGATGG - Intronic
967052143 3:185794743-185794765 CTGGAGATGGATGGTGGTGATGG - Intronic
967532007 3:190559214-190559236 TGGGACATGACTAGTGATCACGG - Intronic
967754208 3:193150103-193150125 CTGGAGATGGATAGTGGTGATGG - Intergenic
967760184 3:193215324-193215346 CTGGAGATGGATGGTGCTGATGG - Intergenic
968168871 3:196492043-196492065 TCAGAGATGAATGGTGGTGACGG + Intronic
968181753 3:196600437-196600459 CTGGAGATGGATGGTGCTGATGG - Intergenic
968215044 3:196882310-196882332 CTGGAGATGAATGGTGGTGATGG - Intronic
969045976 4:4337021-4337043 CTGGAGATGGATGGTGGTGATGG + Intergenic
969083724 4:4640115-4640137 CTGGAGATGGATGGTGGTGACGG + Intergenic
969100915 4:4767660-4767682 TTGGAACTAAATAGTGGTGATGG + Intergenic
969128528 4:4973255-4973277 CTGGAGATGGATGGTGGTGATGG - Intergenic
969781893 4:9410713-9410735 TTGGAATTAAATAGTGGTGATGG + Intergenic
970361748 4:15316274-15316296 CTGGAGATGAATGGTAATGATGG - Intergenic
970574085 4:17410962-17410984 CTGGAGATGGATGGTGGTGACGG + Intergenic
970997060 4:22279646-22279668 TTGGGGAAGAATAGACATGATGG + Intergenic
971209996 4:24606998-24607020 TTGGAGATGGATGGTGGTGATGG + Intergenic
971411375 4:26376208-26376230 CTGGAGATGGATGGTGGTGATGG - Intronic
971434286 4:26603888-26603910 TTGAAGATGGATGGTGAGGATGG - Intronic
971466489 4:26968587-26968609 CTGGAGATGGATTGTGATGATGG + Intronic
972223557 4:36984875-36984897 CTGGAGATGGATGGTGGTGATGG + Intergenic
972387163 4:38578472-38578494 CTGGAGATGAATGGCGGTGATGG - Intergenic
972422359 4:38900833-38900855 CTGGAGATGGATGGTGGTGATGG + Intronic
972531557 4:39965845-39965867 CTGGAGATGAATGGTGGTGATGG + Intronic
972586609 4:40443221-40443243 CTGGAGATGGATGGTGGTGATGG + Intronic
972614302 4:40683463-40683485 CTGGAGATGGATGGTGGTGATGG - Intergenic
972614361 4:40683930-40683952 CTGGAGATGGATGGTGGTGATGG - Intergenic
972679442 4:41291231-41291253 TTGGAGATGAACAGTGGTGATGG - Intergenic
972731607 4:41800455-41800477 CTGGTGATGAATGGTGATGATGG + Intergenic
972744391 4:41919427-41919449 CTGGAGATGAATAGTGGTGATGG + Intergenic
972907927 4:43774099-43774121 CTGGAGATGGATAGTGGTGATGG + Intergenic
973123113 4:46547605-46547627 TTGGATAATAATGGTGATGATGG - Intergenic
973146849 4:46837577-46837599 TTGGAAATGGGTAGTGGTGATGG + Intronic
973561603 4:52142484-52142506 CTGGAGATGGATGGTGGTGATGG + Intergenic
973876089 4:55220600-55220622 GTGGTGATGAATAATGGTGACGG - Intergenic
973927663 4:55755985-55756007 CTGGAGATGGATGGTGTTGATGG + Intergenic
973931669 4:55799303-55799325 ATTGAGATGGATAGTGGTGATGG + Intergenic
974106513 4:57475539-57475561 TGGGAGATGAATACTGAGCAAGG + Intergenic
974496881 4:62641070-62641092 ATGGAGATGGATGGTGGTGATGG + Intergenic
975208793 4:71675099-71675121 CTGGAGATGGATGGTGGTGATGG + Intergenic
975242367 4:72075834-72075856 TTAGAGATGAATGGTGGTGATGG + Intronic
975472107 4:74781791-74781813 CTGGAGATGCATGGTGGTGATGG - Intronic
975615186 4:76238844-76238866 CTGGAGATGGGTAGTGGTGATGG - Intronic
975862164 4:78689253-78689275 ATGGAGATGAAAAGAGATAATGG + Intergenic
975927119 4:79470536-79470558 CTGGAGATGCATGGTGAGGATGG - Intergenic
975981656 4:80167864-80167886 CTGGAGATGGATAGTGGTGAAGG - Intergenic
976384795 4:84444434-84444456 TTGGAGGTGGATGGTGGTGATGG - Intergenic
976417086 4:84789508-84789530 TTAGAGAAGAATAGAAATGAGGG - Intronic
976450372 4:85182826-85182848 CTGAAGATGAATGGTGATAATGG - Intergenic
976763454 4:88574508-88574530 CTGGAGATGGATGGTGGTGATGG - Intronic
977613375 4:99060180-99060202 TTGGAGATGGATGGTGGTAATGG - Intronic
977730424 4:100344531-100344553 CTGGAGATGGATGGTGGTGATGG + Intergenic
977953207 4:102998091-102998113 CTGGAGATGGATGGTGGTGATGG - Intronic
977960756 4:103082517-103082539 CTGGAGATGGACAGTGGTGATGG - Intronic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978204641 4:106066608-106066630 TTGGAAATAACTAGTGGTGATGG - Intronic
978253594 4:106664625-106664647 TTCCTGATGAATAATGATGATGG + Intergenic
978471496 4:109072726-109072748 GTGGAGATGCATAGTGGTCATGG - Intronic
978976010 4:114874022-114874044 CTGGAGATGAATAGTGATGCTGG - Intronic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
979307987 4:119170098-119170120 ATGGAGAGGAATGGTGGTGATGG - Intronic
979384475 4:120048187-120048209 ATGGAGATGGATGGTGGTGATGG + Intergenic
980049826 4:128028062-128028084 TTGGAGATAGATGGTGGTGATGG - Intronic
980546232 4:134266742-134266764 TTGGAGAATGATAGGGATGATGG - Intergenic
980780706 4:137487932-137487954 TTGGAGATGGATGGTGGTGATGG - Intergenic
980868834 4:138586811-138586833 TAGGAGATGAAGAGGAATGAAGG + Intergenic
980886039 4:138763735-138763757 ATGGAGATGGATGGTGGTGATGG + Intergenic
980886481 4:138768217-138768239 CTGGACATGTATAGTGGTGATGG - Intergenic
981072676 4:140560810-140560832 CTAGAGATGGATAGTGGTGATGG - Intronic
981202754 4:142000709-142000731 TTGGAGAAGGATGGTGCTGATGG + Intergenic
981286362 4:143023773-143023795 CTGGAAATGAATAATGGTGATGG + Intergenic
981478918 4:145216080-145216102 CTGGAGATGCATGGTGATGATGG - Intergenic
981577562 4:146221136-146221158 CTGGAAATGGATAGTGATGATGG - Intergenic
981610953 4:146593181-146593203 TTGGAGATGGTTAGTGGTGGTGG + Intergenic
981757004 4:148151061-148151083 TTGGATGTGGATAGTGGTGATGG + Intronic
981821447 4:148891858-148891880 CTGGAGATGGATGGTGGTGATGG - Intergenic
981881314 4:149616496-149616518 CTGGAGATGGATAGTAATGATGG + Intergenic
982222935 4:153140402-153140424 CTGGAGATGGATGGTGATGATGG - Intergenic
982500177 4:156144441-156144463 TGGGAGGTGATTAGTCATGAGGG - Intergenic
982696538 4:158608701-158608723 TTGGAGGTGGATGGTGATGATGG - Intronic
982882202 4:160733927-160733949 GTGGATATGTATAGTGGTGATGG - Intergenic
983363039 4:166751072-166751094 ATGGAGAAGAAAAGTGATTAAGG - Intronic
984305176 4:177980109-177980131 CTGGAGATGGATTGTGGTGATGG - Intronic
984711262 4:182887332-182887354 CTGGAGATGGATGGTGGTGATGG + Intergenic
984724498 4:183007852-183007874 ATGGAGATGAATGGTGGTAATGG + Intergenic
984724501 4:183007871-183007893 ATGGAGATGAATGGTGGTAATGG + Intergenic
984783470 4:183546720-183546742 CTGGAGATGAATGGTGGTGATGG - Intergenic
984916247 4:184727341-184727363 CTGGAGATGGATGGTGATGATGG + Intronic
984937929 4:184905720-184905742 CTGGAGATGGATGGTGATGCTGG - Intergenic
984946421 4:184972139-184972161 CTGGAGATGGATGGTGCTGATGG - Intergenic
984955169 4:185037783-185037805 CTGGAGATGAATGGAGGTGATGG - Intergenic
985001947 4:185494222-185494244 CTGGAAATGGATATTGATGATGG + Intergenic
985107797 4:186515776-186515798 CTGGAGATGGATGGTGGTGATGG + Intronic
985298756 4:188464358-188464380 CTGGATATGGATATTGATGACGG + Intergenic
986028109 5:3869873-3869895 CTGGAGATGGATGGTGGTGATGG + Intergenic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
986370515 5:7075544-7075566 TTGAAGATCAATAGAGATGTGGG - Intergenic
986524136 5:8654804-8654826 TTGCACATGAAAAGTGATCATGG + Intergenic
986808630 5:11332566-11332588 TTGGAGATGGTTAGTGATGATGG - Intronic
987168482 5:15226146-15226168 TTGGAAATAAATAGTAGTGATGG - Intergenic
987348475 5:16999595-16999617 CTGGAGATAAATGGTGGTGATGG + Intergenic
987480362 5:18448367-18448389 ATGGAGATGTATGGTGTTGATGG - Intergenic
987992752 5:25236234-25236256 TTGGAGATGGATGGTGGTGATGG - Intergenic
988000935 5:25347473-25347495 TTGGCAAGGAATAGTGAGGATGG - Intergenic
988519466 5:31932687-31932709 CTGGAGATGGATAGTGGTGATGG - Intronic
988582214 5:32478150-32478172 TTGAAGATGGATGGTGGTGATGG + Intergenic
989020686 5:37003297-37003319 TTGGAGAAGAATATTCAGGATGG + Exonic
989373087 5:40730518-40730540 CTGGAGATGAATGGTGGTGGTGG - Intronic
989395165 5:40947503-40947525 TTGGAGATGAGAGCTGATGAAGG + Intronic
989560866 5:42849330-42849352 ATGGAGATGGATGGAGATGATGG + Intronic
991232862 5:64356885-64356907 TTGAAAATAAATAGTGGTGATGG + Intronic
991268908 5:64756245-64756267 TTTGAAATGAATAGTGATGATGG - Intronic
991301783 5:65135338-65135360 TTGGTGTTGGATGGTGATGACGG - Intergenic
991373729 5:65943779-65943801 CTGGAGATGAACAGTGGTGAAGG - Intronic
991424297 5:66474497-66474519 TTGGAGATGAATGGTGGTGATGG + Intergenic
991453703 5:66780142-66780164 CTGGAGATGGATAGTGCTGATGG - Intronic
991499988 5:67267583-67267605 TTGGATATGCATGGTGATAAAGG + Intergenic
991697406 5:69286110-69286132 CTGGAGCTGGATGGTGATGAAGG + Intronic
991778354 5:70107496-70107518 CTGGAGATGGATAGTGGTGATGG + Intergenic
991857644 5:70982963-70982985 CTGGAGATGGATAGTGGTGATGG + Intronic
991870803 5:71107848-71107870 CTGGAGATGGATAGCGGTGATGG + Intergenic
991895566 5:71394252-71394274 TAGGAGCTGATTAGTCATGAGGG - Intergenic
991921026 5:71657317-71657339 CTGGAGATGAATGGTGGTGATGG - Exonic
991939435 5:71836409-71836431 ATGGTGATGAATCTTGATGATGG + Intergenic
992475963 5:77101932-77101954 CTGGAGATGCATGGTGGTGATGG + Intergenic
992782878 5:80143937-80143959 TTGGAAATGGGTAGTGTTGATGG - Intronic
992918345 5:81483021-81483043 AAGGAGAGGAATAGTGATCAGGG + Intronic
993603087 5:89953047-89953069 TGGGAGATGAGAAGAGATGAAGG + Intergenic
993625435 5:90219160-90219182 ATGAAGATGGATAGTGGTGATGG + Intergenic
993915403 5:93738848-93738870 TTGGAAATGGATAGTGGTGATGG + Intronic
993941227 5:94061412-94061434 TTGAACAAGAATAGTGAGGATGG - Intronic
994673364 5:102789700-102789722 TTGGAGATGGATGGTGGTAATGG + Intronic
994844739 5:104974107-104974129 TTGAAGATGATTTGTGGTGATGG + Intergenic
995006898 5:107208792-107208814 CTGGAGATAAATAGTGGTGATGG + Intergenic
995448974 5:112279494-112279516 TTGGAGATGGACAGTGATGATGG + Intronic
995626497 5:114082971-114082993 ATAGAGATGGATAGTGGTGATGG + Intergenic
995784075 5:115809661-115809683 GTGGAGATGGATAGTGATCAGGG - Intronic
995816568 5:116175935-116175957 CTGGAGATGGATGGTGGTGATGG + Intronic
995857738 5:116611420-116611442 CTGGAGATAAATAGTGGTGCTGG - Intergenic
995929372 5:117419370-117419392 CTGGAGATGGATGGTGCTGATGG - Intergenic
995951250 5:117716544-117716566 CTGAAGATGAATAGTGGTAAAGG - Intergenic
995985692 5:118169753-118169775 CTGGAGATGAATGGTGGTGATGG - Intergenic
996120080 5:119661820-119661842 TTGGAGATGGTTGGTGGTGATGG - Intergenic
996196092 5:120609285-120609307 TTGGAAATAGATACTGATGATGG - Intronic
996224739 5:120977890-120977912 TTTGAGATAGATAGTGATGCTGG - Intergenic
996350418 5:122534760-122534782 CTGGAGATGGATGGTGCTGATGG - Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996792657 5:127309367-127309389 CTGGAGATGGATGGTGGTGATGG - Intronic
996899416 5:128526792-128526814 CTGGAGATGGATGGTGGTGATGG + Intronic
997109924 5:131063897-131063919 CTGGAGATGGATGGTGGTGATGG + Intergenic
997164738 5:131647835-131647857 TTGGAAATGGATAGTAGTGACGG - Intronic
997169849 5:131706151-131706173 CTGGAGTTGGATGGTGATGATGG + Intronic
997183205 5:131854400-131854422 CTAGAGATGAATAGTGGTGATGG + Intronic
997260484 5:132462155-132462177 CTGGAGATGGATGGTGGTGATGG + Exonic
997581798 5:135022276-135022298 CTGGAGATGGATGGTGGTGATGG - Intergenic
997914520 5:137911047-137911069 TTGGAGATAGATGGTGGTGATGG - Intronic
998189761 5:140013436-140013458 CTGGAGATGAATGGTGGTGATGG + Intronic
998213699 5:140221295-140221317 TTGGAGATGAGTGGTGGTGACGG - Intronic
998272716 5:140721441-140721463 CTGGAGATAGATAGTGGTGATGG - Intergenic
998273465 5:140728516-140728538 CTGGAGATGGATAGTGGTGATGG - Intergenic
998705828 5:144758973-144758995 ATGGATATAAATAGTGATCAAGG + Intergenic
998801106 5:145870158-145870180 CTGGAGATGAATGGTGGTCATGG - Intronic
999199955 5:149808909-149808931 CTGGAGATGGATGGTGGTGATGG + Intronic
999403386 5:151284971-151284993 CTGGAGATGGATAGGGGTGATGG - Intronic
999647357 5:153731379-153731401 TTGGAGCTGAATTGTGAAGAAGG - Intronic
999746056 5:154592833-154592855 TTGGAGCTGGATAGTGGTCATGG - Intergenic
999794549 5:154976905-154976927 CTGGAGATGGATGGTGGTGATGG - Intergenic
999928116 5:156401859-156401881 TTGGAGATGGATGATGATGATGG - Intronic
1000035009 5:157439938-157439960 CTGGAGATGGATGTTGATGAGGG + Intronic
1000373997 5:160562475-160562497 ATGGAGATGAAAAGAGAGGAAGG - Intergenic
1000786337 5:165549035-165549057 TGGGAGGTGATTAGTCATGAGGG - Intergenic
1000976230 5:167767462-167767484 CCGGAGATGGATGGTGATGATGG + Intronic
1001039753 5:168325743-168325765 CTGGAGATGGATGGTGGTGATGG - Intronic
1001353635 5:170999827-170999849 CTGGAGATGAATGGTGGTGATGG - Intronic
1001472428 5:172024024-172024046 TTGGAGATGGGTGGTGGTGATGG - Intergenic
1001795281 5:174497112-174497134 CTGGAAATGGATAGTGGTGATGG - Intergenic
1001859916 5:175045161-175045183 CTGGAGATGGATGGTGGTGATGG + Intergenic
1001883713 5:175269531-175269553 CTGGAGATGGATAATGGTGATGG + Intergenic
1002083481 5:176751955-176751977 CTGGAGATGGATGGTGCTGATGG + Intergenic
1002147925 5:177200499-177200521 CTGGAGATGAATAGTGGTAATGG - Intronic
1002325263 5:178400625-178400647 CTGGAGATGGATGGTGGTGATGG - Intronic
1002358408 5:178649825-178649847 TGGGAGTTGCAAAGTGATGAAGG + Intergenic
1002360685 5:178668305-178668327 CTGGAGATGGATGGTGCTGATGG + Intergenic
1002904271 6:1436249-1436271 TTGGAGATGGGTAGTGGTGATGG + Intergenic
1003003683 6:2361024-2361046 TGGGAAATGATTAGTCATGAGGG - Intergenic
1003010709 6:2424570-2424592 CTGAAGATGGATGGTGATGATGG - Intergenic
1003043929 6:2715313-2715335 CTGGAGATGGATGGTGCTGACGG + Intronic
1003129670 6:3385148-3385170 CTGGAGATGGATGGTGGTGAGGG + Intronic
1003135220 6:3429959-3429981 CTGGAGATGGATGGTGGTGATGG + Intronic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003305118 6:4920232-4920254 CTGGAGATGCATGGTGGTGATGG + Intronic
1003311408 6:4972586-4972608 CTGGAGATGGATAGTGGCGACGG + Intergenic
1003371729 6:5534361-5534383 TTGGAGATAGATAGTGGTGATGG - Intronic
1003451391 6:6236791-6236813 TTGGAAATGAATTTTGATGTTGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003507902 6:6754664-6754686 CTGGAGATGAATGGTGGTCATGG - Intergenic
1003595572 6:7471320-7471342 CTGGAGATGGATGGTGGTGACGG - Intergenic
1003838412 6:10095154-10095176 CTGGAGATGGATAGTCATGGTGG + Intronic
1003934288 6:10959457-10959479 CTGGAAATGGATAGTGATGATGG + Intronic
1004015298 6:11726711-11726733 CTGGAGATGGATGGTGGTGATGG + Intronic
1004285834 6:14319747-14319769 CTGGAGATGGATGGTGGTGATGG + Intergenic
1004405935 6:15333653-15333675 CTGGAAATGGATAGTGGTGATGG - Intronic
1004622948 6:17347264-17347286 TGGGAGATGAGAAGTGAGGATGG - Intergenic
1004684281 6:17927577-17927599 CTGAAAATGAATAGTGGTGATGG + Intronic
1004813481 6:19286674-19286696 CTGGAGATGAATGGTGGAGATGG + Intergenic
1005036340 6:21558507-21558529 CTGGAAATGGATAGTGGTGATGG - Intergenic
1005056312 6:21732190-21732212 CTGGAGATGGATGGTGGTGATGG - Intergenic
1005319687 6:24640991-24641013 GTGGAGATAGATAGTGATGATGG - Intronic
1006181951 6:32159085-32159107 CTGGAGATGGATGGTGCTGATGG - Intronic
1006256198 6:32834551-32834573 CTGGAGATGGATGGTGATGATGG + Intronic
1006587469 6:35126055-35126077 CTGGAAATGGATAGTGGTGATGG + Intronic
1006614457 6:35316796-35316818 TTGGAAATAGATAGTGGTGATGG - Intronic
1006647485 6:35524796-35524818 CTGGAGATGGATGGTGGTGATGG + Intergenic
1007291797 6:40793112-40793134 TTGGGGATGGAAGGTGATGAGGG + Intergenic
1007750703 6:44069169-44069191 CTGGAGATGGATGGTGTTGATGG - Intergenic
1008488296 6:52058531-52058553 TGGGAGCAGAATAGGGATGAAGG - Exonic
1008608159 6:53160618-53160640 CTGAAGATGGATGGTGATGATGG - Intergenic
1008791676 6:55242282-55242304 CTGGAGGTGGATAGTGACGATGG - Intronic
1009004412 6:57765185-57765207 AAGAAGATGAAGAGTGATGATGG + Intergenic
1009658135 6:66572271-66572293 TTGGAGATCAATAGTGGCAATGG - Intergenic
1009892759 6:69707873-69707895 CAGAAAATGAATAGTGATGATGG + Intronic
1009956252 6:70457655-70457677 TTGATGAAGAATAGTGATCAAGG - Intronic
1010311554 6:74391969-74391991 TTTGAGATGAATAAAGCTGAAGG + Intergenic
1010582860 6:77620857-77620879 CTGGAGATGGATAGTGATGATGG - Intergenic
1010702922 6:79073678-79073700 TCAGAGATGAATAGGAATGATGG - Intronic
1010793622 6:80093339-80093361 TTGGAGATGAAGACTTTTGAGGG + Intergenic
1010930532 6:81796820-81796842 TTGGTGATGAATATTGTTGTGGG + Intergenic
1011345660 6:86367411-86367433 CTGGTGATGAATTGTGGTGATGG - Intergenic
1011571616 6:88743406-88743428 ATGGAGATGAATGGTGGTGATGG - Intronic
1011623721 6:89266698-89266720 CTGGCAATGAATAGTGGTGATGG - Intronic
1011637566 6:89388401-89388423 CTGGAGATGGATGGTGGTGAGGG + Intronic
1011740255 6:90352583-90352605 CTGGAAATGAATAGTGGTGATGG - Intergenic
1011748402 6:90431205-90431227 CTGGTGATGTACAGTGATGATGG - Intergenic
1011903981 6:92337686-92337708 TTGGAAATGACTAGAGTTGAAGG - Intergenic
1012159054 6:95859939-95859961 CTGGAAATAAATAATGATGAAGG - Intergenic
1012655219 6:101808793-101808815 TTGGACAGAAATAGTGCTGAGGG + Intronic
1012889499 6:104882635-104882657 CTGGAGGTGAATGGTGGTGATGG - Intergenic
1013003874 6:106052082-106052104 CTGGAGATGGATACTGATGATGG + Intergenic
1013351240 6:109307600-109307622 TTGGAGCACAATAATGATGAAGG + Intergenic
1013573504 6:111454477-111454499 CTGGAGATGGATAGTGATGATGG - Intronic
1013590408 6:111615100-111615122 CTGGAGATGGATTGTGATAATGG + Intergenic
1013626427 6:111941863-111941885 CTGGAAATGGATAGTGGTGATGG - Intergenic
1013973073 6:116043876-116043898 TTAGACATGAAAAGTGATAAAGG + Intronic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014218276 6:118774175-118774197 CTGGAAATGGATAGTGGTGATGG + Intergenic
1014634347 6:123826441-123826463 CTGGAGATGGATGGTGGTGATGG - Intronic
1015069849 6:129078718-129078740 GTAGAGCTGAATGGTGATGATGG - Intronic
1015150846 6:130035407-130035429 TTGGAGATGAGGAGTGGTGTAGG + Intronic
1015215039 6:130740383-130740405 CTGGAGATGAATGGTGGTGAGGG - Intergenic
1015220520 6:130799904-130799926 ATGGAGATGGATGGTGGTGATGG - Intergenic
1016274540 6:142333651-142333673 TTGAAGCTCAAAAGTGATGAAGG - Intronic
1016280257 6:142409110-142409132 GGGGAGATGGATAGTGGTGATGG - Intronic
1016861898 6:148729012-148729034 CTGGAAATGAATAGTGGTGGTGG + Intergenic
1017029684 6:150210275-150210297 TTGGAGAAGGACAGTAATGACGG - Intronic
1017089657 6:150747970-150747992 CTGGAGATGCATGGTGGTGATGG - Intronic
1017132444 6:151119256-151119278 CTGGAGATGGATGGTGGTGACGG + Intergenic
1017138571 6:151169833-151169855 CTGGAGGTGGATAGTGGTGATGG - Intergenic
1017223389 6:151992243-151992265 CTGGAGATGAATGGTGATAATGG - Intronic
1017500771 6:155020814-155020836 CTGGAGATGGATAGTGGTGAGGG - Intronic
1017648452 6:156560168-156560190 CTGGAAATGGATAGTGGTGATGG + Intergenic
1017846949 6:158266890-158266912 CTGGAGATGGATAGCGATGATGG - Intronic
1018539854 6:164867304-164867326 TGGGAGAAGAATGGTGGTGATGG + Intergenic
1018597252 6:165494876-165494898 ATTGAGATGGATAGTGTTGAAGG - Intronic
1018896435 6:168021609-168021631 GTGAAGATGGATAGTGGTGATGG - Intronic
1019138680 6:169929336-169929358 TAGGAGGTCAATAGTGAGGATGG + Intergenic
1019655185 7:2189702-2189724 TTGGAGGTGGATGGTGGTGATGG + Intronic
1019695192 7:2441964-2441986 TTGGAGATGGATGGTGGTAACGG - Intergenic
1019836659 7:3392538-3392560 TTGGAAATAAATAATGGTGATGG - Intronic
1019889685 7:3936602-3936624 TTGGAGATGTATAGTGGTGATGG + Intronic
1020033602 7:4950420-4950442 CTGGAGATGGATGGTGGTGACGG - Intronic
1020218230 7:6212352-6212374 CTAGAGATGGATAGTGATGATGG - Intronic
1020227716 7:6293358-6293380 CTGGAGATGGATGGTGGTGATGG - Intergenic
1020367643 7:7397275-7397297 TGGAAGATGCATCGTGATGATGG - Intronic
1020673163 7:11145012-11145034 ATGGAGATGAATGATGGTGATGG + Intronic
1020873342 7:13662281-13662303 ATGGAGATGAATGGTGGTGCTGG + Intergenic
1020898805 7:13976274-13976296 CTGAAGTTGAATAGTGGTGAAGG + Intronic
1021132503 7:16928191-16928213 TTAGAGAGGAAAAATGATGATGG - Intergenic
1021407949 7:20295711-20295733 TTGGAGATGAATGGTGTTGATGG - Intergenic
1021465877 7:20943148-20943170 ATGGAGATGGATGGTGTTGATGG + Intergenic
1021874326 7:25034479-25034501 CTGGAGATGGATGGTGATGATGG - Intergenic
1021968367 7:25944363-25944385 CTGGAGGTGGATGGTGATGATGG + Intergenic
1022013458 7:26328998-26329020 TTGGAGATGACTAATGGTGCAGG - Intronic
1022378027 7:29833229-29833251 TTGGAAACGGATAGTGATGCTGG + Intronic
1022399337 7:30022288-30022310 CTGAAGATGGATAGTGGTGATGG + Intronic
1022455538 7:30555223-30555245 TTGGAAATAGATAGTGGTGATGG - Intergenic
1022707329 7:32815976-32815998 TTAGAGATGAAAAGTGCTGTTGG - Intergenic
1023083961 7:36551442-36551464 CTGGAGATGGGTGGTGATGATGG - Intronic
1023223985 7:37950027-37950049 CTGGAGATGGATGGTGCTGATGG + Intronic
1023347195 7:39283349-39283371 CTGGAGATGGATAGCAATGATGG - Intronic
1023506624 7:40906088-40906110 CTGGAAATGGATGGTGATGATGG - Intergenic
1023592438 7:41794203-41794225 TGGGAGATTAATAGAGCTGATGG + Intergenic
1023711943 7:43004221-43004243 ATGCAGATGGATAGTGGTGATGG - Intergenic
1023928065 7:44685192-44685214 TTGGAGATGGGTGGTGGTGATGG - Intronic
1023979074 7:45055765-45055787 CTGGAGATGGATAGTGCTGATGG - Intronic
1024209980 7:47194754-47194776 TGGGAGATGAATACAGATGGTGG + Intergenic
1024968795 7:55050168-55050190 CTGGAGATGAATGGTGTTTATGG - Intronic
1026234007 7:68510138-68510160 TTGGAGAGAAACAGTGAAGATGG - Intergenic
1026358263 7:69578913-69578935 CTGGAAATGAATGGTGGTGATGG + Intergenic
1026433973 7:70377557-70377579 CCGGAGATGAACAGTGGTGATGG - Intronic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1027994835 7:85412639-85412661 TTTGACATGAGCAGTGATGATGG - Intergenic
1028233088 7:88329272-88329294 CTGGAGATGGATGGTGGTGAAGG - Intergenic
1028293062 7:89092242-89092264 TGGGAGGTGATTAGTAATGAAGG - Intronic
1028427969 7:90712220-90712242 CTGGAAATGGATAGTGGTGATGG - Intronic
1028599251 7:92583367-92583389 ATGAAAATGGATAGTGATGATGG + Intronic
1028828739 7:95304061-95304083 CTGGAGAGGGATGGTGATGATGG - Intronic
1029021847 7:97372383-97372405 CTGGAGATGGATAGTGGTGATGG - Intergenic
1029054156 7:97722780-97722802 CTGGAGATAAATGGTGGTGACGG + Intergenic
1029561540 7:101306236-101306258 CTGGAGATGGATGGTGGTGATGG + Intergenic
1030131865 7:106208291-106208313 CTGGAGATGGATAGTGATGAGGG + Intergenic
1030168463 7:106577828-106577850 TTGTAGATGAAGAGCAATGAAGG - Intergenic
1030199096 7:106884398-106884420 CTGGGGATGAATGGTGATGATGG - Intronic
1030266133 7:107624040-107624062 TTGCAGAAGAATATTGATGTAGG - Intronic
1030266188 7:107624621-107624643 CTGGAGATGGATGGTGGTGATGG + Intronic
1030347565 7:108451858-108451880 CTGGAGAGGTATAGTGGTGATGG + Intronic
1030566568 7:111164994-111165016 CTGGATATGAATGGTGGTGATGG - Intronic
1030585969 7:111419988-111420010 CTGGAAATGGATAGTGAGGATGG + Intronic
1030596764 7:111549170-111549192 TTGAAGATTAATAGTAAAGAAGG - Intronic
1030963868 7:115963825-115963847 TAGGAAATGGATAGTGGTGATGG + Intronic
1031831846 7:126637360-126637382 CTGGAGATGAGTAGTAGTGATGG + Intronic
1032059467 7:128712398-128712420 CTGGAGATGGATGGTGGTGATGG - Intronic
1032143705 7:129358656-129358678 TTGGAGATGGATGGTGGTGATGG + Intronic
1032185841 7:129725181-129725203 GTGGAGATGAATGATGGTGATGG + Intronic
1032446594 7:131989449-131989471 CTGGAGATGAATGGTGGTGATGG + Intergenic
1032683241 7:134207247-134207269 TTGGAAATAGGTAGTGATGATGG - Intronic
1033148850 7:138895613-138895635 CTGGAAATGGATAGTGGTGATGG + Intronic
1033210755 7:139458491-139458513 CAGGAGATGGATGGTGATGATGG - Intronic
1033328755 7:140400616-140400638 CTGGAGATGGATGGTGATGTTGG + Intronic
1033619318 7:143048349-143048371 TAGAAAATGAATAGTCATGAAGG + Intergenic
1034209709 7:149352706-149352728 CTGGAGATGTATGGTGATGATGG + Intergenic
1034261242 7:149757337-149757359 CTGGAGATGGATGGTGGTGATGG + Intergenic
1034458415 7:151184656-151184678 TTGGAGATGGATGGTGGCGATGG + Intronic
1035053636 7:156019266-156019288 TGTGAGATGAAAGGTGATGATGG - Intergenic
1035228623 7:157447407-157447429 CTGGAGATGGATGGTGGTGATGG - Intergenic
1035309896 7:157960239-157960261 TTGGAGATGGATGGTGGAGATGG + Intronic
1035542303 8:450839-450861 CTGGAGATGACTGGTGGTGATGG - Intronic
1035779887 8:2219768-2219790 TGGGAGAAGAAAAGTGATCAAGG - Intergenic
1035915876 8:3621507-3621529 ACAGAGATGAATAGTGGTGATGG + Intronic
1036030669 8:4968338-4968360 TTGGACGTGGATAGTGGTGATGG - Intronic
1036552105 8:9825035-9825057 CTGGAGATGGATGGTGATGACGG + Intergenic
1036574105 8:10009257-10009279 TTGAGGATGTAAAGTGATGAGGG - Intergenic
1036579842 8:10063593-10063615 TGGGAGGTGATTAGTCATGAGGG + Intronic
1036617731 8:10401958-10401980 TTGAAAATGGATAGTGGTGATGG + Intronic
1036706000 8:11047685-11047707 CTGGCGATGGATAGTGGTGATGG + Intronic
1036775739 8:11611922-11611944 CTGGAGATGGATGGTGGTGATGG + Intergenic
1036975145 8:13402730-13402752 TGTGAGATGAAAATTGATGATGG + Intronic
1037038719 8:14203625-14203647 ATGAAGATGAATAGAGGTGAAGG + Intronic
1037215600 8:16447592-16447614 TGGGAAATGAGTAGTCATGACGG - Intronic
1037295390 8:17395001-17395023 TTGGAAATTGATAGTGGTGATGG - Intronic
1037502270 8:19497430-19497452 TAGGAGATGAGTAGTCAGGAGGG - Intronic
1038042905 8:23741118-23741140 CTGGAGATGGATGGTGGTGATGG + Intergenic
1038135993 8:24786399-24786421 ATAAAGATGAATAGTGGTGATGG + Intergenic
1038185687 8:25272785-25272807 CTGGAGATGGATGGTGTTGATGG - Intronic
1038248995 8:25885325-25885347 CTGGATATGGATGGTGATGATGG - Intronic
1038311127 8:26447078-26447100 CTGGAGATGGACAGTGGTGATGG + Intronic
1038775777 8:30529318-30529340 TTGGAAATAGATAGTGGTGATGG - Intronic
1038855456 8:31326981-31327003 GTGGAGATGGATGGTAATGATGG - Intergenic
1039204612 8:35137645-35137667 TTGGAAATTAATAGTGATGGTGG + Intergenic
1039506155 8:38053952-38053974 TTGGAGATGATTGGCGGTGATGG + Intronic
1039937891 8:42063383-42063405 CTGGAGATGAATAGTGGTGATGG + Intergenic
1040022091 8:42749921-42749943 CTGGAGATGGATGGTGCTGAAGG + Intergenic
1040563707 8:48547106-48547128 GTGAACATGAATAGTGTTGAGGG + Intergenic
1040992292 8:53365594-53365616 TTGAAAATGAATAGTCATAATGG - Intergenic
1040992294 8:53365632-53365654 TTGAAAATGAATAGTCATAATGG - Intergenic
1041019642 8:53625849-53625871 CTGGAGGTGAATGGTGGTGATGG + Intergenic
1041061892 8:54042580-54042602 CTTGAGATGAATGGTGGTGATGG + Intergenic
1041101977 8:54405279-54405301 TTGGAGATGGATGGTGGTGATGG + Intergenic
1041146183 8:54878675-54878697 CTGGAGATGGATGGTGGTGATGG - Intergenic
1041715935 8:60932058-60932080 GTGGAGATGGATGGTGATGATGG - Intergenic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1042112864 8:65399554-65399576 CTGGAGATGAATGGTTGTGATGG + Intergenic
1042283850 8:67085157-67085179 CTGGAAATGGATAGTGATGATGG + Intronic
1042358942 8:67860453-67860475 TTGAAAATGAATAGTGAGGGAGG + Intergenic
1042592741 8:70413283-70413305 CTAGAGATGGATAGTGTTGAGGG - Intergenic
1042868351 8:73375687-73375709 CTGGAAATGGGTAGTGATGATGG + Intergenic
1042951857 8:74208587-74208609 CTGGAAATGGATAGTGGTGATGG - Intergenic
1043163245 8:76872079-76872101 TTGGAGATGTATATTGCAGAGGG + Intergenic
1043298493 8:78697263-78697285 GTGGAAATGAATGGTGATGATGG - Intronic
1043321673 8:78994380-78994402 CTGGAGATGGATGGTGATGATGG + Intergenic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1043876867 8:85494996-85495018 TTGGAGATGGATGTTGGTGATGG + Intergenic
1044716954 8:95108619-95108641 CTGGAGATGGATAGTGGCGATGG + Intronic
1044919988 8:97159206-97159228 TTAGAGATGGATGGTGGTGATGG - Intergenic
1045243172 8:100420214-100420236 CTGGAAATGGATAGTGGTGATGG - Intergenic
1045289474 8:100820181-100820203 CTGGAGATGGATGGTGGTGATGG + Intergenic
1045429573 8:102100962-102100984 CTGGAGATGGATGGTGGTGATGG + Intronic
1045431549 8:102119476-102119498 CTGGAGATGGATGGTGGTGATGG + Intronic
1046149606 8:110206127-110206149 TTGGAAATAGATAGTAATGATGG + Intergenic
1046531938 8:115457520-115457542 CTGGAGATGGATGGTGGTGATGG + Intronic
1046534096 8:115486325-115486347 TTGGAGAGGGAGAGAGATGAGGG - Intronic
1046803497 8:118454713-118454735 CTGGAGATCAATGGTGGTGATGG - Intronic
1046816090 8:118585353-118585375 CTGGAGATGGATGGTGATGATGG + Intronic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1047273538 8:123386574-123386596 CTGGAGATGAATGGTGATGATGG + Intronic
1047602141 8:126436258-126436280 TGGGAGATTAATTGTGGTGATGG - Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1048011002 8:130456176-130456198 CTGGAGATGGATGGTGGTGATGG + Intergenic
1048103871 8:131385863-131385885 TTTGAGATGGACAGTGGTGATGG + Intergenic
1048302504 8:133261794-133261816 CTGGAGATGGATGGTGGTGACGG + Intronic
1049224544 8:141443647-141443669 CTGGAGATGGATGGTGGTGATGG - Intergenic
1049518444 8:143074862-143074884 GTGGAGCTGAATGGTGCTGAGGG - Intergenic
1049916575 9:323588-323610 CTGGAGATGGATGGTGGTGATGG - Intronic
1049939569 9:532453-532475 CTGGAGATGGATGGTGATGATGG - Intronic
1050020206 9:1276009-1276031 TTGGAAATGGATGGTGGTGATGG + Intergenic
1050303286 9:4281362-4281384 TTGGAGATGGGTAATGGTGATGG - Intronic
1050323490 9:4477767-4477789 CTGGAGATGGATAGTGGTGACGG + Intergenic
1050382585 9:5045494-5045516 CTGGAGATGGATGGTGGTGATGG - Intronic
1050399411 9:5235356-5235378 TTGAAGATGAAGAGGGATCATGG + Intergenic
1050403879 9:5286519-5286541 CTGGAGATAGATAGTGGTGATGG + Intergenic
1051071464 9:13173181-13173203 CTGGAGATGGATGGTGATGATGG + Intronic
1051628904 9:19125237-19125259 TTAGAAATGGATAGTGGTGATGG - Intronic
1051806749 9:21002623-21002645 CTGGAGATGGACAGTGGTGATGG + Exonic
1051812980 9:21071517-21071539 CTGGAGATGAATAGTGGTGATGG + Intergenic
1052483406 9:29062744-29062766 CTAGAGATGGATAGTGATGATGG + Intergenic
1052597411 9:30577106-30577128 CTGGAGATGTATGGTGATGATGG + Intergenic
1052621480 9:30915829-30915851 CTGGAGATGAGTGGTGGTGATGG + Intergenic
1053296476 9:36918031-36918053 TAGGAGAAGAAGAGAGATGAGGG - Intronic
1053398399 9:37796638-37796660 CTGGAGATGGATGGTGGTGATGG - Intronic
1053474458 9:38372066-38372088 TTTGAGACGCAGAGTGATGAAGG - Intergenic
1053587281 9:39472446-39472468 TTGGAGATGGATGGTGGGGATGG - Intergenic
1054474472 9:65562980-65563002 CTGGAGATGTCCAGTGATGAAGG + Intergenic
1054579024 9:66892787-66892809 TTGGAGATGGATGGTGGGGATGG + Intronic
1054727787 9:68668969-68668991 TTGGAGATGGATGGTGGAGATGG + Intergenic
1054772590 9:69096751-69096773 CTGGAGATGGATGGTGGTGATGG - Intronic
1054790507 9:69252353-69252375 TTGGGGATGGATGGTGGTGATGG - Intronic
1054886579 9:70205250-70205272 CTGGAGATGGATGGTGGTGATGG - Intronic
1055531302 9:77186793-77186815 CAGGAGATGAATGGTGGTGATGG - Intronic
1055536553 9:77252568-77252590 CTGGAAATGAATGGTGGTGATGG - Intronic
1055977486 9:81969223-81969245 TTGGGGATGTATAGGGGTGAGGG - Intergenic
1056159904 9:83878811-83878833 TTGGAAATAGATAGTGGTGATGG + Intronic
1056249794 9:84735863-84735885 GTGGAGATTAGAAGTGATGAAGG + Intronic
1056360322 9:85851006-85851028 TTGGAAATAGATAGTGGTGATGG - Intergenic
1056420153 9:86416641-86416663 CTGCAGATGAATGGTGGTGATGG + Intergenic
1056444557 9:86653297-86653319 CTGGAGATGGATAGTGGTGATGG - Intergenic
1056461592 9:86814296-86814318 TGGGAGATGGATGGTGGTGATGG + Intergenic
1056535374 9:87523167-87523189 CTGGAGATGGATAGTGGTGATGG - Intronic
1056685188 9:88753411-88753433 CTGGAGATGGATGGTGGTGATGG - Intergenic
1056749236 9:89334850-89334872 CTGAAGATGGATGGTGATGATGG + Intronic
1056903865 9:90627588-90627610 TTAGAGATGGATGGTGGTGATGG + Intronic
1057058201 9:91980195-91980217 CTGGAGATCAATGGTGGTGATGG + Intergenic
1057229467 9:93310994-93311016 ATGGAGATGAACAGTGGTGGTGG - Intronic
1057242562 9:93424247-93424269 CTGGAAATGGATAGAGATGATGG - Intergenic
1057301278 9:93885423-93885445 TTGGAAATAGATAATGATGATGG + Intergenic
1057334134 9:94142536-94142558 CTGGAGATGAATGGTGGTGTTGG + Intergenic
1057359286 9:94358651-94358673 CTGGAGATGGACAGTGGTGACGG + Intergenic
1057637744 9:96786606-96786628 TTGGAGATGTAGAGGGCTGAAGG - Intergenic
1057648479 9:96898939-96898961 CTGGAGATGGACAGTGGTGACGG - Intronic
1057825172 9:98367536-98367558 TTGGAGATGGATGGTGATGATGG + Intronic
1058057139 9:100460121-100460143 CTGGAAATGGATAGTGGTGATGG + Intronic
1058196314 9:101980921-101980943 TTGGACATGAATAATGTTAAAGG + Intergenic
1058691893 9:107526994-107527016 CTGGAGATGGATGGTGATGATGG - Intergenic
1059137232 9:111818791-111818813 GCGGAGATGGATAGTGATGATGG + Intergenic
1059315145 9:113418149-113418171 CTGGAAATGGATAGTGCTGATGG - Intronic
1059373922 9:113866772-113866794 ATGAAGATGAATAGTGGTGATGG + Intergenic
1060239327 9:121889453-121889475 CTGGAGATGGAAGGTGATGATGG - Intronic
1060392424 9:123289248-123289270 TGGGGTATGAATAGTGGTGATGG - Intergenic
1060475224 9:123981811-123981833 TTAGAGATGGATGGTGGTGATGG + Intergenic
1060576596 9:124701475-124701497 CTGGAAATGGATAGTGATGCTGG - Intronic
1060604833 9:124904343-124904365 TTGGAGATGGATGGTGGTGATGG + Intronic
1060621611 9:125072617-125072639 ATGGAGATGGATGGTGGTGATGG - Intronic
1060699208 9:125736186-125736208 TTGGAGAAAGATAGTGGTGATGG + Intergenic
1060809322 9:126601759-126601781 CTGGAGACAAATAGTGGTGATGG + Intergenic
1061223454 9:129266265-129266287 CTGGAGATGGATGGTGGTGATGG - Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061327199 9:129871105-129871127 CTGGAGATGAATGGGGAGGATGG - Intronic
1061443191 9:130621045-130621067 TTGGATATGGATGGTGGTGATGG + Intronic
1061501558 9:131006191-131006213 CTGGAGATGGATGGTGGTGATGG + Intergenic
1061503362 9:131016314-131016336 CTGGAGATGGATGGTGGTGAAGG + Intronic
1061544350 9:131295575-131295597 CTGGAGATGGATGGTGGTGATGG - Intronic
1061560743 9:131401263-131401285 CTGGAGATGGATGGTGGTGATGG - Intronic
1061611908 9:131752447-131752469 CTGGAGATGGATGGTGGTGATGG - Intergenic
1061656137 9:132091733-132091755 CTGGAGATGAGTGGTGGTGATGG + Intergenic
1061785369 9:133024698-133024720 TAGGAGATGAATACAGATCAGGG - Intergenic
1061826079 9:133259032-133259054 CTGGAGATGGATGGTGGTGATGG + Intronic
1062415803 9:136448926-136448948 CTGGAGATGGATGGTGGTGATGG + Intronic
1062619463 9:137413183-137413205 CTGGAGTTGGATAGTGGTGATGG - Intronic
1203734257 Un_GL000216v2:120722-120744 CTGGAGATGGATGGTGGTGATGG + Intergenic
1185555858 X:1020577-1020599 TTGGAGGTGGTTAGTGATGATGG - Intergenic
1185696848 X:2201371-2201393 TTGGAACTCAAGAGTGATGATGG - Intergenic
1185827735 X:3268562-3268584 TTCGAACTGAATAGAGATGATGG - Intergenic
1185916398 X:4040516-4040538 CTGGTGGTGAATGGTGATGACGG + Intergenic
1185925446 X:4140786-4140808 CTGGAGATGAATAATGGTGATGG - Intergenic
1186210800 X:7248787-7248809 CTAGAGATGGATAGTGGTGATGG - Intronic
1187463537 X:19508471-19508493 CTGGAGATGGATATTGTTGATGG + Intronic
1187481270 X:19657975-19657997 CTGGAGATGGATGGTGGTGATGG + Intronic
1187482125 X:19667258-19667280 CTGGAGATGGATAGTGATGACGG + Intronic
1187560680 X:20400132-20400154 TTGAAAATGGATGGTGATGATGG - Intergenic
1187630091 X:21159746-21159768 CTGGAAATGAATAGTTGTGAGGG + Intergenic
1187758476 X:22552358-22552380 TTGGAGATGGATGGTGGTGGTGG + Intergenic
1187961399 X:24569814-24569836 CTGGAGATGGATGGTGGTGATGG + Intronic
1188227645 X:27621246-27621268 GTGGAGATCGATGGTGATGATGG + Intronic
1188412602 X:29892370-29892392 TGGGACATCATTAGTGATGATGG - Intronic
1188435848 X:30157634-30157656 CTGGAGATGGATAGTGGTTATGG + Intergenic
1188509407 X:30919263-30919285 CTGGAAATGGATAGTGGTGATGG - Intronic
1188559701 X:31453515-31453537 CTGGAGATGGATGGTGGTGATGG + Intronic
1188573014 X:31612054-31612076 CTAGAGATGGATAGTGGTGATGG - Intronic
1188912739 X:35869850-35869872 TTGAAGATGAGTGGTGGTGATGG - Intergenic
1189290837 X:39884837-39884859 CTGGAGATGAATGGTGGTGATGG + Intergenic
1189345243 X:40236135-40236157 CTGGAGATGGATAATGGTGATGG - Intergenic
1189426377 X:40905171-40905193 ATGGAGATGGAAAGTAATGATGG + Intergenic
1189457219 X:41203271-41203293 TTGGAGATGGGTGGTGGTGATGG - Intronic
1189504769 X:41601163-41601185 CTGGAGATGGATAGTGATGATGG + Intronic
1189914706 X:45845374-45845396 CTGGAGATGAGTGGTGGTGAAGG + Intergenic
1190511007 X:51174431-51174453 CTGGAGATGGATGGTGGTGATGG + Intergenic
1190858227 X:54317990-54318012 CTGGAGATGGATATTGCTGAGGG + Intronic
1191709190 X:64130811-64130833 CTGGAAATGGATAGTGGTGATGG + Intergenic
1192015987 X:67331840-67331862 CTGGAGATGGATGGTGGTGATGG - Intergenic
1192348756 X:70336827-70336849 TTGGAGGTGGATGGTGGTGATGG - Intronic
1192413612 X:70957190-70957212 CTGGAAATGGATGGTGATGATGG + Intergenic
1192555701 X:72087419-72087441 TTGGAAATCCATAGTGGTGATGG + Intergenic
1192596719 X:72417093-72417115 TTGTAAATAAATAGTGATGATGG - Intronic
1192666488 X:73093263-73093285 TTGGAAATGTATAGTGGTGATGG + Intergenic
1192677730 X:73216191-73216213 CTGGAGATGTATGGTGATGATGG + Intergenic
1192845308 X:74901066-74901088 CTGGAGATGGATGGTGGTGATGG + Intronic
1193304732 X:79934650-79934672 GTGGTGATGGATAGTGATGATGG + Intergenic
1193730964 X:85102365-85102387 CTGGAGATGGATAGTGGTGCTGG + Intronic
1194702431 X:97130664-97130686 CTGGAGATGGATAGTGGTGATGG + Intronic
1195058971 X:101175554-101175576 TTGGAAATGAATTGAGCTGAAGG + Intergenic
1195091231 X:101461158-101461180 CTGGAGATGGACAGTGGTGATGG - Intronic
1195096447 X:101505810-101505832 CTGGAGATGAATGGTGGTAATGG - Intronic
1195280211 X:103325976-103325998 CTGGAGATGAACAGTAGTGATGG - Intergenic
1195594366 X:106672220-106672242 TTGGAAATGAATAGTGGTGATGG - Intronic
1195672259 X:107479717-107479739 CTGGAGATGAATGGTGGTGATGG + Intergenic
1195800184 X:108700137-108700159 TTGGAGCTGCCTAGGGATGAAGG - Intergenic
1195956641 X:110338130-110338152 ATGGAGATGGATGGTGGTGATGG + Intronic
1196290171 X:113930545-113930567 GTGAAGATGCATAGTGGTGATGG - Intergenic
1196290226 X:113931681-113931703 GTGAAGATGGATAGTGGTGATGG + Intergenic
1196338045 X:114562174-114562196 ATGGAGATGAATATTGGGGATGG + Intergenic
1196606053 X:117658310-117658332 CTAGAGATGGATAGTGATGATGG + Intergenic
1196608050 X:117678260-117678282 CTGGAAATGGATAGTGGTGATGG - Intergenic
1196673589 X:118395418-118395440 CTGGAGATGGATGGTAATGATGG + Intronic
1196707941 X:118732130-118732152 ATGGGGATGGATGGTGATGATGG - Intronic
1196929894 X:120671054-120671076 CTGGAGATGGATGGTGTTGATGG + Intergenic
1197422446 X:126255415-126255437 GTGGTGATGGATGGTGATGAAGG - Intergenic
1197450369 X:126606092-126606114 TTGGAAATAGATAGTGGTGATGG + Intergenic
1197555843 X:127952049-127952071 TTGGGAATAGATAGTGATGATGG - Intergenic
1197577441 X:128233227-128233249 CTGGAGATGCATGGTGGTGATGG + Intergenic
1197639544 X:128952691-128952713 TTAGAGTTGAATAGTGGTTATGG + Intergenic
1197681098 X:129386360-129386382 CTGGAGATGGGTAGTGATGATGG - Intergenic
1197740720 X:129891285-129891307 TTGAAGATGAATGGTGGGGAGGG + Intergenic
1197964608 X:132045364-132045386 TTGGTGATTGCTAGTGATGAAGG + Intergenic
1197994943 X:132362957-132362979 CTGGAGGTGAATGGTAATGATGG - Intergenic
1198738066 X:139809583-139809605 CTGGAAATGGATAGTGGTGATGG + Intronic
1199257893 X:145737928-145737950 GTGGAGCTGCATATTGATGATGG - Intergenic
1199287874 X:146074058-146074080 CTGGAGATAAATGGTGGTGATGG - Intergenic
1199604040 X:149562516-149562538 TTTGAGATGAACGGTGGTGATGG + Intergenic
1199783874 X:151086625-151086647 CTGGAGATGAACAGTGGTAATGG - Intergenic
1199800833 X:151248985-151249007 CTGGAGATGGATGGTGGTGATGG + Intergenic
1199899360 X:152157957-152157979 TTGGAAAGGAATAAAGATGAGGG + Intergenic
1201116349 Y:10838239-10838261 TTGGAGTTGAATAGAGTGGATGG - Intergenic
1201224698 Y:11807537-11807559 CTGGAAATGAATAGTGGTGATGG + Intergenic
1202358888 Y:24083292-24083314 TTGGAGGTGAGAAGTTATGAAGG + Intergenic
1202511890 Y:25586822-25586844 TTGGAGGTGAGAAGTTATGAAGG - Intergenic
1202626754 Y:56867713-56867735 CTGGAGATGGATGGTGGTGATGG - Intergenic