ID: 1112775780

View in Genome Browser
Species Human (GRCh38)
Location 13:102842920-102842942
Sequence CTTTAACAGTAATAGCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112775780_1112775783 6 Left 1112775780 13:102842920-102842942 CCCTACTGCTATTACTGTTAAAG 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1112775783 13:102842949-102842971 GTGCCATCATTAGGCCAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 56
1112775780_1112775782 -3 Left 1112775780 13:102842920-102842942 CCCTACTGCTATTACTGTTAAAG 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1112775782 13:102842940-102842962 AAGAACTGTGTGCCATCATTAGG 0: 1
1: 0
2: 1
3: 8
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112775780 Original CRISPR CTTTAACAGTAATAGCAGTA GGG (reversed) Intronic
905482944 1:38274181-38274203 CTTTAACTGTAACAGCAGCCAGG - Intergenic
906836925 1:49093943-49093965 CTTTAACAGAAATAGCAATGGGG + Intronic
907026514 1:51125391-51125413 CTTGAAGTTTAATAGCAGTAGGG + Intronic
908281247 1:62538110-62538132 CTTTAATACTAATACCAGAATGG + Intronic
911162871 1:94699270-94699292 CTTTGACAGTAAACCCAGTAGGG + Intergenic
911781307 1:101882873-101882895 GTTTTACAGTAACAACAGTAAGG + Intronic
912074743 1:105859437-105859459 TTTTTAAAGTAATAGAAGTAAGG - Intergenic
916799867 1:168206751-168206773 CTTTCTCAGTATCAGCAGTAAGG + Intergenic
917006498 1:170421095-170421117 CTTTAACAGCAAAAGAAGTTTGG + Intergenic
917192333 1:172431319-172431341 CTTTATCTGTATTAACAGTAAGG - Intronic
917455331 1:175181258-175181280 TTTTTACAGTAATAGCAGTGAGG - Intronic
917577632 1:176340570-176340592 GATTAACAATAATAGCAATAAGG + Intergenic
918977177 1:191504555-191504577 CTTTAACAGAAGTATTAGTAGGG + Intergenic
921881670 1:220261858-220261880 TTTTAGCAGTAAAAGCAGTCAGG + Intronic
921987599 1:221329194-221329216 CTTTAAGAGTGATATCAGCAGGG + Intergenic
923795187 1:237147315-237147337 CTCTTACAGTAATAGAAATAGGG - Intronic
924313260 1:242768891-242768913 CTTCAATAAAAATAGCAGTAGGG - Intergenic
1063280024 10:4618129-4618151 TTTTAGCAGTATTAGCAATATGG - Intergenic
1065774476 10:29106701-29106723 TTATAACAGTAATACCAGAAAGG - Intergenic
1073274732 10:102300357-102300379 ATTAGACAGTGATAGCAGTAGGG + Intronic
1075922649 10:126225937-126225959 CTTTAACAGAAATGGGAGTGCGG + Intronic
1077826742 11:5818634-5818656 TTTAAAAAGTAATAGCAGTAAGG + Intronic
1080148171 11:29015160-29015182 ATTTAGCAGTAATAACAGTCAGG + Intergenic
1080566782 11:33516959-33516981 CTTTGAGAGTAATAGCAATTAGG - Intergenic
1080768702 11:35320791-35320813 CTTTAACATCAACAACAGTATGG - Intronic
1087487809 11:98780004-98780026 ATGTAACAGTACTAGCATTATGG + Intergenic
1088213991 11:107487384-107487406 CTTTAACAATTAAAACAGTATGG + Intergenic
1088763222 11:112951504-112951526 CTATAACAGTAATAATAATAAGG - Intergenic
1090737721 11:129625527-129625549 ATTTAAAAGTAATAGTAATAAGG - Intergenic
1090889395 11:130909920-130909942 CTTGAAAAATAAGAGCAGTAGGG - Intronic
1095544015 12:43344198-43344220 CTATCACAGGAATAGCAGGATGG + Intergenic
1097393281 12:59041746-59041768 CAATAACAGTATTAGCAATAGGG - Intergenic
1097928377 12:65156849-65156871 TTTTAACTTTAATAGCTGTATGG + Intergenic
1099653056 12:85454223-85454245 CTTTAACAGTGAAAGCATTGAGG + Intergenic
1100221599 12:92510130-92510152 CTTTTGCAGTAGTAGCAATAAGG - Intergenic
1101191181 12:102334538-102334560 CTGTAACAACAATAGCACTAAGG - Intergenic
1102853108 12:116269529-116269551 CTTTAACAGTAATGGAGGCAGGG + Intronic
1103429832 12:120874065-120874087 CTTTAACATTAGTTGTAGTAGGG - Intronic
1106630237 13:31464244-31464266 CTTTAAATGTAATAGAAGTTTGG - Intergenic
1109507414 13:63323150-63323172 CATTAACAGTATTGACAGTATGG - Intergenic
1110031090 13:70614836-70614858 CTTAAGTAGTAATAGGAGTAGGG + Intergenic
1111801293 13:92984226-92984248 CTTTAGGAGTAAGAGCATTATGG + Intergenic
1112775780 13:102842920-102842942 CTTTAACAGTAATAGCAGTAGGG - Intronic
1117017432 14:51532816-51532838 TCTCAACAGTAATAGTAGTAAGG + Intronic
1117640915 14:57798802-57798824 CTTTTACAGTAAATGCAGCAAGG + Intronic
1120169965 14:81238200-81238222 CTTTCACAGTGACAGGAGTAGGG + Intergenic
1120572985 14:86144471-86144493 CATTAAGAGTAATAGAAGAAGGG + Intergenic
1125790628 15:42362922-42362944 CTTAGACAGTAAAAGCAGGAAGG - Intronic
1137342201 16:47619518-47619540 CTATAACAGTAATTTTAGTAGGG + Intronic
1138628290 16:58270947-58270969 ATTTGACAGTAATAGCACAAAGG - Intronic
1145016307 17:19400570-19400592 CTTTAACAGTGAAAACAGTCAGG - Intergenic
1149306601 17:55353403-55353425 TTATAACAGTAATAGCACAAAGG + Intergenic
1149312905 17:55412887-55412909 CTTTAACATGAAAAGTAGTAAGG - Intronic
1153319411 18:3757688-3757710 CTTTATCATTAATAGCTGTTGGG - Intronic
1153719360 18:7885874-7885896 CCTTAACAGTAATGGTAGAAAGG + Intronic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1154309751 18:13257860-13257882 CTTTAACAGTAGTGGTAGTTTGG + Intronic
1157709078 18:49836281-49836303 CTTTAAAACTAATTGCAATATGG - Intronic
1160474471 18:79169986-79170008 CAGTAACAGTAATGACAGTATGG - Intronic
1167718951 19:51164527-51164549 CTTTAAAAGGCATATCAGTAGGG + Intergenic
925520770 2:4742385-4742407 AGTGTACAGTAATAGCAGTATGG - Intergenic
925645522 2:6031935-6031957 CTTTAACAGGAATAGAGGCATGG + Intergenic
927269001 2:21185513-21185535 CTTCAACTGCAATAGCAGTGGGG - Intergenic
929843026 2:45490788-45490810 GTTTAAAAGAAATGGCAGTATGG - Intronic
933043991 2:77509962-77509984 CTGTAAAAGTAATAGCAGAGAGG - Intronic
933235824 2:79863601-79863623 TCTTAACACTAATAGCAGTTTGG + Intronic
937995128 2:127688224-127688246 ATTTAACAGTAACAGCACAAAGG - Intergenic
939263199 2:139836446-139836468 TTTTAACAGTACTAGCTATATGG - Intergenic
942160657 2:173182885-173182907 CATTAACAGTAACAGAAGTGAGG + Exonic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
944745367 2:202650421-202650443 CTTTAAAAGTAATAAAAATATGG + Intronic
945752956 2:213811184-213811206 GTTTAACAGTAAGAACATTAAGG + Intronic
947342058 2:229150714-229150736 CTTTAACAGTATAAGCACTGTGG + Intronic
947944260 2:234086838-234086860 CATTAAAAGTAATAGCAGGCTGG - Intergenic
948012861 2:234663922-234663944 CTTTTACAGTCGTAGCTGTAGGG + Intergenic
948095643 2:235332112-235332134 GTTTGTCAGCAATAGCAGTATGG + Intergenic
948579641 2:238976474-238976496 GTATAACAATAATAGCAGAAAGG + Intergenic
1177259967 21:18717128-18717150 CCCTAACAGTAAGAACAGTAGGG + Intergenic
1178738835 21:35177552-35177574 CTTTACCAGTACTAGAAATATGG + Intronic
1179518721 21:41928113-41928135 CTTTAACATGAAGAGCAGAAGGG + Intronic
1181924069 22:26343792-26343814 CTTTAACAGGAATAACAATCAGG - Intronic
1184927528 22:47653769-47653791 CTTTAGTGGTAATACCAGTAGGG + Intergenic
949174125 3:1037969-1037991 TTGTAGTAGTAATAGCAGTAGGG + Intergenic
950164524 3:10784113-10784135 CTCTAACAGGAAATGCAGTAGGG + Intergenic
957333372 3:78794894-78794916 CTTTACCAGTAATTGCATTCTGG + Intronic
957970565 3:87376514-87376536 ATTTCACAGTAAAAGAAGTATGG - Intergenic
959301867 3:104612823-104612845 CTGTAACAGCAATATCAATACGG + Intergenic
960112848 3:113862280-113862302 CTTTTACAGTCACAGCTGTAGGG - Intronic
963415471 3:144990536-144990558 CTTTACCAGTAATCACAGAAAGG - Intergenic
965134394 3:164742801-164742823 CTTCCACAGTAATAACAGTGTGG + Intergenic
966548292 3:181176418-181176440 CTTGAACAGTATTTGCATTAGGG + Intergenic
966570417 3:181436069-181436091 CTTAAAGAGTAATAGAAGTTTGG + Intergenic
967785246 3:193486397-193486419 CTTGAACCGTAATAGTGGTAGGG + Intronic
974908810 4:68089980-68090002 CCTTAACTGTCATAGCAGAAAGG - Intronic
976078817 4:81331180-81331202 GTTTAAAAGTAATAACAGTGTGG + Intergenic
976148491 4:82067843-82067865 ATATAACTGTAATAGCAGTGTGG - Intergenic
979098755 4:116587918-116587940 CTGTAACAGGAATAAAAGTAGGG - Intergenic
979572878 4:122251155-122251177 CTTTACCTGTAATAGGAGTATGG + Intronic
981057447 4:140378883-140378905 CTTTAAAAATAATAACTGTACGG + Intronic
983315015 4:166120814-166120836 AATTAACAGTAATAGTATTAAGG - Intergenic
988319827 5:29680425-29680447 CTATAACAGTAACAGCACAAAGG - Intergenic
991622556 5:68559880-68559902 CTTTAACATTAATGGCAGAAAGG + Intergenic
992167170 5:74065668-74065690 CTATAACTGTTAAAGCAGTATGG + Intergenic
992571466 5:78063269-78063291 TTTCCACAGTAATAGCAGTTCGG + Intronic
993082865 5:83323681-83323703 GTTGAACAGTAAAAGTAGTAAGG + Intronic
993118699 5:83748450-83748472 GTATAACAGTAATAGCAAAAAGG - Intergenic
993352201 5:86864201-86864223 CTTTAACAGTAATTGGCGTGTGG - Intergenic
994163291 5:96581137-96581159 TTTTAACAGTAACAGTAGAAAGG + Intronic
994615891 5:102103871-102103893 TTTTATCAGAAATAGCCGTAAGG + Intergenic
995163365 5:109008682-109008704 CTTAAACAATAATAGCAGGCCGG + Intronic
996331559 5:122335493-122335515 CTTTAAAAGTTATGGCAGTCAGG - Intronic
1004990687 6:21134685-21134707 CTTGAAAAGTAATTGCAGTGAGG + Intronic
1008170717 6:48202323-48202345 CTTTTACAGTCACAGCTGTAGGG + Intergenic
1008378907 6:50821074-50821096 CTTTAACAGAAATGGCAGTCAGG + Intronic
1013200022 6:107885392-107885414 CATTTACAGTAATACCAGAAAGG + Intronic
1014573559 6:123041657-123041679 TTTTAATAGTAATGGCAGAAAGG + Intronic
1016263644 6:142205885-142205907 TTTGAACAGTAATAGAATTATGG + Intronic
1017410633 6:154164069-154164091 ACTTTACATTAATAGCAGTATGG - Intronic
1020412272 7:7905919-7905941 CTTTAAAAATAATAGTAGTATGG + Intronic
1020749953 7:12128439-12128461 CTTTAAAAGTAATAGCAAAAGGG - Intergenic
1022311919 7:29205012-29205034 ATTCTAAAGTAATAGCAGTAAGG + Intronic
1023060840 7:36324600-36324622 TTTTTCCAGGAATAGCAGTAAGG - Exonic
1023775515 7:43602327-43602349 TTTTAACAAGTATAGCAGTAAGG - Intronic
1026666813 7:72347831-72347853 CATTGAAAGTAATGGCAGTAGGG + Intronic
1036053238 8:5223985-5224007 CTTTTACAATAATTACAGTAAGG - Intergenic
1036145624 8:6252241-6252263 CATTAAAAGTAATAGCAGCCGGG + Intergenic
1038306676 8:26409818-26409840 CTTCAACAGCAAAAGCAGAAGGG - Intronic
1038753127 8:30315387-30315409 CTTTAACAGGAAAAGCTCTAGGG + Intergenic
1041135581 8:54754611-54754633 CATTAAAAGTAATAGCAAAATGG + Intergenic
1043288543 8:78566983-78567005 CTTCAACATCAATATCAGTAAGG + Intronic
1043843055 8:85131922-85131944 CTTCAACAGTTAAAGCAATACGG - Exonic
1045656139 8:104388816-104388838 CAGTAACAGTAATAGCTGCATGG + Intronic
1046271251 8:111900554-111900576 CTTTATCAGTGAAGGCAGTATGG + Intergenic
1050073987 9:1844955-1844977 GTTGAACAGTAATAGTAGGAGGG - Intergenic
1051008759 9:12383531-12383553 TTTTAAAAATAATATCAGTAGGG - Intergenic
1051560512 9:18436085-18436107 ATTTAACAGTAATAGAATTGGGG + Intergenic
1052085282 9:24257704-24257726 CTTTAACAGTCATAGCATTTGGG - Intergenic
1053542925 9:38993555-38993577 CTCCAACAGTAATGGCAGTATGG + Intergenic
1053807368 9:41817072-41817094 CTCCAACAGTAATGGCAGTATGG + Intergenic
1054623224 9:67370355-67370377 CTCCAACAGTAATGGCAGTATGG - Intergenic
1185560764 X:1058866-1058888 CTTTAATGGGAATAGCAGAAAGG + Intergenic
1188918459 X:35941532-35941554 CTTTTACAGTAATACTATTAAGG - Intronic
1189620186 X:42828378-42828400 TTTTAACATAAATAGCAGTTTGG - Intergenic
1190571102 X:51782609-51782631 CTTTACCAGTTATAGGAGTAGGG - Intergenic
1193640344 X:84004226-84004248 CTTTTACAGTAGTAGCAGACTGG - Intergenic
1196903052 X:120405003-120405025 CTTTAACATTTTTTGCAGTATGG + Intergenic
1201912603 Y:19147985-19148007 CTATAACAATAATTGCAGCAAGG + Intergenic