ID: 1112776970

View in Genome Browser
Species Human (GRCh38)
Location 13:102854912-102854934
Sequence TTCTGTGTTTGAAGTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 417}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112776963_1112776970 26 Left 1112776963 13:102854863-102854885 CCTCTCTGTGGACTCCTCTTCCT 0: 1
1: 1
2: 0
3: 42
4: 543
Right 1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG 0: 1
1: 1
2: 4
3: 39
4: 417
1112776964_1112776970 12 Left 1112776964 13:102854877-102854899 CCTCTTCCTCTGTCTCTCTCTTA 0: 1
1: 0
2: 43
3: 471
4: 3306
Right 1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG 0: 1
1: 1
2: 4
3: 39
4: 417
1112776966_1112776970 6 Left 1112776966 13:102854883-102854905 CCTCTGTCTCTCTCTTAATGGTT 0: 1
1: 0
2: 2
3: 38
4: 403
Right 1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG 0: 1
1: 1
2: 4
3: 39
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112776970 Original CRISPR TTCTGTGTTTGAAGTGAAGG TGG Intronic
900031540 1:376274-376296 TTCTGTCTGTGAGGTGAAGCGGG - Intergenic
900052091 1:604474-604496 TTCTGTCTGTGAGGTGAAGCGGG - Intergenic
901227176 1:7620493-7620515 TTCTGTGAGAGAAGGGAAGGAGG - Intronic
901895477 1:12308184-12308206 GTCTGTGCTTGGAGTGGAGGCGG + Intronic
902105037 1:14027972-14027994 TTCTGTCTTTGTAGAGATGGTGG + Intergenic
902263390 1:15244171-15244193 TTCTGTTTTTGAAATGAAAATGG + Intergenic
902737050 1:18408142-18408164 TGCTCTGTTTGAAGTGAGGGTGG + Intergenic
902794021 1:18788477-18788499 TTCTGTGTATGGTGTGAAGGAGG - Intergenic
902985906 1:20153986-20154008 TCCTGTCTCTGAAGAGAAGGAGG + Intergenic
905703351 1:40036019-40036041 TTTTGTATTTTTAGTGAAGGGGG - Intergenic
905931747 1:41792764-41792786 TTCAGTGTATGCAATGAAGGTGG - Intronic
905938549 1:41844178-41844200 TTCTCAGTTTGCAGTGGAGGTGG - Intronic
908040597 1:60108359-60108381 TTGTGAGTGTGAAGTGAAGGAGG - Intergenic
909889344 1:80984046-80984068 TTCAGTGTTTGAAATCAATGTGG + Intergenic
910182708 1:84503653-84503675 TTTTCTGTTTAAAGTGTAGGTGG + Intronic
910369800 1:86503596-86503618 TTCTGGGTTTGTGGTGATGGAGG + Intergenic
910373881 1:86548508-86548530 TTTTGTATTTTTAGTGAAGGCGG - Intronic
910432126 1:87169259-87169281 CTCTGTGTGTGAATTGAATGGGG + Intergenic
911294350 1:96096131-96096153 TTCTGTGTTTGAAGATATGTGGG + Intergenic
912271977 1:108220768-108220790 TTCTGTGTTTGTACTGGAGGTGG + Intergenic
913168302 1:116209600-116209622 TTCTGTGATGGAGGTGAAAGGGG - Intergenic
913556653 1:119973998-119974020 TACTGTGTTTGAAGGTAAGTTGG + Intronic
914837978 1:151223816-151223838 TTTTGTGTTTTTAGTGGAGGCGG - Intronic
917140862 1:171834109-171834131 TTTTGTGTTTTTAGTAAAGGTGG + Intergenic
918100307 1:181366987-181367009 TTCTGTGTCTGTGGTGAAGGAGG + Intergenic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919734760 1:200939781-200939803 TTTTGTGTTTTTAGTGAAGATGG + Intergenic
920782640 1:209009300-209009322 TCCTCTGTTGGAAGTAAAGGAGG + Intergenic
922004277 1:221513370-221513392 TTATTTTTTTTAAGTGAAGGAGG + Intergenic
922383276 1:225055384-225055406 TTCTTTATTTGCAGTGATGGGGG + Intronic
922927437 1:229361756-229361778 ATCGGTGTTTGAAGTGATAGTGG + Intergenic
923762644 1:236860823-236860845 TTCTGTTTTGGAAGTGTATGAGG + Intronic
924742629 1:246804512-246804534 TTCTGTGTTTGATGTAAGGTAGG - Intergenic
924743976 1:246815595-246815617 TTTTGTGTTTTTAGTGGAGGCGG - Intergenic
1063594180 10:7418619-7418641 GTGTGTGTGTGAAGCGAAGGAGG + Intergenic
1063935670 10:11075324-11075346 TTCTGTTTTAGAAGAGACGGGGG - Intronic
1064272239 10:13875923-13875945 TGATGTGTATAAAGTGAAGGTGG + Intronic
1064310959 10:14211368-14211390 TTCTGGGTTTGAAGTCACGTGGG + Intronic
1066528193 10:36305661-36305683 TTTTCTGTTTGCAGTGATGGGGG - Intergenic
1067746687 10:48941489-48941511 TTCTGTGTGGGTTGTGAAGGAGG + Intronic
1068142068 10:53021738-53021760 TTCTGTGTTTGATGGGAATGTGG - Intergenic
1068165157 10:53321283-53321305 TTCAGTGTCTGTAGTGGAGGAGG - Intergenic
1068208479 10:53889049-53889071 TTGTGTGTTTGGAGTGATGTAGG - Intronic
1068964250 10:62895814-62895836 TTTTGTGTTTGTAGTAAAGATGG - Intronic
1069372753 10:67764927-67764949 TTCTGGGATGGAAGGGAAGGTGG - Intergenic
1069492203 10:68870710-68870732 TTCTGTGTTTGAAGATGAAGGGG + Intronic
1069660829 10:70122437-70122459 TTTGGTGTTTGAAGCTAAGGGGG - Intronic
1073558609 10:104478364-104478386 TTCTGTGTTGGGAATAAAGGTGG - Intergenic
1073928119 10:108541190-108541212 TTTTGTGTATGAAGTGAAATAGG - Intergenic
1074072810 10:110090026-110090048 TTCTGTACTTGAGGTGATGGTGG - Intronic
1074212336 10:111347734-111347756 TTGTTGGTTTGAAGTGGAGGAGG + Intergenic
1076002534 10:126923735-126923757 TTCTGTGTATGAAGTGGGGAGGG - Intronic
1076476401 10:130756753-130756775 TGCCTTGTTTGAAGTGAACGGGG - Intergenic
1078163761 11:8864927-8864949 TTCTTTCTTTGATGTGAAGTTGG - Intronic
1078353708 11:10617321-10617343 TTCTGTATTTGTGGGGAAGGAGG - Intronic
1078626179 11:12960848-12960870 TTCAGTGTTAGTAGTGAAAGTGG + Intergenic
1079418015 11:20258628-20258650 TGCTGTGTTTCAAATGAATGGGG + Intergenic
1079649951 11:22915309-22915331 TTCTTTGTTTAAAGTTCAGGTGG + Intergenic
1080362899 11:31536520-31536542 TTTTGTGTTTTTAGTAAAGGCGG + Intronic
1080973804 11:37310361-37310383 TTCTGTGTTTTTTGTGGAGGTGG + Intergenic
1082670094 11:56025269-56025291 GTCTGTTTCTAAAGTGAAGGAGG - Intergenic
1082865817 11:57899277-57899299 TTCTGTGTTTGAAATGGGGAAGG - Intergenic
1083389057 11:62334768-62334790 TTCTGGGTCAGAAATGAAGGAGG - Intergenic
1083584602 11:63847635-63847657 TTCAGTGTTTGGGGAGAAGGGGG - Intronic
1084017227 11:66391791-66391813 TTTTGTGTTTTTAGTAAAGGTGG - Intergenic
1084622166 11:70280076-70280098 TTCTGTATTTTCAGTGGAGGTGG + Intronic
1087979248 11:104590694-104590716 TTTTTTTTTTGAAGTGTAGGTGG - Intergenic
1088558985 11:111093212-111093234 TCATTTGTTTAAAGTGAAGGTGG + Intergenic
1088585582 11:111357663-111357685 TTCTGTGTCTGCAGTGACAGAGG - Exonic
1088621174 11:111685491-111685513 ATTTCTGTTTGAAGTGAAGAGGG + Intronic
1088714888 11:112540371-112540393 TGCTGTGATTGAAGTGGATGGGG + Intergenic
1089976228 11:122734055-122734077 TTTTGTGTTTTAAGTAAAGATGG + Intronic
1090277333 11:125429375-125429397 GTCTGTCTCTGAAGTGCAGGTGG - Intronic
1092558990 12:9589656-9589678 TTCTGTGTTTCTAGTGGAGATGG - Intergenic
1092876434 12:12852426-12852448 TCCTGTGTTTGTAGTGATGCTGG + Intergenic
1093288574 12:17296941-17296963 TCCTGTCTCTGAAGAGAAGGAGG + Intergenic
1093289692 12:17304568-17304590 TCCTGTTTCTGAAGAGAAGGAGG + Intergenic
1093375731 12:18425322-18425344 TTGTGTTTTTGAAGTAAAGAAGG + Intronic
1093553146 12:20438963-20438985 TTTTGTGTTTTTAGTGAAGACGG + Intronic
1094344754 12:29454909-29454931 TTATTTGTCTGAAGTGAAGCAGG + Exonic
1097444152 12:59647626-59647648 TTCTGCTTCTGCAGTGAAGGTGG - Intronic
1097500624 12:60396103-60396125 TTCTAAGTTTGAAATGAAGGAGG + Intergenic
1098517529 12:71394874-71394896 TTCAGTACTTGAAGTGAAAGAGG - Intronic
1098881762 12:75924663-75924685 TTCTGTGCTGGAAGTGAAACTGG - Intergenic
1099693939 12:85994551-85994573 TTCTATGTTTGAGGTGGGGGAGG - Intronic
1100099140 12:91081063-91081085 ATGTGTGATGGAAGTGAAGGGGG + Intergenic
1100729940 12:97453794-97453816 TTCTATGTTTGAAGAAATGGAGG - Intergenic
1100851156 12:98712988-98713010 TTCTGTTTTTGTAGAGATGGAGG + Intronic
1101189679 12:102318909-102318931 TTCTGTGTTTGAAGGGATCCAGG + Intergenic
1101219335 12:102620506-102620528 TAATGTCTTTGAAGTGAGGGGGG - Intergenic
1102218434 12:111178495-111178517 TTCTGTGTTTTAAATGGGGGAGG - Intronic
1102344748 12:112152422-112152444 TTCAGTGGTAGGAGTGAAGGTGG + Exonic
1102724979 12:115054549-115054571 TTTTGTGTTTTAAGTAGAGGAGG + Intergenic
1103004995 12:117414009-117414031 TGCTGTGCTTGAAGTACAGGAGG - Intronic
1104144373 12:126018664-126018686 TTCTGTTTTTGGCTTGAAGGTGG - Intergenic
1104717873 12:131028606-131028628 TTCTGTGTCTGCAGTGCAGTAGG + Intronic
1104878910 12:132055729-132055751 GTGTGTGTGTGAAGTGTAGGAGG + Intronic
1104941262 12:132396468-132396490 TCCTGTCTCTGAAGAGAAGGAGG + Intergenic
1106505128 13:30364522-30364544 TTCTGTGGTTTCACTGAAGGCGG + Intergenic
1107042385 13:35962996-35963018 TTCTATCTTAGAAGTCAAGGAGG - Intronic
1107511321 13:41088337-41088359 TTCTAGGCTTGAAGTGAAGATGG - Intergenic
1107653473 13:42568403-42568425 TTGTGTGATTTAAGTTAAGGGGG + Intronic
1107876275 13:44793479-44793501 TTTTGTGTTTTAAGTAAAGATGG - Intergenic
1108167039 13:47704134-47704156 TTCTGTTTCTGAAGCGAATGCGG - Intergenic
1109257308 13:60098685-60098707 ACCTGTGTTTGAATGGAAGGAGG - Intronic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1110727894 13:78847180-78847202 TTATTTGTTGGAAATGAAGGAGG + Intergenic
1110916270 13:81024979-81025001 TTATGTTTTTGAAGTGCAGCTGG - Intergenic
1111682373 13:91459387-91459409 TTGGGTGTTTGCAGTGGAGGTGG + Intronic
1111688480 13:91530500-91530522 TTCAATGTTTAAAATGAAGGAGG - Intronic
1112620525 13:101049801-101049823 ATCTGTGTTTGAAGCCAAGGAGG + Intergenic
1112698099 13:101973037-101973059 TTCTTCTTTTTAAGTGAAGGAGG - Intronic
1112754552 13:102616828-102616850 TGCAGTGTTAGAAGTCAAGGTGG - Intronic
1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG + Intergenic
1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG + Intronic
1113820788 13:113210928-113210950 TTCTTTGTCTGAAGTGTAAGTGG + Intronic
1114740161 14:25088608-25088630 TTCTTTTTTTGAGGTGGAGGCGG + Intergenic
1116589685 14:46755757-46755779 TTATGTGTTTTCACTGAAGGTGG + Intergenic
1118403488 14:65401092-65401114 TTCTGTTTATGAAGTCAAGTGGG - Intergenic
1118867028 14:69712003-69712025 TTCTGGGTTTGTGGTGACGGAGG + Exonic
1119358492 14:74027255-74027277 TTTTGTGTTTGTAGTAAAGACGG + Intronic
1120079422 14:80198692-80198714 TTCTATTTTTAGAGTGAAGGAGG + Intronic
1120170078 14:81239366-81239388 TTCTGTGTTTTTAGTAGAGGTGG + Intergenic
1120994076 14:90402052-90402074 TACTGTGTTTAAAGAGGAGGAGG + Intronic
1122454678 14:101841287-101841309 TTCAGAGTTAGAAATGAAGGGGG + Intronic
1122586210 14:102808340-102808362 TTTTGTATTTGTAGTAAAGGTGG - Intronic
1124394276 15:29287340-29287362 TTCTGTGATTGCAGTGTAGCTGG - Intronic
1125938367 15:43657182-43657204 TTTTTTGTTTGAATTGAAGGGGG + Intronic
1125950643 15:43748496-43748518 TTTTTTATTTGAATTGAAGGGGG + Intronic
1126116232 15:45210169-45210191 TTCTCTTCCTGAAGTGAAGGTGG + Intergenic
1126203116 15:46011593-46011615 TTTTGTGTTTTTAGTGGAGGTGG + Intergenic
1126770052 15:52047156-52047178 CTCTCTGTTTGAAATGAAGGTGG + Intronic
1127371076 15:58342223-58342245 AACCGTGATTGAAGTGAAGGGGG - Intronic
1127378544 15:58407590-58407612 GTCTCTGTTTGAAATGAATGAGG + Intronic
1128534935 15:68483279-68483301 TTCTGTGTTCGGCGTGAAGTTGG + Intergenic
1129125679 15:73438909-73438931 TTGTTTGTGTGAAGTGAAGTAGG - Intergenic
1130633739 15:85596670-85596692 TTCAGTGTTTGTACTGAAGATGG + Intronic
1130690150 15:86075336-86075358 TTCTGTGTTTAGAGTGGAGCGGG + Intergenic
1131773236 15:95763954-95763976 TTCTGTGATTGCATTGAAGGAGG + Intergenic
1131784239 15:95894327-95894349 TTCTGTGTTTGATGTTACTGTGG + Intergenic
1132394468 15:101462726-101462748 TTTTGTGTTTGATGTGAAGTAGG - Intronic
1132488231 16:208655-208677 TTTTGTTTTTGAGGTGAAAGGGG - Intronic
1133264266 16:4574002-4574024 TTTTGTGTTTTTAGTGGAGGTGG + Intronic
1133282411 16:4674457-4674479 TTTTGTGTTTTAAGTGGAGATGG + Intronic
1133803175 16:9100966-9100988 TTCTGTTTCTGAAGAGAATGAGG - Intronic
1134061780 16:11203625-11203647 TTTTGTGTTTAAAGAGATGGGGG - Intergenic
1134794947 16:17026494-17026516 TTTTGTGTTTTTAGTGGAGGCGG - Intergenic
1136273792 16:29165998-29166020 TTCTGTATTTGAGATGAAGAAGG + Intergenic
1137638849 16:50010722-50010744 TTTTGTGTTTTTAGTGAAGATGG - Intergenic
1139420836 16:66848712-66848734 TTCTGTGTGTGAACTGGGGGAGG + Intronic
1140188548 16:72795410-72795432 CTCTGTTTTTGAATTGAAGGTGG + Exonic
1141735830 16:85852039-85852061 TCCTGTGTTTGAAGATAAAGTGG + Intergenic
1142077335 16:88127743-88127765 TTCTGTATTTGAGATGAAGAAGG + Intergenic
1142528869 17:565229-565251 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1142913846 17:3117535-3117557 ACCTGTGTTTGGAGTGAAGTTGG + Intergenic
1143909535 17:10236294-10236316 TTTTGTGTTTTTAGTGAAGACGG - Intergenic
1144565403 17:16355017-16355039 TTCTGTATCTGAAGTGGTGGTGG - Intergenic
1145196495 17:20898859-20898881 TATTGTTTTTGAAGTGAAAGGGG + Intergenic
1146204131 17:30887318-30887340 TTCTGGATTAGAAGTGGAGGTGG + Exonic
1147204447 17:38826658-38826680 TTTTGTGTTTGTAGTAAAGATGG + Intergenic
1147859285 17:43508156-43508178 TTGTATGTTTGAAATGATGGTGG + Intronic
1148144545 17:45354689-45354711 TTCTGTTTTTTAAATAAAGGTGG + Intergenic
1149753290 17:59166267-59166289 ATCTGAGTTTGAAGGGAAGGAGG + Intronic
1150505976 17:65699624-65699646 TTGTTTGTTTGAAGAGATGGGGG + Intronic
1151270843 17:72994857-72994879 TTATATGTTGGAGGTGAAGGAGG + Intronic
1151311327 17:73294178-73294200 TTCTGTGTTTTTAGTGGAGATGG - Intronic
1151464349 17:74274933-74274955 TTCTGTGGTTCAAGAGAATGTGG - Intronic
1152948113 17:83209439-83209461 TTCTGTCTGTGAGGTGAAGCGGG + Intergenic
1153027622 18:685992-686014 TTCTAGGTTTAAAGTAAAGGTGG - Exonic
1153106345 18:1532308-1532330 ATCAGTGCTTGAAGTGAAGTTGG + Intergenic
1153388025 18:4521671-4521693 TTGTGCATTTGAAGTGAATGAGG + Intergenic
1153822000 18:8839989-8840011 CTCTGTCTTTGAAGTGGAGTGGG - Intergenic
1153835680 18:8962158-8962180 TTCAGTGCTAGAAGAGAAGGTGG - Intergenic
1153925260 18:9830183-9830205 TTATGTGTTTGTAGAGATGGGGG + Intronic
1155098041 18:22579117-22579139 TTCTGTGAATGAAGTGAAGAGGG + Intergenic
1155284020 18:24270936-24270958 TTCTGGGTTTGGAGAGAGGGTGG - Intronic
1157818097 18:50745438-50745460 TTTTGTGATTGATTTGAAGGAGG - Intergenic
1159829779 18:73261801-73261823 TTCTGTGTTTTCAGTGAATTGGG - Intronic
1159888397 18:73932397-73932419 TTCTGTGTTCTGTGTGAAGGAGG + Intergenic
1160466931 18:79085614-79085636 TTTTGTGTTTTAAGTGATAGTGG + Intronic
1161005180 19:1932107-1932129 TTCTGTGTTTCAAAGGAGGGTGG - Intergenic
1161855281 19:6760986-6761008 TTCTGTGGATGAAGTTCAGGGGG + Exonic
1162196602 19:8989665-8989687 TTTTGTATTTGTAGTGAAGACGG - Intergenic
1162414558 19:10527303-10527325 TTTTGTATTTTTAGTGAAGGTGG + Intergenic
1162641741 19:12015713-12015735 TCATGTGTTTGAAGTGAACTGGG + Exonic
1162856668 19:13473851-13473873 CTCAGAGTTAGAAGTGAAGGTGG - Intronic
1163397042 19:17069822-17069844 TTCTGTCTTCCCAGTGAAGGAGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164502476 19:28831490-28831512 TTCTGTGGTTGACGTGGAGACGG - Intergenic
1165056434 19:33179258-33179280 TTTTGTATATGATGTGAAGGAGG + Intronic
1165086750 19:33354405-33354427 TTTTGTGTTTTTAGTAAAGGTGG + Intergenic
1165923250 19:39311615-39311637 TTCTGTCTTTGAAATGGAGAGGG + Intronic
1166009663 19:39933124-39933146 TTCTGTTTTTAAAGAGAATGTGG + Intronic
1167009015 19:46794335-46794357 TTTTGTGTTTTTAGTGGAGGTGG - Intergenic
1167231318 19:48285711-48285733 TTCTTTGTTGAAAGTAAAGGTGG - Intronic
1167328495 19:48839317-48839339 TTTTGAGGGTGAAGTGAAGGGGG + Intronic
1168019139 19:53595973-53595995 TTTTGTATTTTTAGTGAAGGGGG - Intergenic
925124278 2:1443212-1443234 TACCGTGTTTGAAGGGAATGGGG + Intronic
925124497 2:1444483-1444505 TACTGTGTTGGAAGGGAATGGGG + Intronic
925124594 2:1445082-1445104 TACTGTGTTGGAAGGGAATGGGG + Intronic
925995044 2:9285351-9285373 TTCAGTGTTTGAAGTGGGGATGG - Intronic
926317024 2:11717490-11717512 TTCTGTGTTTGGAGGGTGGGGGG - Intronic
927169919 2:20360710-20360732 TTCTGTCCTGGAAGAGAAGGAGG - Intergenic
927346359 2:22047382-22047404 TTTTGTGTTTGGCGTGAAGTGGG - Intergenic
927457023 2:23261680-23261702 ATCTGTGTTTGGAGTGAAGGTGG + Intergenic
928662622 2:33519117-33519139 TCATGTGTTTGTAGTGATGGTGG - Intronic
929329156 2:40658759-40658781 TGCTGTGTTTTAAGTGAGGATGG - Intergenic
929637407 2:43538392-43538414 TTATGTGATTACAGTGAAGGAGG + Intronic
930081599 2:47453901-47453923 TTCTATTTTTGAAGTAAATGTGG + Intronic
930517799 2:52430968-52430990 TCCTGTCTCTGAAGAGAAGGAGG + Intergenic
930751972 2:54943137-54943159 TTCTGTTTTCTCAGTGAAGGAGG - Intronic
930979051 2:57499372-57499394 TTTTGTTTTTGAAGGGAAGTAGG - Intergenic
931327676 2:61243698-61243720 TTTTGTGTTTTAAGTGGAGACGG - Intronic
931573205 2:63691462-63691484 TTTTGTGTTTTTAGTGGAGGTGG - Intronic
931698171 2:64887743-64887765 TCCTGTCTCTGAAGAGAAGGAGG - Intergenic
931699767 2:64899984-64900006 TCCTGTCTCTGAAGAGAAGGAGG - Intergenic
932292297 2:70592783-70592805 TTATGTGTTTTAAGTGAAAAGGG + Intergenic
932942749 2:76188231-76188253 TTCTGTGTATTTAGAGAAGGAGG + Intergenic
933935808 2:87202991-87203013 TCCTGTCTCTGAAGAGAAGGAGG - Intergenic
935143416 2:100376550-100376572 TCCAGTGTTTGAGGGGAAGGAGG + Intergenic
935394394 2:102590535-102590557 GTCAGCTTTTGAAGTGAAGGAGG - Intergenic
935528345 2:104200638-104200660 TTTTGTTTTTGAATTGGAGGTGG - Intergenic
935723599 2:106001585-106001607 TTTTGTGTATGAAGTGAAGAAGG + Intergenic
936357340 2:111762839-111762861 TCCTGTCTCTGAAGAGAAGGAGG + Intergenic
936489505 2:112958115-112958137 CTCTGTGTTTCAAGTGAAATAGG - Intergenic
936878532 2:117221507-117221529 TTGTGAGTTTGAAGATAAGGTGG + Intergenic
937006229 2:118518940-118518962 TTCTGTGTATGATGTGATGTGGG - Intergenic
937983150 2:127626606-127626628 TTCTGTGTTTTTAGTAGAGGGGG - Intronic
938395888 2:130947678-130947700 TTCTGTGTTAGAAGGGAATTGGG + Intronic
938889714 2:135692081-135692103 TTTTGTGTTTTTAGTGTAGGCGG + Intronic
939272454 2:139958089-139958111 TTCTGTTTTATAAATGAAGGAGG + Intergenic
940069535 2:149670177-149670199 TGCTGTGGTTGATGTGATGGTGG + Intergenic
940588333 2:155686019-155686041 GATTGGGTTTGAAGTGAAGGGGG - Intergenic
940873771 2:158881315-158881337 TTCTGTCTCTGAAGAGGAGGAGG + Intergenic
941137144 2:161732445-161732467 ATCTGTGTTTGAAGACTAGGGGG - Intronic
943906618 2:193507054-193507076 TTTTGTGTTTGAAATGAGGCAGG - Intergenic
944951771 2:204758681-204758703 TTCTGAGATTGACTTGAAGGAGG + Intronic
945317494 2:208386040-208386062 TTCTGTATCTGAAGAGATGGAGG - Intronic
946011447 2:216567364-216567386 GGCAATGTTTGAAGTGAAGGTGG + Intronic
947054032 2:226079936-226079958 TTCTCTGTTTGGAGTGGGGGTGG + Intergenic
947629628 2:231643676-231643698 TTCTGTCTGTGAAGTGAGTGGGG - Intergenic
948379445 2:237542365-237542387 TTCTGTGGTTGTTGAGAAGGGGG - Intronic
1169655678 20:7920208-7920230 TCCTGTGTGTGAAGTGAAGGGGG - Intronic
1170066294 20:12314261-12314283 TTCTGTGTTTCCAGTGAAAAGGG + Intergenic
1170920978 20:20679166-20679188 GTCTGTGTTTGAGGTGCATGGGG - Intronic
1171319399 20:24227215-24227237 TTCTATATGTGAAATGAAGGAGG + Intergenic
1171353063 20:24519869-24519891 TTCTGTGTTTTTCGTGATGGCGG - Intronic
1172952502 20:38730925-38730947 TTCTATGGTGGAAGGGAAGGTGG + Intergenic
1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG + Intronic
1175693389 20:61082795-61082817 TTCTGTGTTTAAATTGAAATAGG - Intergenic
1176919644 21:14672296-14672318 TTCTGTGTTTGATGTGAGGTAGG + Intergenic
1177246891 21:18537873-18537895 ATATGTCCTTGAAGTGAAGGTGG + Intergenic
1178749132 21:35283979-35284001 ATCTGTGTTCCAAGTGGAGGAGG - Intronic
1179877018 21:44273763-44273785 TTCTGTGTATGGTGTGAAGTAGG - Intergenic
1183377096 22:37471658-37471680 TTTTGTGTTTTTAGTGGAGGCGG - Intronic
1183770520 22:39921529-39921551 TTTTGTGTTTGTGGAGAAGGAGG + Intronic
1183781373 22:40001182-40001204 TTCTGTTTTTGACATGAAGCTGG - Intronic
1184966530 22:47977054-47977076 TTTTGTGTGTGATGTGAAGAGGG + Intergenic
949544303 3:5059351-5059373 TTCTGTGTTTTTAGTAGAGGTGG + Intergenic
949759566 3:7454470-7454492 TTGTGTAACTGAAGTGAAGGAGG + Intronic
950700407 3:14741538-14741560 TTCTGTGTTTTCTGAGAAGGAGG + Intronic
950716147 3:14849011-14849033 TTCTGTGTTTGGAGTAGAGGAGG + Intronic
950853333 3:16083252-16083274 TTGTGTGATGGAAGTGGAGGTGG + Intergenic
951223791 3:20097225-20097247 TACCCTGTTGGAAGTGAAGGTGG + Intronic
951943461 3:28108515-28108537 TCATGTGGTTGAAATGAAGGGGG - Intergenic
952371240 3:32724727-32724749 TTTTGTGTTTTTAGTGGAGGTGG + Intronic
952681528 3:36099073-36099095 TTTTTTGTTTAAAGTGAAAGAGG + Intergenic
953620481 3:44528536-44528558 TTCTATGTGTGTAGTGAAGGTGG + Intergenic
953857899 3:46515325-46515347 TTGTATGTTGGAAGTGTAGGGGG - Intergenic
954939460 3:54358127-54358149 TTGTGTGTGTGAGGTGGAGGTGG + Intronic
955586061 3:60479516-60479538 TTATGTGTTTGCAGTGATGCTGG + Intronic
955651711 3:61201877-61201899 TTCTGTGTTTGAAGTGGAAAGGG - Intronic
956151225 3:66245078-66245100 TTCTATTTTTGAAGAGATGGGGG + Intronic
956829980 3:73037129-73037151 GTCTGTGTATTAAGTGGAGGGGG - Intronic
957260845 3:77899464-77899486 TCATGTGTTTGTAGTGAAGCTGG - Intergenic
957693392 3:83600466-83600488 TCCTTTCTTTGAAGTGATGGTGG + Intergenic
957962462 3:87275006-87275028 TTCTGTGTTTGAAGATAATTTGG - Intronic
958727558 3:97924247-97924269 TTTTGTGTTTGGAGTAAAGTAGG - Intronic
959265559 3:104132954-104132976 TTCTGTGTCAGAAGAGAAGAAGG + Intergenic
960855633 3:122099434-122099456 GTTTGTGTTTGAAGTAATGGAGG + Intronic
962188529 3:133285919-133285941 CTATGTGTTTGAGGTGGAGGGGG + Intronic
963256115 3:143146462-143146484 TTCCATGGTTGAAATGAAGGTGG - Intergenic
963721488 3:148866925-148866947 TTTTGTGTTTTTAGTGAAGACGG + Intronic
964147177 3:153478732-153478754 TCATGTGTTTGCAGTGAAGCCGG - Intergenic
964352386 3:155815906-155815928 TTTTGTATTTTTAGTGAAGGCGG - Intergenic
964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG + Intergenic
965182589 3:165423857-165423879 TTGTGTGTGGGAAGAGAAGGTGG - Intergenic
966265830 3:178042004-178042026 TGCTGTGTTTGAAATGAGAGTGG + Intergenic
967646968 3:191936898-191936920 CTCTGTGTTTTAGGTGCAGGTGG + Intergenic
968096325 3:195933187-195933209 TCCTGTCTCTGAAGAGAAGGAGG + Intergenic
969324050 4:6430752-6430774 TTTTGTGTTTTTAGTGGAGGCGG - Intronic
970008131 4:11429256-11429278 TCCCGTGTTTGCAGTGACGGCGG - Exonic
970096651 4:12471050-12471072 TTCTGTCACTGAAGTGAATGAGG - Intergenic
970300686 4:14678679-14678701 TTCTGTGTTTAATGTAAAGGAGG + Intergenic
970371088 4:15407299-15407321 TTCTGTGGATGAAGTGAATTTGG - Intronic
971742599 4:30539628-30539650 CTTAGTGTTTGAAGTGAAAGAGG - Intergenic
971834046 4:31738348-31738370 ATCTGTTTTTGAAGGAAAGGCGG + Intergenic
972942992 4:44220005-44220027 TTCTGTTTTAGAAGTAATGGTGG + Intronic
972961477 4:44458320-44458342 TCCTGTGTTTGTAGTGATGCTGG - Intergenic
974410255 4:61531928-61531950 GTCTGTGTTTCAAATGAAGGTGG + Intronic
974701859 4:65460814-65460836 GTGTGTGTTTGAGGTGAATGAGG + Intronic
974940824 4:68465658-68465680 TTCTGTGGTTTAAGTGAAGAGGG + Intronic
976614185 4:87059308-87059330 TTCTGTGTGTGAAGTGATACAGG - Intronic
977254600 4:94726991-94727013 TTCTGTTTTTGAAAAGAAAGAGG - Intergenic
977848677 4:101797954-101797976 TTCAGTGTTGGTAGAGAAGGAGG + Intronic
978003794 4:103591425-103591447 TTGTATGTTTCCAGTGAAGGTGG + Intronic
978157662 4:105508465-105508487 TTCTGACTTTGAAATGAAAGGGG - Intergenic
978609508 4:110522047-110522069 TTTTGTATTTTTAGTGAAGGCGG + Intronic
979150883 4:117312525-117312547 TTATGTTAATGAAGTGAAGGAGG - Intergenic
979532163 4:121780352-121780374 TTATTTGTTTGTAGAGAAGGGGG - Intergenic
979880594 4:125953689-125953711 TTCTGTGGATGAAATGAATGTGG + Intergenic
981245120 4:142526395-142526417 TTCTGTGGTGGAAGTGGAGGTGG + Intronic
981734120 4:147931635-147931657 CTCTGTATTTGGAGAGAAGGTGG + Intronic
981945683 4:150340934-150340956 TTCTATGTTTGATGTGAAATAGG + Intronic
982188836 4:152832742-152832764 TTTTGTGTATGATGTGAAGTAGG + Intronic
982677629 4:158394295-158394317 TTTAGTGTTTGAAGTGAAGGAGG + Intronic
982752566 4:159179681-159179703 TTCTGTGTGAGAAGTGAAGGAGG + Intronic
986694695 5:10341059-10341081 CTCTGTGTTTTGAGTGAGGGAGG + Intergenic
986896324 5:12374069-12374091 TTCTATGTTTAAAGTAAAGTAGG + Intergenic
987549859 5:19365480-19365502 TGCTGTGTTTGTAGTGATGATGG - Intergenic
988126109 5:27039896-27039918 TTCTGTGTTTGAAGTGTAGGAGG + Intronic
988633902 5:32960771-32960793 TTCTGTTTATGAAGAGAAAGAGG - Intergenic
988826312 5:34939038-34939060 TTTTGTTTTTTAAGTGAAGCTGG + Intronic
992398277 5:76387349-76387371 TTTTGTTTTTTAAGAGAAGGTGG + Intergenic
993033468 5:82730909-82730931 TTGTGCGTTTGCAATGAAGGAGG - Intergenic
993308563 5:86299242-86299264 TTCTGTGTTTGTACTGGAGGTGG - Intergenic
993327924 5:86565482-86565504 TCCTGTCTCTGAAGAGAAGGAGG - Intergenic
993849006 5:92982724-92982746 TTCTGTGATTTCAGTGATGGGGG - Intergenic
995421347 5:111970653-111970675 TTCTGTGTTTTTAGTGGAGGCGG - Intronic
995710544 5:115031043-115031065 TTGTTTGTTAGAAGTGATGGAGG - Intergenic
997047463 5:130335644-130335666 GTTTGTGATTGAAGTGAAGAAGG - Intergenic
997153818 5:131529303-131529325 TTTTGTGTTTTTAGTGGAGGTGG - Intronic
997677900 5:135727949-135727971 TTCTGTCTTTTAAGGGAACGTGG + Intergenic
998523329 5:142819828-142819850 TTTTTTTTTTAAAGTGAAGGTGG + Intronic
998911720 5:146967316-146967338 TTTTGTCTTTGAAGTGAACGTGG - Intronic
999341033 5:150772713-150772735 TTATGTGTTTGTAGTGATGCTGG - Intergenic
999368094 5:151035856-151035878 TACTCTGTTTGAAGTTAAGGTGG - Intronic
999687465 5:154115882-154115904 TTCTGTGTATGAAGAAAGGGAGG - Intronic
1001608117 5:172978405-172978427 TTTTGTATTTGTAGTGGAGGTGG - Intergenic
1002742280 5:181442594-181442616 TTCTGTCTGTGAGGTGAAGCGGG + Intergenic
1003182489 6:3804204-3804226 TTCTTTGTTTCAGGTGAAGATGG - Intergenic
1004299951 6:14448452-14448474 TCCTGTGTTTTATGTTAAGGTGG + Intergenic
1004373545 6:15073204-15073226 TTCTATGTTTTTAGTGGAGGCGG + Intergenic
1005147567 6:22708832-22708854 TTCTGAGTTTGAAAAGATGGGGG - Intergenic
1006326279 6:33356394-33356416 TTCTGGGTTTGTGGTGACGGAGG + Intergenic
1006573710 6:35027236-35027258 TTCTGTGTTCCAAGTGGTGGTGG - Intronic
1008026117 6:46637666-46637688 GTCTGTATGTGAATTGAAGGAGG - Intronic
1008443084 6:51555324-51555346 TTCTGTATTTGTAGTAGAGGTGG - Intergenic
1009043989 6:58215679-58215701 TTCCTTGTTTGAAGTATAGGTGG + Intergenic
1009219816 6:60969939-60969961 TTCCTTGTTTGAAGTATAGGTGG + Intergenic
1009402368 6:63271969-63271991 TTCAGTGTTTGAAGTGAAAAAGG - Intergenic
1010797193 6:80131256-80131278 TGCTGAGTTTGAAGTGACTGTGG - Intronic
1011044081 6:83062899-83062921 TTTTGTGTTTGCAGTGAAGTAGG - Intronic
1011200841 6:84834472-84834494 TGCTGTGTCTGAAATGGAGGGGG + Intergenic
1011567301 6:88689973-88689995 TTATATGTTGGTAGTGAAGGGGG - Intronic
1012284266 6:97369524-97369546 TACTGTTTTGGTAGTGAAGGAGG - Intergenic
1012611423 6:101225102-101225124 TCCTGTCTCTGAAGAGAAGGAGG - Intergenic
1012961154 6:105623295-105623317 TTCTGAGTATGAAGAGAAAGAGG - Intergenic
1013629296 6:111970087-111970109 TAGTGTGTTTGAAGAGAAGGAGG + Intergenic
1013858777 6:114608433-114608455 TTCTCTGTTTGCACTGAGGGAGG + Intergenic
1013920710 6:115399382-115399404 TTTTGTGTAAGAAATGAAGGAGG - Intergenic
1015121817 6:129708445-129708467 TTCTGTGTTTGCAGTGTGGGTGG - Intronic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1015590642 6:134819708-134819730 TGCTGTGTTTGAACTGATGTTGG + Intergenic
1015855944 6:137624802-137624824 TTCTCTGCTTGAAGAGAAAGGGG - Intergenic
1016475247 6:144420083-144420105 CTCTGAGTTTGAAATGGAGGAGG - Intronic
1019247416 6:170718332-170718354 TTCTGTCTGTGAGGTGAAGCGGG + Intergenic
1019581536 7:1766095-1766117 TTTTGTGTTTTTAGTGGAGGCGG + Intergenic
1020122445 7:5512803-5512825 TTCTACATTTGAAGTGAATGCGG - Intronic
1023279154 7:38552262-38552284 CTCTGTTTCTGAAGTGCAGGGGG - Intronic
1023976842 7:45036824-45036846 TTCTGTGTTTGGTGATAAGGGGG + Intronic
1024004185 7:45213160-45213182 TGCTGTGTGTGCGGTGAAGGGGG + Intergenic
1024066870 7:45745388-45745410 TTCAGTGGTGTAAGTGAAGGGGG + Intergenic
1025212180 7:57026072-57026094 TTCTGAGTCTGAAGGGAGGGAGG - Intergenic
1025639235 7:63351614-63351636 CTGTGTGTTTCAAGTGGAGGAGG + Intergenic
1025643464 7:63396478-63396500 CTGTGTGTTTCAAGTGGAGGAGG - Intergenic
1025659774 7:63550756-63550778 TTCTGAGTCTGAAGGGAGGGAGG + Intergenic
1025713056 7:63929488-63929510 TTGTGTGTTTCAAGTGGAGGAGG - Intergenic
1028266763 7:88734968-88734990 TGCTGTCTTTGAAGAGAAAGAGG - Intergenic
1028283125 7:88958633-88958655 TTCTGACTTTGAATCGAAGGAGG + Intronic
1028479930 7:91293376-91293398 TTCTGTGTTTATACTGATGGTGG - Intergenic
1028725909 7:94087790-94087812 TTGTTTGTTTGGAGTGAAGGAGG + Intergenic
1029185969 7:98738922-98738944 TTCTGTATTTGTAGTAGAGGTGG + Intergenic
1029347502 7:99989171-99989193 TTTTGTGTTTTCAGTGAAGACGG - Intergenic
1030138010 7:106276670-106276692 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1030666131 7:112280796-112280818 TTTTGTGTTTGTAGTGGAGATGG + Intronic
1030817211 7:114052825-114052847 TTCTGTCTTTGAAATTGAGGTGG - Intronic
1031268896 7:119619698-119619720 TACTGTGTTTGGAGAGAATGAGG + Intergenic
1032350192 7:131155272-131155294 TTCTGCATTTGAAACGAAGGAGG + Intronic
1033543852 7:142381808-142381830 CTCTGTGTTGGAAAGGAAGGAGG - Intergenic
1033968256 7:147005569-147005591 TTCTTTGTTTCAGTTGAAGGTGG - Intronic
1035500722 8:89604-89626 TTCTGTCTGTGAGGTGAAGCGGG - Intergenic
1035561431 8:607106-607128 TTCTGGTTTTCAAGTGAAGACGG + Intergenic
1036820568 8:11936297-11936319 TCCTGTATCTGAAGAGAAGGAGG - Intergenic
1037327305 8:17705566-17705588 ATCTGTGTTTTAAGTATAGGGGG + Intronic
1038628871 8:29221271-29221293 TTTTGTGTTTTTAGTGGAGGCGG + Intronic
1039496098 8:37981434-37981456 TCCTGTGTTTGTGGTGATGGTGG + Intergenic
1039522178 8:38180350-38180372 TTTTGTGTTTTTAGTGGAGGTGG - Intronic
1041513395 8:58675249-58675271 TTCTGTTTCTGAAGGGCAGGAGG + Intergenic
1041531614 8:58874622-58874644 ATCTGTGTTTTAAATTAAGGTGG - Intronic
1041701665 8:60796632-60796654 TTCTATGTTTGAAATGCAGCAGG - Intronic
1042207627 8:66345065-66345087 TTCTGGGTCTGAGGTGAGGGTGG - Intergenic
1042895170 8:73658740-73658762 TTTTGTATTTGTAGTGAAGACGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1042974333 8:74449019-74449041 TTTTGTGTATGGTGTGAAGGAGG + Intronic
1044079511 8:87866382-87866404 GTATGTGTTTGTAGTGAAAGAGG - Intergenic
1044200647 8:89431647-89431669 TTATGTGTTTGAAGGGAAAAGGG + Intergenic
1044230736 8:89774876-89774898 TTGTGTCTTGGAAGTCAAGGAGG + Intronic
1044426642 8:92059073-92059095 TTCAGGGTTTGAAGGGAAGCTGG + Intronic
1044855826 8:96474635-96474657 TTTTGTGTTTGATATGAAGTAGG - Intergenic
1045106107 8:98894221-98894243 TTCTGTTTATGAGGTCAAGGTGG - Intronic
1045286209 8:100793865-100793887 TTCTGTCTTTGAAATTAAAGTGG + Intergenic
1045427181 8:102078613-102078635 TTGTGTGTGAGGAGTGAAGGTGG - Intronic
1046207705 8:111023149-111023171 TTCAGTGTTGGAAGTGAAGCTGG - Intergenic
1047460281 8:125057328-125057350 TTCTGTGTTTTAAGTGTTGGTGG - Intronic
1048022879 8:130556629-130556651 TTGTTTCCTTGAAGTGAAGGAGG + Intergenic
1048939739 8:139388697-139388719 TTCTCTGTTTTAAGTGGTGGGGG + Intergenic
1051183469 9:14435774-14435796 CTCTGTGTTTAAAAGGAAGGTGG + Intergenic
1051390408 9:16557326-16557348 TTTTGTGTTTTTAGTAAAGGTGG - Intronic
1051682815 9:19625189-19625211 TTGTGTGTTTAAAATTAAGGGGG - Intronic
1052307547 9:27027977-27027999 TTCTGTGTATGATGTGAGGTAGG + Intronic
1054754010 9:68938833-68938855 TTCTGTGTTTGAAGACAGAGGGG - Intronic
1054809066 9:69420520-69420542 TTATGTTTTTGTAGAGAAGGAGG + Intergenic
1055123088 9:72685532-72685554 TTTTGTGTTTGTAGTAGAGGCGG + Intronic
1055991213 9:82107891-82107913 TTATGTGTTTGTGGTGATGGTGG + Intergenic
1056513798 9:87331124-87331146 TTCTGTCTTGGAAATGAAGAAGG - Intergenic
1057585490 9:96324857-96324879 TTGTGTGTTGGAAGTGCAGCAGG - Intronic
1057896098 9:98909849-98909871 TTGTTTGTTTGTAGAGAAGGAGG - Intergenic
1058621847 9:106891507-106891529 TTCTGCTTTTGAAGTTAAGATGG + Intronic
1059174148 9:112153981-112154003 TTATGTGTTTGTAGTGATGCTGG - Intronic
1060245693 9:121944335-121944357 TTTTGTGTTTTTAGTGGAGGCGG - Intronic
1060867447 9:127011347-127011369 TTTTGTGTTTTTAGTGGAGGTGG + Intronic
1061466070 9:130780789-130780811 TTCTGAGTGGGCAGTGAAGGTGG + Intronic
1061896905 9:133652956-133652978 TTCTGTGTTGTACGTGCAGGAGG - Exonic
1062141536 9:134961723-134961745 TGCAGTGTTTGCAGTGAAGCTGG - Intergenic
1203608189 Un_KI270748v1:73809-73831 TTCTGTCTGTGAGGTGAAGCGGG + Intergenic
1185628956 X:1502366-1502388 CTCTGTGTTCGAAGTGGGGGAGG - Intronic
1185645123 X:1610445-1610467 TCCTGTCTCTGAAGAGAAGGAGG - Intergenic
1185668362 X:1786521-1786543 CTTTGTGGGTGAAGTGAAGGGGG - Intergenic
1185779537 X:2832427-2832449 TTTTGTGTTTGAGATCAAGGTGG + Intronic
1186021574 X:5262746-5262768 TTTTGTGTTTTTAGTAAAGGTGG + Intergenic
1186658825 X:11646609-11646631 TTTAGAGTTTGAAGTGATGGTGG + Intronic
1187188810 X:17013441-17013463 TTCTCTGGTTGAATTGAGGGTGG + Intronic
1189212710 X:39298218-39298240 TTTTGTGTATGTAGTGAAAGAGG + Intergenic
1189634613 X:42992829-42992851 TTCTTTGTTTCAACAGAAGGTGG - Intergenic
1190367497 X:49710071-49710093 TTCTTTGTTTTAATTGAAGATGG - Intergenic
1192507593 X:71698397-71698419 TTCTGGGTTTGTGGTGACGGAGG + Intergenic
1192519103 X:71783155-71783177 TTCTGGGTTTGTGGTGACGGAGG - Intergenic
1193406948 X:81112208-81112230 TTTTGTATATGAAGTGAAGTAGG - Intergenic
1194790545 X:98143625-98143647 GACTGTGTTTGATGTGAAAGAGG - Intergenic
1195421771 X:104683492-104683514 TGCTGTGGTTGAAGTGGAGTGGG - Intronic
1196803351 X:119563242-119563264 TACAGTGTTAGAAGTGGAGGTGG + Intronic
1198978630 X:142367253-142367275 TTTTGTATTTTAAGTGAAGACGG - Intergenic
1198992526 X:142531621-142531643 TTATTTGTTTAAACTGAAGGCGG - Intergenic
1200932816 Y:8712413-8712435 TCCTGTTTCTGAAGAGAAGGAGG + Intergenic
1201850760 Y:18477232-18477254 TTTTGTGGGTGAAGGGAAGGTGG + Intergenic
1201882558 Y:18843145-18843167 TTTTGTGGGTGAAGGGAAGGTGG - Intergenic