ID: 1112779191

View in Genome Browser
Species Human (GRCh38)
Location 13:102879479-102879501
Sequence ATGTATACACAGATGAATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112779191 Original CRISPR ATGTATACACAGATGAATCG AGG (reversed) Intergenic
900675494 1:3882874-3882896 ATGTATACGTAGATGAAACGTGG + Intronic
900869239 1:5289973-5289995 ATGGATACATGGATGAATGGTGG + Intergenic
903199048 1:21718170-21718192 ATGTACACACAGATGCAGTGAGG - Intronic
906161345 1:43651061-43651083 AGGCATACAAAGATGAATAGGGG + Intronic
911386638 1:97183674-97183696 ATGTATATACAGATCAATCCAGG + Intronic
911559508 1:99387107-99387129 GTGTAAACACAGTTGAATGGAGG - Intergenic
918399691 1:184151370-184151392 ATGTAAACACAAATGACCCGCGG - Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918656986 1:187039377-187039399 ATGTAGACAAAGAAGAATAGAGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
923721419 1:236470168-236470190 TTGTATACACAGATTAAATGCGG - Intronic
1064485060 10:15778404-15778426 ATTTATTCACAGATGTATAGGGG - Exonic
1065270364 10:24025577-24025599 ATGAATCTACAGATGAATTGGGG + Intronic
1066423123 10:35280055-35280077 ATAGATACAAAGATGAAACGTGG - Intronic
1066676159 10:37889663-37889685 ATGTATACAAAGATATATCACGG - Intergenic
1068444190 10:57098959-57098981 ATGTATACAAATATGATTCAGGG + Intergenic
1069040648 10:63692296-63692318 ATGTTCACACATATGAATTGAGG - Intergenic
1069269337 10:66505451-66505473 ATGTAATCACAGATGACTCAGGG + Intronic
1069765945 10:70859942-70859964 AAGTATACACAGATAAATAGGGG - Intronic
1072017304 10:91360969-91360991 TTCTAGATACAGATGAATCGGGG + Intergenic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1079539415 11:21554007-21554029 ATGTAAAAACATATAAATCGTGG + Intronic
1087012885 11:93530075-93530097 TTTTATACACAGAAGAATCCTGG + Intronic
1088063264 11:105683138-105683160 ATGTATACAGAGAAAAATCATGG - Intronic
1088970021 11:114765691-114765713 AGGTATACACAGATGAAAGTAGG - Intergenic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1092303142 12:7271820-7271842 ATGTATACATAGTTGAATTATGG - Intergenic
1092944805 12:13442851-13442873 ATGTGCACACAGATGACTAGAGG - Intergenic
1095109679 12:38279282-38279304 ATGAACACACAGATGAAAGGTGG - Intergenic
1099479741 12:83150893-83150915 ATCTATAAACAGTTGAATCCTGG - Intergenic
1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112990002 13:105501626-105501648 AAGTATACACAAAAGAATTGCGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116691404 14:48111387-48111409 ATTGATACACAGATGACTCTTGG + Intergenic
1121056057 14:90854017-90854039 GTGTATACACACATGTATTGGGG - Exonic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1133919759 16:10141519-10141541 ATGAATACAGAGAAGAATCAAGG + Intronic
1139508126 16:67409825-67409847 ATGTAAACACAGATGAGACCGGG + Intronic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1141314301 16:82946204-82946226 ATGGATACATGGATGAATGGAGG + Intronic
1144297511 17:13890291-13890313 ATGTATACACAGATAAAAAGGGG - Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1155912356 18:31518583-31518605 ATATATACACAGATGCATAAAGG - Intronic
1158061064 18:53342957-53342979 ATGTATATATAGATGTATTGTGG + Intronic
1160055488 18:75475570-75475592 CTCTATAAACAGATGAATCCTGG - Intergenic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
929725139 2:44417430-44417452 ATGAATACATAAATGAATTGTGG - Intronic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931704300 2:64934450-64934472 ATTTTTACACAGAAGAATCTAGG - Intergenic
933486521 2:82931644-82931666 ATGCATACACAGATGAAAAGAGG - Intergenic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
935128457 2:100243768-100243790 ATCCATCCACAGATGAACCGGGG - Intergenic
935231231 2:101098541-101098563 ATGTATACACTGTTGATTTGGGG - Intronic
940619355 2:156091588-156091610 ATGATTACAAAGATGAATCATGG - Intergenic
941128711 2:161619509-161619531 ATGTAAACACATGTGAATTGTGG + Intronic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
941571377 2:167175046-167175068 ATGTATACACTGTTGATTTGGGG + Intronic
941883983 2:170509607-170509629 TTATATACACAAATGAATCAAGG - Intronic
942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG + Intronic
943079729 2:183244113-183244135 ATTTATACATAGATGAATGCTGG - Intergenic
943432488 2:187822079-187822101 ATGTATACAAATATAAATAGTGG - Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
946366733 2:219253385-219253407 ATGCATACACAGAGGAAAGGGGG + Intronic
1173804646 20:45916266-45916288 TTGTGTACCCAGATGAATCCAGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177006589 21:15680122-15680144 ATGTATACATTGGTCAATCGAGG + Intergenic
1184493271 22:44822926-44822948 ATGTAGGCCCAGATGAATAGAGG + Intronic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
950634557 3:14305751-14305773 TTTTATATACAGATGAATTGAGG + Intergenic
956030413 3:65031057-65031079 ATATATACTCAGATGACTCATGG - Intergenic
957490681 3:80922782-80922804 ATGTATACATCAATGAATCCAGG - Intergenic
957645839 3:82924743-82924765 ATGTATAGACAATTCAATCGAGG + Intergenic
959784703 3:110281662-110281684 ATGTATATATAGATGAGTCTTGG + Intergenic
965954856 3:174357531-174357553 ATGTACACACACATGAAGAGGGG - Intergenic
966305358 3:178527008-178527030 ATGTCTACATATATGAATGGCGG - Intronic
967315228 3:188146094-188146116 ATATATACACAGTTTAATTGAGG - Intergenic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
968397196 4:251357-251379 ATGTATACACACATTTGTCGTGG + Intergenic
970311004 4:14782481-14782503 ATGGATAAACAGATGAATATAGG + Intergenic
976020192 4:80614103-80614125 ATGTATACAGAAATGAAAAGGGG - Intronic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
989264909 5:39462284-39462306 ATGTATGCACACATGAAACATGG - Intronic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
991038646 5:62153675-62153697 ATGTTTACAAAGATAAATCCAGG - Intergenic
991442253 5:66663202-66663224 ATGTATACACACATGCACTGAGG - Intronic
992376410 5:76192188-76192210 AGGTATACACAGATTACTTGGGG + Intronic
993507674 5:88731190-88731212 ATGTATGGAAAGATGAATTGAGG + Intronic
995024682 5:107406238-107406260 ATGTATACAAATATTAATTGTGG + Intronic
995764458 5:115600969-115600991 ATGTTTACACTGTTGAATCATGG - Intronic
996455608 5:123678025-123678047 ATGTATACTCTGTTGAATTGGGG + Intergenic
997826562 5:137111913-137111935 AGGGATTCACAGATGAATGGGGG - Intronic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1008358849 6:50590815-50590837 ATGTAGACACAGATGATTTTAGG - Intergenic
1010184833 6:73132005-73132027 ATGTAAACACACATAAAACGTGG + Intronic
1011522591 6:88225746-88225768 ATGTATATACACATGATTTGGGG - Intergenic
1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG + Intergenic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1018130334 6:160724596-160724618 ATGTTTACACAGAAGAATAGTGG + Intronic
1019704479 7:2490986-2491008 ATTTATACTCAGATGAACCCTGG - Intergenic
1021041570 7:15869313-15869335 ATGTTTCCACAGGTGAACCGTGG + Intergenic
1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG + Intronic
1024159520 7:46660009-46660031 ATGTATACACATATGATACAGGG - Intergenic
1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG + Intergenic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1039603356 8:38860703-38860725 ATGTATACATAGATGAAAAATGG + Intergenic
1043317954 8:78944584-78944606 ATTTATACACACATAAATCTGGG - Intergenic
1045390853 8:101712955-101712977 ATGTATACACTGTTGATTTGGGG - Intronic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1049350653 8:142162773-142162795 ATGGATTGACAGATGAATGGAGG + Intergenic
1049405168 8:142449163-142449185 ACGGACACACAGATGAATGGAGG - Intergenic
1051200674 9:14618951-14618973 ATGTCTAAACAGATGGATGGTGG - Exonic
1051372525 9:16370672-16370694 ATGAATGCACAGTTGAATCATGG - Intergenic
1056827491 9:89886730-89886752 AGGTATAAACAGAGGCATCGAGG + Intergenic
1058410258 9:104724096-104724118 CTTTAGACACAGCTGAATCGAGG - Intergenic
1060510165 9:124225982-124226004 ATGTATACACATATGCATGCAGG - Intergenic
1061963389 9:133999214-133999236 ATGAATACAGGGATGAATGGAGG - Intergenic
1188489028 X:30716978-30717000 ATGTATAAACAGAACAATTGTGG + Intronic
1190394214 X:49963423-49963445 ATGTACACACATATGGATTGGGG - Intronic
1196185255 X:112738625-112738647 AAGTGTACACAGATGAATAGTGG - Intergenic