ID: 1112780621 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:102897173-102897195 |
Sequence | CTGGCTACACATCTGCAGAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1112780614_1112780621 | 17 | Left | 1112780614 | 13:102897133-102897155 | CCCTGCTTCACGGATAAAGAAAC | No data | ||
Right | 1112780621 | 13:102897173-102897195 | CTGGCTACACATCTGCAGAGTGG | No data | ||||
1112780615_1112780621 | 16 | Left | 1112780615 | 13:102897134-102897156 | CCTGCTTCACGGATAAAGAAACT | No data | ||
Right | 1112780621 | 13:102897173-102897195 | CTGGCTACACATCTGCAGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1112780621 | Original CRISPR | CTGGCTACACATCTGCAGAG TGG | Intergenic | ||
No off target data available for this crispr |