ID: 1112780621

View in Genome Browser
Species Human (GRCh38)
Location 13:102897173-102897195
Sequence CTGGCTACACATCTGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112780614_1112780621 17 Left 1112780614 13:102897133-102897155 CCCTGCTTCACGGATAAAGAAAC No data
Right 1112780621 13:102897173-102897195 CTGGCTACACATCTGCAGAGTGG No data
1112780615_1112780621 16 Left 1112780615 13:102897134-102897156 CCTGCTTCACGGATAAAGAAACT No data
Right 1112780621 13:102897173-102897195 CTGGCTACACATCTGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112780621 Original CRISPR CTGGCTACACATCTGCAGAG TGG Intergenic
No off target data available for this crispr